ID: 1142715590

View in Genome Browser
Species Human (GRCh38)
Location 17:1745373-1745395
Sequence CTGGTTGCCCAACTTGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142715590_1142715600 -2 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715600 17:1745394-1745416 AGGTACAACCAGGTGGGGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 159
1142715590_1142715605 11 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715605 17:1745407-1745429 TGGGGCTGGGGAAGAGTGGGCGG 0: 1
1: 1
2: 16
3: 214
4: 1797
1142715590_1142715612 28 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715612 17:1745424-1745446 GGGCGGGGCTAGAGGGAGGAGGG 0: 1
1: 0
2: 8
3: 91
4: 1059
1142715590_1142715611 27 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715611 17:1745423-1745445 TGGGCGGGGCTAGAGGGAGGAGG 0: 1
1: 1
2: 8
3: 86
4: 864
1142715590_1142715609 21 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715609 17:1745417-1745439 GAAGAGTGGGCGGGGCTAGAGGG 0: 1
1: 0
2: 3
3: 28
4: 376
1142715590_1142715597 -7 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715597 17:1745389-1745411 CAACCAGGTACAACCAGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 124
1142715590_1142715596 -8 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715596 17:1745388-1745410 GCAACCAGGTACAACCAGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 111
1142715590_1142715601 -1 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715601 17:1745395-1745417 GGTACAACCAGGTGGGGCTGGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1142715590_1142715606 12 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715606 17:1745408-1745430 GGGGCTGGGGAAGAGTGGGCGGG 0: 1
1: 1
2: 14
3: 169
4: 1541
1142715590_1142715610 24 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715610 17:1745420-1745442 GAGTGGGCGGGGCTAGAGGGAGG 0: 1
1: 2
2: 11
3: 54
4: 611
1142715590_1142715595 -9 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715595 17:1745387-1745409 GGCAACCAGGTACAACCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 100
1142715590_1142715603 7 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715603 17:1745403-1745425 CAGGTGGGGCTGGGGAAGAGTGG 0: 1
1: 2
2: 12
3: 114
4: 1126
1142715590_1142715604 8 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715604 17:1745404-1745426 AGGTGGGGCTGGGGAAGAGTGGG 0: 1
1: 0
2: 16
3: 120
4: 1065
1142715590_1142715607 13 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715607 17:1745409-1745431 GGGCTGGGGAAGAGTGGGCGGGG 0: 1
1: 0
2: 7
3: 109
4: 1049
1142715590_1142715599 -3 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715599 17:1745393-1745415 CAGGTACAACCAGGTGGGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 200
1142715590_1142715608 20 Left 1142715590 17:1745373-1745395 CCCTCCTCAAGTTGGGCAACCAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1142715608 17:1745416-1745438 GGAAGAGTGGGCGGGGCTAGAGG 0: 1
1: 1
2: 3
3: 46
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142715590 Original CRISPR CTGGTTGCCCAACTTGAGGA GGG (reversed) Exonic
901012706 1:6210392-6210414 CTTGTTGGCCAAGCTGAGGAAGG - Exonic
902245323 1:15117022-15117044 CTGGTTTCTCAACATGAGGATGG + Exonic
904978114 1:34473828-34473850 CTGGTTGATCAAGATGAGGAAGG + Intergenic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
917765987 1:178217772-178217794 CTGGTTGCTGAACATGGGGATGG + Intronic
919637376 1:200016013-200016035 GTGGTTGCCCAACTGGAGGGAGG - Intergenic
919880863 1:201899654-201899676 ATGGTAGCCCAGCTTGAGCAGGG + Exonic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
1066233810 10:33465974-33465996 GTAGTTTCCCAACTTGGGGAAGG + Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1069372026 10:67758189-67758211 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1069526043 10:69172810-69172832 ATGGTTGCACAATTTGAGGCTGG - Exonic
1071576154 10:86728184-86728206 CTGGTTACCCAACTTCTGGAAGG + Intronic
1073832208 10:107397671-107397693 CTGGTTGCTCAATGAGAGGAAGG + Intergenic
1074206269 10:111285745-111285767 CTGGCTGTCCAGCTTGAGGGTGG + Intergenic
1074853208 10:117455223-117455245 TGGGATGCCCAGCTTGAGGAAGG + Intergenic
1078926279 11:15878455-15878477 GATGTTGCCCAACTTTAGGAGGG - Intergenic
1083739439 11:64700906-64700928 CTGGGTGCCTAACTTGATCAGGG - Intronic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083879609 11:65541495-65541517 CCGGTTCCCCAAATTTAGGAGGG + Intronic
1085182173 11:74545188-74545210 CTAGTTGCCCTAATTGATGAGGG + Intronic
1086056193 11:82649902-82649924 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1086958767 11:92960985-92961007 CTTCTTCCCCAACTGGAGGAAGG - Intergenic
1087229951 11:95649905-95649927 CTGATTGCCACACTTGTGGAAGG + Intergenic
1087886364 11:103487640-103487662 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092742344 12:11641908-11641930 CTGGTTCCCCAGCTTGCAGATGG + Intergenic
1100601136 12:96112333-96112355 CTGATTGTCAAACCTGAGGAGGG + Intergenic
1102218757 12:111180143-111180165 CTTGTTGTCCAAGGTGAGGAGGG - Intronic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1111431946 13:88156995-88157017 CTGGTTTTCCAGCTTGTGGATGG - Intergenic
1112213966 13:97411089-97411111 CTGGTTTCCAGAATTGAGGAAGG - Intergenic
1115768359 14:36646793-36646815 CTGCTGACCCAACTTGAGCAGGG - Intergenic
1119128330 14:72149100-72149122 CTGTTGGCCGAACTTGAGCAGGG + Intronic
1119718577 14:76875850-76875872 CTGGGTGCCCAACTTGCAGCTGG + Intergenic
1120488667 14:85148345-85148367 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1121311937 14:92940088-92940110 CAGGATGCCCACTTTGAGGAGGG - Exonic
1124576212 15:30910734-30910756 CTGTTTGGCCAATTTGAGAAAGG - Exonic
1126418869 15:48450165-48450187 CTGATTTCCGATCTTGAGGAAGG + Intronic
1129403476 15:75299801-75299823 CTTGTGGCCCAACAAGAGGAAGG - Intergenic
1129726277 15:77903327-77903349 CCCTTTGCCCAACATGAGGAGGG + Intergenic
1132220406 15:100100950-100100972 CTGGTTGCCCACCTGGCTGAGGG - Intronic
1132228889 15:100167173-100167195 CTGATTGGCTAACTTGAGGTGGG + Intronic
1132396629 15:101479620-101479642 CTGGTTTCCCATCTGGAGGACGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133695662 16:8260165-8260187 CTGGATGCCAAACAAGAGGAAGG + Intergenic
1134644132 16:15852847-15852869 CTGGTTCCCCAACTTTTGCAAGG - Intronic
1136085588 16:27882613-27882635 CTTGGTGGACAACTTGAGGAGGG - Intronic
1141463791 16:84194140-84194162 CGGTTTGCCCAACTTGAGTCAGG - Exonic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1142728800 17:1836541-1836563 CTGGTTGCCTAGGGTGAGGATGG - Intronic
1143099956 17:4499364-4499386 CACGTTGCCCAAGCTGAGGATGG - Exonic
1144825397 17:18102916-18102938 CTGGTTTCCTGACTTGAGGCAGG + Intronic
1146494361 17:33307715-33307737 CTGGTGGGGGAACTTGAGGAAGG + Intronic
1147306857 17:39570110-39570132 CTGGTAGCCTAACATGAGTAAGG - Intergenic
1151858067 17:76737098-76737120 CAGGTTGTCCACCTTGAGGGAGG + Exonic
1152366205 17:79857965-79857987 CTGGTTCCCCACCTTGCAGATGG - Intergenic
1152685436 17:81691505-81691527 CTCGATGCCAAACTTGGGGATGG - Exonic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1162874422 19:13610217-13610239 CTGTTTGCCCAACCTCAGCACGG + Intronic
1167467452 19:49657879-49657901 CCGGGTGCCCACCTTGTGGACGG - Exonic
1168541947 19:57220275-57220297 CTGTTTCTTCAACTTGAGGAAGG + Exonic
926425554 2:12735962-12735984 CTGGGTGCTCATCTTGAGGTAGG + Intronic
928884688 2:36134873-36134895 CTGGTTCCCCAGCTTGCAGACGG + Intergenic
935249564 2:101249740-101249762 CTGGTTGCCAAATATGGGGAAGG + Intronic
935341711 2:102064978-102065000 CTGATTGCCCATCATGAGGGTGG + Intronic
937331799 2:121035423-121035445 CTGGTTGCTTCACATGAGGAGGG + Intergenic
938976309 2:136481609-136481631 CTGGTTCTCCAACTTGCAGATGG + Intergenic
939161341 2:138593598-138593620 ATGGTTGCACAACCTCAGGAAGG - Intergenic
943747716 2:191479689-191479711 CTGGCTGCCCAACGTGTGGCAGG - Intergenic
947710307 2:232309870-232309892 CTGGCTGCTGCACTTGAGGAGGG + Intronic
947840921 2:233207523-233207545 ATGGCTGCCCACCTCGAGGAGGG - Exonic
947987050 2:234457552-234457574 CTGATTGTCCAATTTGAGTAGGG - Intergenic
948315572 2:237026067-237026089 CGGGCTGCCCAATCTGAGGAAGG + Intergenic
948811578 2:240481070-240481092 CTGGTAGCAGAACTTGAAGAAGG + Exonic
1168977679 20:1980419-1980441 CTGGTTGTCCCACTTGAGCTTGG + Exonic
1169158424 20:3354504-3354526 GTCCTTGCCTAACTTGAGGATGG - Intronic
1173528551 20:43751063-43751085 CTTGTTGCCCCATTTGAAGATGG - Intergenic
1175839999 20:62020606-62020628 CTGTTTGCCCATCTGGTGGAGGG - Intronic
1176246550 20:64099991-64100013 CTTGCTGCCCAACGGGAGGATGG + Exonic
1177192709 21:17869589-17869611 CTGGTCCCCCAGCTTGCGGATGG - Intergenic
1177197341 21:17917329-17917351 CTGGTTCTCCAGCTTGAAGATGG + Intronic
1177942612 21:27429870-27429892 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1178806392 21:35843157-35843179 CTGGTTCCCCAGCTTGCAGATGG + Intronic
1179597165 21:42450669-42450691 TTGGCTGCCCAGCTTGAGGCCGG - Intergenic
1179922521 21:44514842-44514864 CTGGCTGCCCACCCTGGGGAAGG - Intronic
1180206989 21:46266880-46266902 CTGCTTGCCTGACTTGAAGAAGG - Intronic
1181132158 22:20738323-20738345 CTGTGTGCCCAACTTAAGCAGGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
950220352 3:11190797-11190819 CTGGCTGCTCAACGTGAGCAGGG - Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
952306354 3:32150120-32150142 CTGACTGCCCAACTGGAGGCTGG - Intronic
952401619 3:32968683-32968705 CTGGTTGGCCTCCTAGAGGAGGG - Intergenic
953113041 3:39962152-39962174 CTGTTTGCCCATCTATAGGATGG + Intronic
953617334 3:44503009-44503031 CTGAGTTCCCCACTTGAGGAAGG + Exonic
953625566 3:44567937-44567959 CTGAGTTCCCCACTTGAGGAAGG - Exonic
960441353 3:117692832-117692854 CTGGTTCTCCAACTTGCAGACGG + Intergenic
960835426 3:121901673-121901695 CTGATTTTCCAACTTAAGGAAGG - Intronic
961041751 3:123683010-123683032 CTGCTTGCCCTCCATGAGGAAGG - Intronic
967120566 3:186379017-186379039 CTGGTTTGCCAGCTTGTGGATGG - Intergenic
968572596 4:1349885-1349907 CTGGTTACCTGACGTGAGGAGGG + Intronic
971905681 4:32722275-32722297 CTAGGTGCCCAGCTTGGGGAAGG + Intergenic
973318970 4:48790506-48790528 CTGGTTGCAAAACTTGAGAGAGG - Intergenic
973784808 4:54324751-54324773 CTGGTGGACCAACTAGAGAAAGG - Intergenic
975335313 4:73169555-73169577 ATAGTTGCCAAACTTGGGGAGGG - Intronic
975536152 4:75453016-75453038 CTGATTGCCCAAGTAGAGGAGGG + Intergenic
976037301 4:80839505-80839527 CTGGCAGCCTAACTTGAGGCAGG + Intronic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
982738789 4:159036296-159036318 CTTGTAGCCCAGCTGGAGGAAGG + Intronic
984274680 4:177595843-177595865 CTGGCTGGGCAAGTTGAGGAAGG - Intergenic
985780364 5:1867763-1867785 GTGGGTGTCCAACTTGAGGGCGG + Intergenic
986795028 5:11201724-11201746 ATGGTTGCCCAGCCTGAGGGTGG + Intronic
987046762 5:14116047-14116069 CTGGTTCTCCAGCTTGAGGATGG - Intergenic
988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG + Intergenic
994176220 5:96714233-96714255 CTGGTTGCACAACTACAGGCAGG - Intronic
994475653 5:100265650-100265672 CTGCTTGGCCTACTTGAGAAAGG + Intergenic
998725213 5:145004861-145004883 CTGGTTCTCCAGCTTGAAGATGG - Intergenic
1006302946 6:33203793-33203815 CTGATTGCCCACCTTGAGTGAGG + Exonic
1009034110 6:58095885-58095907 CTGGTTCTCCAGCTTGAAGAAGG - Intergenic
1010467981 6:76191223-76191245 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1015378999 6:132545444-132545466 ATGGTTGCCCACATTGAGCAAGG + Intergenic
1018991630 6:168678238-168678260 CTGGTTGCCAAATATGGGGAAGG + Intergenic
1023045789 7:36209031-36209053 ATGGTTGCACAACTTGTCGAAGG - Intronic
1027613849 7:80396490-80396512 ATGGTAGCACATCTTGAGGAGGG - Intronic
1030638543 7:111977942-111977964 CTTGTTGCCCAAGTTGAGCCTGG - Intronic
1031484849 7:122313583-122313605 CAAGTACCCCAACTTGAGGAAGG + Intergenic
1031953909 7:127922675-127922697 ATGCTTGCCCAACTAGAAGAAGG - Intronic
1045467364 8:102482604-102482626 TTGGTTCCCCAACTTGCAGATGG + Intergenic
1046560025 8:115824382-115824404 CTGGTGGCCTAACTGTAGGAAGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1050023775 9:1311831-1311853 CTGCATGCTCAACTTGAGTAAGG + Intergenic
1050144506 9:2552236-2552258 CTGGTTGCAGAATTTGTGGAAGG + Intergenic
1050665874 9:7936240-7936262 ATGGTTGCCCACACTGAGGAAGG + Intergenic
1051108484 9:13608017-13608039 CTCCTTGCCAAACTTGAGGACGG - Intergenic
1054969477 9:71068657-71068679 CAGGTTGCCCAACTTCAGCATGG - Intronic
1056238579 9:84620650-84620672 ATGGTTTCCCAGCTTGAGCAAGG + Intergenic
1056463234 9:86828322-86828344 CTGCATGCCCCACTGGAGGAGGG - Intergenic
1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG + Intergenic
1057941131 9:99285974-99285996 CTGGTTCTCCAACTTGTAGATGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1060058661 9:120439116-120439138 CTGAGCCCCCAACTTGAGGAGGG + Intronic
1060545407 9:124456371-124456393 CTGGTTGGCAAACAGGAGGATGG + Intronic
1060637816 9:125213298-125213320 TTGGTTGGCACACTTGAGGAGGG - Intronic
1062031751 9:134365022-134365044 CCGGTTGCCCAGCTGGGGGATGG + Intronic
1203785255 EBV:124048-124070 GTGGTTGCCCAGCTTGATGACGG + Intergenic
1192597261 X:72424304-72424326 CTGGTTGCCCAACATTATGAAGG - Intronic
1193348722 X:80432813-80432835 TTGGTTGCCCACCATGAGGTTGG + Intronic
1199028162 X:142963595-142963617 CTGGTGGATCAACTTGAGGTTGG - Intergenic