ID: 1142715137

View in Genome Browser
Species Human (GRCh38)
Location 17:1743092-1743114
Sequence CTGGCCAAGGGCTCTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142715130_1142715137 -4 Left 1142715130 17:1743073-1743095 CCAGGTCGGAGTCGGGGCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 160
1142715123_1142715137 24 Left 1142715123 17:1743045-1743067 CCTGTTCTTGGCAAGAAGATTCT 0: 1
1: 0
2: 2
3: 16
4: 182
Right 1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 160
1142715129_1142715137 -3 Left 1142715129 17:1743072-1743094 CCCAGGTCGGAGTCGGGGCCCTG 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142715137 Original CRISPR CTGGCCAAGGGCTCTTGTGT GGG Intronic
900476071 1:2876963-2876985 CTGGCCACGGCCTCGTGTGTGGG + Intergenic
900605390 1:3521449-3521471 CTGGCCAAGGGCTGCCCTGTGGG - Intronic
901066064 1:6495222-6495244 CTGGCATTGGGCTCTGGTGTTGG - Intronic
901264676 1:7901770-7901792 CTGGCCGAGGGTTTTTGTTTTGG - Intergenic
902237428 1:15066459-15066481 CGGGCCAAGGGGCCTTGTCTTGG + Intronic
902652963 1:17848654-17848676 CTGGCAAAGAGCTCTAGAGTGGG - Intergenic
902822610 1:18952345-18952367 CAGGCCAGGGGCTCTGGTTTGGG + Intronic
904330447 1:29754950-29754972 CTGGCCAAGGGCTCTCATCTGGG - Intergenic
904416230 1:30362645-30362667 CTGGCCAAGGGCTCTCATCTGGG + Intergenic
907289383 1:53403072-53403094 CTGGCCCAGGGCTCCTGGGCTGG - Intergenic
910862165 1:91752574-91752596 CTGGCCAAGGCCTCTGGACTAGG + Intronic
913286594 1:117232318-117232340 CTGGCCAGTGGCTCTTGTTGCGG + Intergenic
915696308 1:157746107-157746129 CTGGTCTAGGGCTTTTGTGTTGG - Exonic
920833764 1:209488686-209488708 CTGACCAAGGGCCCTTGGGATGG + Intergenic
1063628991 10:7716911-7716933 CTGGCCATGGGGTCTTGAGCAGG + Intronic
1064859453 10:19811683-19811705 CTGGCACAGGCTTCTTGTGTTGG - Intergenic
1065238999 10:23686559-23686581 CTTGCCCAGAGCTCTTCTGTGGG + Intergenic
1069638500 10:69940296-69940318 CCAGACAAGGGCTCTTGTGTAGG - Intronic
1071069002 10:81669873-81669895 CTCGCCCATGGCTCTTGTGCTGG - Intergenic
1074796858 10:116955427-116955449 CTGGTCAAGGGCTCTAGTAAAGG - Intronic
1076902856 10:133348236-133348258 CTGGGCAGGGGCTCTTGTCTGGG - Intronic
1079543333 11:21602708-21602730 CTGGCCCAAGGCTTTTGTCTTGG - Intergenic
1084433705 11:69125942-69125964 GTGGCCAGGGGCTGGTGTGTGGG + Intergenic
1085205277 11:74727998-74728020 CTGGGTAAGGGGTCTTGTATAGG + Intronic
1086818675 11:91406535-91406557 CTGGCCAATGGCTCCAGTGCTGG + Intergenic
1089282346 11:117383041-117383063 CTGGCCAAGGGTTAGAGTGTAGG + Intronic
1090201691 11:124862157-124862179 CTGGCCCAGGGCTCTTTTCTAGG + Intergenic
1090405884 11:126475616-126475638 CTGGCCCTGGGCTCTTGAGCCGG + Intronic
1093224130 12:16460558-16460580 CCTGCCTAGGGCTTTTGTGTAGG + Intronic
1093540410 12:20276786-20276808 CTGGTCAAGGGCTCTAGAGCAGG + Intergenic
1096407118 12:51351993-51352015 CTGGCCAATGTCTCCTCTGTAGG + Exonic
1096576178 12:52554244-52554266 CTAGCCACTGGCTCCTGTGTTGG + Intergenic
1098672902 12:73253150-73253172 CAGGCCAAGGGCTATTATGGTGG + Intergenic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1105425428 13:20290927-20290949 CTGGGCAAGGTCTTTTGTGGGGG - Intergenic
1105439411 13:20402918-20402940 CTGGCCAGGCTCTCCTGTGTTGG + Intergenic
1106016373 13:25872999-25873021 CTGGCCAGTGGCTGCTGTGTTGG + Intronic
1111268973 13:85854647-85854669 GTGGCCAAGGGTGCTTTTGTTGG - Intergenic
1113635261 13:111914954-111914976 CAGGCCAAGGTCTCCTGTCTGGG + Intergenic
1119187628 14:72654083-72654105 CTGGCCACGAGCTCTTGAGCAGG - Intronic
1123066472 14:105621853-105621875 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1123070613 14:105640906-105640928 ATGGCCCACGGCTCCTGTGTGGG + Intergenic
1123075207 14:105664567-105664589 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1123095640 14:105765855-105765877 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1125512676 15:40301279-40301301 CTTGGCCAGTGCTCTTGTGTGGG - Intronic
1125920889 15:43525013-43525035 CTGGCCAACGGTCTTTGTGTAGG - Exonic
1131046272 15:89318493-89318515 CTGGCCATGTGCTCCTATGTGGG - Intronic
1133475655 16:6119061-6119083 CTTGCCATGGGATCTTGGGTGGG + Intronic
1134836780 16:17368015-17368037 CTGGTCAGAGGCTCTTGTGAAGG - Intronic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1136681698 16:31969583-31969605 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1136782005 16:32911085-32911107 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1136887785 16:33942767-33942789 CTGGCTCAGGGCTTTTGTGATGG - Intergenic
1137601971 16:49762399-49762421 CTGGCCACAGGCTTCTGTGTGGG - Intronic
1138515967 16:57535853-57535875 CTCTCCCAGGGCTCTTGTGGGGG - Intronic
1139329826 16:66178627-66178649 CTGGCCAAGGGCATCTGTGAAGG + Intergenic
1139568995 16:67798767-67798789 CTGGCCAAGAGCCCTTGTCCAGG - Intronic
1140507791 16:75484955-75484977 CTGGCCTTGTGCTCTGGTGTGGG - Intronic
1141158169 16:81611176-81611198 ATGGCCAAAGGCTGCTGTGTTGG + Intronic
1141736636 16:85858540-85858562 GTGACCAATGGCTCTTGTCTTGG + Intergenic
1141790644 16:86232097-86232119 CTGGTGAAGGGCTCTGGTGAAGG + Intergenic
1141801372 16:86311605-86311627 CAGGCCCAGGGCTCTGGGGTAGG + Intergenic
1142367196 16:89656921-89656943 CTGGGCAAGGGGTCCTGGGTCGG + Intronic
1203084664 16_KI270728v1_random:1175071-1175093 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG + Intronic
1148746315 17:49920230-49920252 CTGGCCCCGGGCGGTTGTGTGGG + Intergenic
1149010651 17:51853334-51853356 CTGGACAAGGGCTGGTCTGTGGG + Intronic
1149432291 17:56604034-56604056 CTAGCCATGAGCTGTTGTGTGGG - Intergenic
1150006655 17:61473957-61473979 CTGGGCAAGGCCTCTTGAGTGGG + Intronic
1153355759 18:4133565-4133587 GTGGCTAAGGGCTCTGGTTTTGG + Intronic
1155968080 18:32054649-32054671 CTGCCCAAGGGCTCTGTTGTAGG + Intronic
1160039803 18:75335199-75335221 CTGGGCAGGGGCTCCTGTGAGGG + Intergenic
1161073806 19:2275442-2275464 CTGGCCAGCGCCTCCTGTGTTGG - Exonic
1161262674 19:3346366-3346388 CTGGCCAGGGGCTGTCCTGTGGG + Intergenic
1163228128 19:15979358-15979380 CTGGCCAAGGGCCTCTGTCTTGG + Intergenic
1165068912 19:33244008-33244030 CTGCCCCAGGGCTTTTGTGCTGG + Intergenic
1165232119 19:34393803-34393825 CTGGCCAGAGGCGCGTGTGTTGG + Intronic
1166845934 19:45728531-45728553 CTGGGCAAGGGTTCTTCTTTTGG - Intronic
1167037912 19:47005176-47005198 CTGGCCGAGGCCTCTCCTGTGGG - Intergenic
927174597 2:20396649-20396671 CTGGGCAAGGCCACTTGTGTGGG - Intergenic
927220681 2:20705967-20705989 CTAGCCAAGGGCCTTTGTATTGG - Intronic
928825150 2:35411712-35411734 ATGGTCAAGAGCTCTTTTGTAGG - Intergenic
929559601 2:42947724-42947746 CTGGCCAATGGCTATTGGGCAGG + Intergenic
929844749 2:45511972-45511994 GTCTCAAAGGGCTCTTGTGTGGG - Intronic
933710268 2:85320132-85320154 CTGGCCAAGGCCCCTCCTGTGGG - Intronic
934695635 2:96398007-96398029 GTGGCCAAGGGGTGCTGTGTTGG + Intergenic
936071085 2:109371789-109371811 CTGGCCAGAGGCTATTGTGGAGG - Intronic
937900238 2:127014289-127014311 CTCAGCAAGGGCTCTTGTGAAGG - Intergenic
938107120 2:128540050-128540072 CTGGCCTAAGGCTCTTCTGTTGG + Intergenic
939886688 2:147688999-147689021 CTGGCAATTGGCTCTTGTGCTGG - Intergenic
940170116 2:150819695-150819717 CTGGACAAGGGCTGAAGTGTGGG - Intergenic
940901295 2:159128764-159128786 CTGACCAAGCACTCTTTTGTTGG + Intronic
943771392 2:191721510-191721532 CTGGCTAAGGGCTGCTGTGGTGG + Intergenic
945655712 2:212620727-212620749 CTGGCCAAGGGGACTTCTCTTGG - Intergenic
946020662 2:216637732-216637754 TTGGCCAAGAGCCATTGTGTGGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948226978 2:236318921-236318943 CTGGCCAAGGGCTCCAGAGGTGG + Intergenic
1171119032 20:22552272-22552294 GTGGCCTAGGGCTCTTGTCCTGG + Intergenic
1173664000 20:44752604-44752626 CTCCCCAGGGGCTCTTGTGAGGG + Intronic
1174280466 20:49435223-49435245 CTGGCCTATGGTTTTTGTGTTGG + Intronic
1180252817 21:46600861-46600883 CTGAACAAGGGCTGTTGTGAGGG - Intronic
1183179045 22:36246189-36246211 CAGGCAAAGTGATCTTGTGTAGG + Intergenic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG + Exonic
949524350 3:4888628-4888650 GTCGCCAAGGGCTCTTTTGAAGG - Intergenic
949528430 3:4929214-4929236 CTGGCCAAGGGATCTTTGGAAGG + Intergenic
949843803 3:8350578-8350600 CTGGCCACCTGCTCTTTTGTAGG + Intergenic
950683571 3:14601766-14601788 CAGGCCCAGAGCTCCTGTGTGGG - Intergenic
951833940 3:26960565-26960587 CTGACCCAGGGCTCTTCTCTGGG + Intergenic
953184466 3:40625304-40625326 CTGGGCTGGGGCACTTGTGTGGG + Intergenic
953908134 3:46878608-46878630 CTGGCCAAGGGGTTTTCTGAGGG + Intronic
954398142 3:50303698-50303720 CTGGCAAAGGGATCTTGGTTGGG + Intronic
955953521 3:64265676-64265698 CAGGCTAAGTGGTCTTGTGTTGG - Intronic
956565980 3:70639186-70639208 CTGGCCAACAGCTATGGTGTTGG - Intergenic
957440852 3:80245429-80245451 GTGGCCAGGGGCTTGTGTGTGGG - Intergenic
960973883 3:123157398-123157420 CTGGCCACAGGCTGGTGTGTGGG + Intronic
963573000 3:147020775-147020797 CAGGCCAAGGGCTTGTCTGTGGG - Intergenic
964799611 3:160540761-160540783 CTGGCCAAAGGCTTATGTATAGG + Intronic
966805905 3:183807287-183807309 CTGCCCAAGGGCTCTGATGTGGG - Intronic
967096352 3:186180497-186180519 CTGGCCCAGGTCTCTCCTGTGGG - Intronic
967220684 3:187245632-187245654 CTGCTCAAGGCCTCTTGTGAGGG - Intronic
967907434 3:194513266-194513288 CTGGCCAAGGGGTCTCTTGCAGG + Intergenic
968461614 4:728754-728776 GTGGCCAGTGGCTCCTGTGTTGG - Intronic
968916877 4:3500479-3500501 CTGGCCAAGGGCTGCTGGGTGGG - Intronic
973541693 4:51941561-51941583 CTGGCCAAAGGCTCATGAGTGGG - Intergenic
975419598 4:74147385-74147407 CTGGCTAGGGGTTCTTGTCTAGG + Intronic
978266286 4:106829871-106829893 CTGGTCCAGGGCTCTTTTTTTGG - Intergenic
978373519 4:108052007-108052029 CTGGCCAAGCGCTCTGCTTTTGG - Intronic
978676714 4:111327181-111327203 GGGCCCAAGGGCTCTTCTGTTGG + Intergenic
981580034 4:146241784-146241806 CTGGCCAAGTGCTTTTATTTTGG - Intergenic
983835967 4:172384905-172384927 CTGGCTAAGGTTTGTTGTGTTGG + Intronic
985841653 5:2310366-2310388 TAGGCCAAGGTCTGTTGTGTAGG - Intergenic
987640887 5:20610979-20611001 CTAGCCAAGGGCATTTGTATCGG - Intergenic
991961501 5:72049179-72049201 CTGTCAAAGGGCTCTTGCATTGG - Intergenic
996000127 5:118351104-118351126 CAGGTCAAGGTCTTTTGTGTTGG - Intergenic
996067149 5:119091760-119091782 CTGGCTAAGGGTTCATGTGCTGG + Intronic
998339927 5:141408323-141408345 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998341010 5:141417980-141418002 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998369915 5:141654211-141654233 CTGGCCAAGGGTGCTTGACTTGG + Exonic
998675852 5:144407058-144407080 CTGGTGGAGGGCTCTTGAGTAGG + Intronic
1001314302 5:170631798-170631820 CTGGCCCAGGTCTCTAGTGGGGG - Intronic
1001738643 5:174029831-174029853 CTGGCCAAGAGCTATTCTTTAGG + Intergenic
1002003285 5:176211220-176211242 CTGGCCCTGGGCTTTTTTGTGGG + Intergenic
1002223167 5:177699724-177699746 CTGGCCCTGGGCTTTTTTGTGGG - Intergenic
1005666830 6:28066089-28066111 CTGGGCAAGAGATCTTGTGCTGG - Intergenic
1007231804 6:40353503-40353525 CTGGTCCAGGCCTTTTGTGTTGG + Intergenic
1007686761 6:43671686-43671708 GTGGCCAAGGGCTTGTGAGTGGG + Exonic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1013457161 6:110340484-110340506 CTAGCCCAGGGCTCCTGTGATGG - Intronic
1021963632 7:25895983-25896005 TTGGCCAAGGACTCTGGTGGAGG - Intergenic
1023852161 7:44156608-44156630 CTGGCACAGGGCTCTTATCTGGG + Intronic
1037963324 8:23115830-23115852 CTGGCCAAGGGGACTCGTGCTGG - Intronic
1037974792 8:23201552-23201574 CTGGCCAAGGGGACTAGTGCTGG + Intronic
1038459355 8:27703092-27703114 CTGGGCCAGGGCTGTGGTGTGGG - Intergenic
1043972050 8:86541207-86541229 CTGGCTAAGGGATCTTGGGCAGG + Intronic
1045800698 8:106097363-106097385 AGGGCCAAGGGCTCTTTAGTTGG - Intergenic
1047481280 8:125285944-125285966 ATGGCCAAGGGCTCAAGTTTTGG - Intronic
1049400714 8:142425746-142425768 CTGGCAAAGGGCCCTGGGGTTGG - Intergenic
1049437768 8:142595593-142595615 CTGGCCAAGGGCGCCTGGGGTGG - Intergenic
1052638813 9:31137469-31137491 CTGAACAAAGTCTCTTGTGTAGG + Intergenic
1053149339 9:35732702-35732724 CTGGCCTGGGGCTCGTGTCTGGG + Exonic
1055736643 9:79337301-79337323 CTGGCGAACAGCTCTTGTGATGG - Intergenic
1058118999 9:101117947-101117969 CTGTCCAAGGGCTGCTTTGTTGG + Intronic
1061302728 9:129714950-129714972 CAGCGCAAGGGCTCTTGTTTCGG + Intronic
1061725429 9:132579929-132579951 CTGGCCTTTGGCTCTTGGGTTGG - Intergenic
1062338525 9:136083177-136083199 GTGGCCACTGGCTCTTCTGTTGG - Intronic
1062571924 9:137189681-137189703 GTAGCCAAGGGATCCTGTGTGGG - Intronic
1186507946 X:10109198-10109220 ATGGCCAGGGGCTCTGGTGCAGG + Intronic
1188722932 X:33544671-33544693 CTGTCCTTGGGCTCTTGTTTGGG - Intergenic
1190139672 X:47831827-47831849 CTGGCGAAGAGCTCAAGTGTTGG + Intergenic
1190686163 X:52875695-52875717 CTGGCCTGGGGCTCCTGTCTTGG + Intergenic
1191931095 X:66373930-66373952 CTGGTCAAGGGCTTTTTTTTTGG + Intergenic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1196166126 X:112537018-112537040 CTGGCCAATTTTTCTTGTGTGGG + Intergenic
1199717135 X:150514962-150514984 CTGGCCAAGAGCTGGAGTGTTGG - Intergenic
1201925194 Y:19277029-19277051 CTGGCCTAAGGCTCTTTTATTGG + Intergenic