ID: 1142715986

View in Genome Browser
Species Human (GRCh38)
Location 17:1747205-1747227
Sequence TGGAGGAGGGTGAGAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 915}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142715977_1142715986 -5 Left 1142715977 17:1747187-1747209 CCTCAGTCCTGCCCTGGGTGGAG 0: 1
1: 0
2: 6
3: 60
4: 516
Right 1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG 0: 1
1: 0
2: 9
3: 82
4: 915
1142715969_1142715986 30 Left 1142715969 17:1747152-1747174 CCTGCAGAAAGGTAGGCGCTGAT 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG 0: 1
1: 0
2: 9
3: 82
4: 915
1142715976_1142715986 -4 Left 1142715976 17:1747186-1747208 CCCTCAGTCCTGCCCTGGGTGGA 0: 1
1: 0
2: 4
3: 29
4: 261
Right 1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG 0: 1
1: 0
2: 9
3: 82
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142715986 Original CRISPR TGGAGGAGGGTGAGAGCAAG GGG Intronic
900149079 1:1170487-1170509 AGGAGGAGGGGGAGGGAAAGAGG - Intergenic
900497259 1:2981473-2981495 TGGGGAAGGGGGACAGCAAGAGG - Intergenic
900547171 1:3235618-3235640 TGGAGCAAGGTGAGAGCGGGTGG - Intronic
900658271 1:3770804-3770826 AGGAGGAAGGGGAGAGAAAGAGG + Intronic
900720176 1:4170875-4170897 AGGAGAAGGGTGAGAAGAAGAGG - Intergenic
900874073 1:5328979-5329001 TGGAGGACAATGAGAGGAAGGGG + Intergenic
901105380 1:6751850-6751872 AGGAGGAGGGGGAGGGGAAGTGG - Intergenic
901239723 1:7685923-7685945 TCGGGGAGGGAGTGAGCAAGGGG - Intronic
901420944 1:9150702-9150724 GGGAGGAGGGTGAGGACCAGAGG + Intergenic
902086822 1:13869029-13869051 GGGAGGAGGGTGGGAGTAGGAGG + Intergenic
902131012 1:14260475-14260497 TGGAGCAGGGTGAGCCCATGGGG + Intergenic
902785607 1:18730881-18730903 TGGAGTAGAGGGAGAGGAAGGGG + Intronic
902924128 1:19684511-19684533 CGGAGGAAGTTGAGAGCCAGAGG - Intronic
903287003 1:22283628-22283650 AGGAGCAGGGTGAGTCCAAGTGG - Intergenic
903730575 1:25492027-25492049 TGGTGGAGGGTGAGGGGTAGAGG + Intronic
903951933 1:27000828-27000850 AGGAGGGGGGTAAGAGCAGGCGG - Exonic
904041105 1:27585771-27585793 TGGAGGAAGGGGAGGGGAAGTGG - Intronic
904128697 1:28260138-28260160 GGGAGGAGGGGGAGAGGGAGGGG - Intronic
904539391 1:31222563-31222585 TGGTGCAGGGTGAGAGGAAGAGG + Intronic
904588778 1:31595823-31595845 TGGAGCAGGGTGGGGGCCAGTGG - Intergenic
904597255 1:31654673-31654695 GTGTGGAGGGTGAGAGCAGGAGG + Intronic
905015626 1:34776714-34776736 TGGAGGAGGAAGAGAGGAGGTGG + Intronic
905212176 1:36381940-36381962 TGGAGGAGGTTGTGATCTAGGGG - Intronic
905735027 1:40318940-40318962 TGTTGGAAGATGAGAGCAAGAGG + Intergenic
906483481 1:46216785-46216807 TGGAGGAGGGAGAGAGGTGGGGG - Intronic
906653196 1:47528037-47528059 AGGAGGAGGAGGAGAGGAAGAGG + Intergenic
906706723 1:47900303-47900325 TGAAGTCGTGTGAGAGCAAGTGG - Intronic
906746809 1:48228004-48228026 GGGAGAAGGGGGAGAGGAAGGGG - Intronic
907390628 1:54155891-54155913 GGCAGGAGAGAGAGAGCAAGCGG + Intronic
907407305 1:54261534-54261556 TGGTGGAAGGTGAGAGGAGGAGG + Intronic
907753081 1:57282344-57282366 TGGCTTAGGGTGGGAGCAAGCGG + Intronic
907971397 1:59385139-59385161 TGGAGAAGGAAGAGAGAAAGGGG - Intronic
908057128 1:60299773-60299795 GAGAGGAGGCTGAGAGCAAGGGG - Intergenic
908728768 1:67204652-67204674 TGGAGGTGGGTGACAGGAGGAGG + Intronic
909424235 1:75503428-75503450 TGCAGGAGAGAGAGAGCAAAGGG - Intronic
909996858 1:82290478-82290500 TGGAGGAGGGTGAGAGGAGTAGG - Intergenic
910183076 1:84506303-84506325 TGGAGGAGGGGGAGGAGAAGGGG + Exonic
910425377 1:87115613-87115635 AGGAGGAGGGAGACAGGAAGAGG - Intronic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911098231 1:94073251-94073273 TGGGGGAGGAGGAAAGCAAGGGG - Intronic
912254706 1:108047026-108047048 TGGAGAGGGGTGAGAGGATGAGG - Intergenic
912297526 1:108484714-108484736 TGGAGGAGGTGGACAGCAAATGG + Intergenic
912520891 1:110243903-110243925 TGGAGGCAGGTCAGAACAAGAGG + Intronic
912649071 1:111422276-111422298 GGGAGGAGGGTGAGAGACACAGG - Intronic
912654855 1:111477120-111477142 TGAGGGAGGGGGAGAGGAAGAGG + Intronic
913317036 1:117562216-117562238 TGCTGGAGGCTGAGAGCTAGTGG + Intergenic
913322617 1:117599757-117599779 TGGAGAAGGGAGAGAGGAGGAGG + Intergenic
914942048 1:152031799-152031821 TAGAGGAGAGAGAGAGAAAGAGG - Intergenic
915456148 1:156042111-156042133 GGGTGGAGGTTGAGGGCAAGGGG - Intronic
915467932 1:156108365-156108387 TGGAGGAGGGTCTGAGGAGGTGG - Intronic
915631237 1:157155247-157155269 CGGGGGAGGGTGAGAGCTGGAGG + Intergenic
916213141 1:162374456-162374478 TGCAGCAGGATGAGGGCAAGTGG - Exonic
916453239 1:164941846-164941868 GGGAGGAGGGTGGGAGGAAGAGG - Intergenic
917459638 1:175218925-175218947 TGGAAGAGGGAGGGAGGAAGGGG + Intergenic
917519549 1:175736563-175736585 TGAGGGAGGGTGAGGGAAAGAGG + Intronic
917782083 1:178409076-178409098 TGGAGGCAAGAGAGAGCAAGCGG + Intronic
918002930 1:180514579-180514601 AGGAGGAGGGGGGGAGGAAGAGG + Intergenic
918006065 1:180543165-180543187 GGGAGGAGGGGGAGAGGGAGAGG + Intergenic
918048648 1:180956009-180956031 TGGGGGAGGGAGGGAGAAAGGGG - Intergenic
918086758 1:181252105-181252127 TGAAGGAGGAAGAGAACAAGGGG - Intergenic
918238782 1:182604040-182604062 AGGAGCAGGGAGAAAGCAAGGGG - Intronic
918307584 1:183261118-183261140 TGGAGGAGTGAGAGAGCAAAAGG - Intronic
919006640 1:191908052-191908074 AGCAGGAGAGAGAGAGCAAGGGG + Intergenic
919127174 1:193409026-193409048 TGGCGGACAGTGAGAGAAAGGGG + Intergenic
919251554 1:195063094-195063116 AGGAGGAGGAGAAGAGCAAGAGG - Intergenic
919359516 1:196573670-196573692 AAGAGGAGGGAGAGAGAAAGAGG + Intronic
920294649 1:204948485-204948507 TGGAGAAGGGTGAGTGAGAGGGG - Intronic
920441377 1:205983158-205983180 TGGAGGAATGTCAGAGCACGGGG - Intronic
920743869 1:208607052-208607074 TGGAGGGGGGTGAGAGTAGAGGG + Intergenic
922050998 1:221990556-221990578 TGGATGAGGGTGGCAGGAAGAGG - Intergenic
922355126 1:224768006-224768028 AGGAGGAGGGGAAGAGCAGGAGG + Intergenic
922677179 1:227560339-227560361 TGAAGGAGAGCAAGAGCAAGAGG - Intergenic
922727191 1:227927960-227927982 GGGAGGAGGGTGAAGGGAAGAGG + Intronic
923051876 1:230395401-230395423 GGGAGGAGGGTGGGAGTGAGAGG - Intronic
923110438 1:230885605-230885627 CTGAGGAGGGTGAGAACCAGAGG - Intergenic
923297060 1:232604340-232604362 TGGAGCAGAGTGAGAGGAGGCGG - Intergenic
923438152 1:233988587-233988609 TGGAGGATGGAAAGAGCATGTGG - Intronic
924016552 1:239731569-239731591 AGGAAGAGGGAGAGAGCAGGGGG + Intronic
924573487 1:245258782-245258804 CGGGCGGGGGTGAGAGCAAGTGG + Intronic
924710771 1:246528300-246528322 CAGAGGAGGCTGAGAGGAAGAGG + Intergenic
924947782 1:248857793-248857815 TGGCAGGGGGTGAGAGCCAGAGG - Intronic
1063526846 10:6795106-6795128 TGGGGGAGGGTGGGAGGAGGGGG + Intergenic
1063663540 10:8049256-8049278 TGGAGGCGGGTGCGTCCAAGGGG - Intergenic
1063929124 10:11011402-11011424 TGGAGGTGGGTGAGGGGGAGAGG + Intronic
1064068836 10:12207703-12207725 GGGAGCAGGGTGGGAGGAAGGGG + Intronic
1064693520 10:17942075-17942097 TGTAAGAGCATGAGAGCAAGAGG - Intergenic
1064769751 10:18711359-18711381 AGGGGGAGGGGGAGAGGAAGGGG - Intergenic
1064967662 10:21031202-21031224 AGGAGGAGAGAGAGAGAAAGAGG + Intronic
1064995801 10:21295980-21296002 GGGAGGAGGGGGAGAGCTGGAGG - Intergenic
1065550445 10:26863926-26863948 AGGAGGAGGGAGAGAGGGAGCGG + Intergenic
1065619455 10:27565701-27565723 TGGATGAGAGAGACAGCAAGAGG + Intergenic
1066372942 10:34832621-34832643 AGGAGGAGGAGGAGAGGAAGAGG + Intergenic
1066994656 10:42552650-42552672 TGGAGGTGGGAGAGAGGGAGCGG - Intergenic
1067069048 10:43119314-43119336 AGCAGGAGGCAGAGAGCAAGTGG + Intronic
1067101991 10:43340549-43340571 TGGACAAGGGCGAGAGGAAGAGG + Intergenic
1067680021 10:48428364-48428386 TGTAGGAGGGTGAGATGAAGGGG - Intronic
1068328165 10:55523198-55523220 TGGAGGAGAGGGAGAAAAAGTGG - Intronic
1069493177 10:68879115-68879137 TGGAAAAGGGTGAGAGCTGGGGG - Intronic
1069514977 10:69070204-69070226 CGGCGGAGGGTGAGTGCCAGTGG - Intergenic
1070333923 10:75438010-75438032 TGGAGGAGAGGGAGAAGAAGGGG + Intronic
1070517420 10:77221178-77221200 AGGAGGATGGTGAGGGGAAGAGG - Intronic
1070652972 10:78251484-78251506 TGCGGGAGGGTGAGGGCAAGAGG + Intergenic
1071361550 10:84851280-84851302 TGCAGGAGGGACAGAGCAAGAGG - Intergenic
1071688766 10:87792886-87792908 TGGAGAAGGCTAAGATCAAGGGG - Intronic
1072722381 10:97789012-97789034 TGCAGGAGGGTGGGAGCAGGAGG - Intergenic
1072945208 10:99803809-99803831 TGGAGGAAGGTGGGAATAAGAGG + Intronic
1073070908 10:100792708-100792730 AGGGGGAGGGAGAGAGCAGGGGG - Intronic
1074085291 10:110205097-110205119 GGGAGAAGGGAGAGAGCAATGGG + Intergenic
1075311410 10:121417056-121417078 AGGAAGAGGGTGGGAGCAAAAGG + Intergenic
1075714647 10:124548941-124548963 TGGAGAAGGGGGACAGCCAGCGG + Intronic
1076179033 10:128391646-128391668 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
1076182258 10:128419336-128419358 TGGATGAGGGTGGGAGCTACAGG + Intergenic
1076408259 10:130227714-130227736 AGGAGGAGGTTGAGATCCAGAGG + Intergenic
1076600068 10:131651658-131651680 TGAAGGAGGGAGAGATGAAGGGG - Intergenic
1076655475 10:132020713-132020735 TGGAGGAGAGTGTGAGCCCGAGG - Intergenic
1076778136 10:132709399-132709421 GGAAGGAGGGGGAGAGAAAGAGG + Intronic
1078135059 11:8644999-8645021 TGGAGGAGAGTGAGAAGCAGTGG - Intronic
1078390595 11:10932235-10932257 TGGAGGAAGGAGAGAGGAGGAGG + Intergenic
1078930049 11:15905725-15905747 TGGAGCAGGGTGAGTGGATGGGG + Intergenic
1079029659 11:16977112-16977134 TGGTGGAGGGAGAGAGGAGGAGG - Intronic
1080083684 11:28252978-28253000 TAGAGGAGGAGGAGACCAAGAGG - Intronic
1080653699 11:34242286-34242308 GGCAGGAGGGTGGGAGCAAGGGG + Intronic
1080962265 11:37174360-37174382 GGCAGGAGAGAGAGAGCAAGGGG - Intergenic
1081346597 11:41994904-41994926 AGCAGGAGGGAGAGAGCAAAGGG + Intergenic
1081432481 11:42991163-42991185 TGGCGGAGGAGGAAAGCAAGAGG - Intergenic
1081437119 11:43039478-43039500 ATGAGGAGTGTGAGAGAAAGAGG + Intergenic
1081485627 11:43525777-43525799 AGGAGGAGGAAGAGAGCAAAGGG - Intergenic
1081580037 11:44345906-44345928 TGGAGCTGGGTGAGAGGAATAGG - Intergenic
1081787388 11:45757016-45757038 TGGAGTAGGGTGGGGACAAGAGG - Intergenic
1081864456 11:46352057-46352079 TGGGGGAGAGTGAGAGAAACGGG + Intronic
1081961076 11:47137961-47137983 TGGAGGGTGGTGAGATGAAGAGG + Intronic
1082099688 11:48162326-48162348 AGAAGGAGGGGGAGAGGAAGAGG - Intronic
1082774957 11:57237574-57237596 TGGAAGGGGGTGAGAACAGGAGG - Intergenic
1082811009 11:57479038-57479060 TGGGGGAGAGTGAGAGCAGCTGG + Intergenic
1083037743 11:59655984-59656006 TGGAGGGGGCTGAGAACAGGAGG + Exonic
1083162886 11:60866462-60866484 TGCTGGAAGGGGAGAGCAAGAGG - Intergenic
1083219028 11:61240229-61240251 GGGAGGAGGGAGAGAGCACCGGG - Intergenic
1083571577 11:63764420-63764442 TGGAGGAGGGCGAGGGCGAGAGG - Exonic
1083616410 11:64028674-64028696 GGGAGGAGGGGGAGGGGAAGAGG - Intronic
1083652412 11:64211163-64211185 TGGCTGGGGGTGAGTGCAAGTGG + Exonic
1083681515 11:64353946-64353968 GGGAGGAGGGAGGGAGCAAAGGG - Intronic
1084168360 11:67387742-67387764 AGGATGAGGCTGAGAGCATGGGG + Intronic
1084771232 11:71344066-71344088 AGGAGGAGGGAGAGGGCAAGAGG - Intergenic
1085022832 11:73219797-73219819 TTGAGGAAGGTGAGAGTAGGAGG - Intronic
1085042489 11:73334776-73334798 TGAGGGAGGGAGAGAACAAGAGG + Intronic
1085405563 11:76259766-76259788 TGGAGAAGGGGGAGAGGAGGAGG + Intergenic
1085592594 11:77778112-77778134 GGGAGGAGGGGGAGAGGATGGGG + Intronic
1086443095 11:86847962-86847984 TGGAGGAGAGTCAGTGCAGGAGG - Intronic
1087970136 11:104470405-104470427 TGGAAGAGGGAGAAAGGAAGAGG + Intergenic
1088014536 11:105043041-105043063 TGGAGGTGCATGAGAGGAAGGGG + Intronic
1088598667 11:111457464-111457486 TGTAGGGGGCTGAGAGGAAGGGG - Intronic
1088598726 11:111457710-111457732 AGGAGGAGGGGGAGAGGGAGGGG - Intronic
1088825192 11:113488039-113488061 AGAAGGAGAGTGAGAGCGAGAGG - Intergenic
1089120456 11:116130831-116130853 TGGAGGAGGGAGAGAGCCAGAGG - Intergenic
1089152779 11:116376842-116376864 TGGGGCTGGGTGGGAGCAAGTGG + Intergenic
1089357023 11:117860613-117860635 AGGCCGAGGGTGAGAGCATGGGG + Intronic
1089495947 11:118908748-118908770 TGGGGGAGGGTGGGGGGAAGGGG + Intronic
1089541659 11:119193006-119193028 TGGTGGAGGGTCAGCGAAAGTGG + Intronic
1089664075 11:120006299-120006321 TGGAGGACAGTGGGAGCAAGGGG + Intergenic
1090119751 11:124013906-124013928 TGGAGGAGGGGAAGATCATGGGG + Intergenic
1090717054 11:129440116-129440138 AGGAGGAGGGTGAGAGCTGTGGG - Intronic
1090855915 11:130609248-130609270 TGAAGGAGGCTGAGAACAACCGG + Intergenic
1091025284 11:132136062-132136084 GTGAGGAGGCTGAGAGGAAGGGG - Intronic
1091070465 11:132558300-132558322 GGGAGGAGGGGGAGAGGAGGAGG - Intronic
1091070481 11:132558332-132558354 GGGAGGAGGGGGAGAGGAGGAGG - Intronic
1091214491 11:133892376-133892398 TATAGGAGGGTGAGAGCAGAGGG - Intergenic
1091403217 12:193394-193416 TGGGAGAGTGTGAGAGCCAGAGG + Intronic
1091447560 12:552755-552777 TGGAGGAGAGTGAGAGCCCGGGG + Intronic
1091635317 12:2192714-2192736 TGGAGGAGGGGGAGAGTGGGGGG - Intronic
1091635331 12:2192753-2192775 TGGAGGAGGGGGAGAGTGGGGGG - Intronic
1093017641 12:14170950-14170972 AGGAGAAGGGTGAGGGGAAGGGG + Intergenic
1093066672 12:14665382-14665404 GGGAGGAAGCTGAGAGCATGGGG + Intronic
1094394493 12:29991440-29991462 AGGAGGGGGTTGAGATCAAGAGG + Intergenic
1094491797 12:30965357-30965379 AGGAGGCAGGTGAGAGCACGTGG - Intronic
1095178168 12:39117266-39117288 TAGAGGAGTGAGAGGGCAAGAGG - Intergenic
1095606209 12:44070781-44070803 TGGAGGAGGCTGAATGCAATTGG - Intronic
1095958281 12:47818988-47819010 TTGGGGAGTGTGAGAGCAGGCGG - Intronic
1096315054 12:50557239-50557261 TGGGAGAGGGTGAGTGAAAGTGG + Intronic
1097221621 12:57454672-57454694 TGGAGGAGGGCCAGAGCCGGCGG - Intronic
1097221869 12:57455836-57455858 TGGGTGAGGGAGAGAGCAACAGG + Intronic
1097929835 12:65170622-65170644 GGGAGGAGGGTGTGATCAAGTGG + Exonic
1098024908 12:66191105-66191127 TGGAGGAGGGTGGGAGAAGAAGG + Intronic
1098130803 12:67347985-67348007 TGGAGGAGGAAGAGAGCAAAGGG + Intergenic
1098141188 12:67451582-67451604 TGGAGGTGGGTGGGAGGAGGAGG - Intergenic
1098238054 12:68437648-68437670 TGGAGGGGGATGACAGCAATGGG + Intergenic
1098566156 12:71938904-71938926 TGGCGGAGATTGAGAGGAAGGGG - Exonic
1098739415 12:74153290-74153312 TTGAAGAAGGTGAGAGCAATGGG - Intergenic
1098960580 12:76735937-76735959 TGGAGGAGGGCGAGATCACAGGG - Intergenic
1099729260 12:86477409-86477431 TAGAGGAGGAAGAGAGAAAGGGG + Intronic
1100503934 12:95201293-95201315 TTGAGGAGGGAAATAGCAAGGGG - Intronic
1100659062 12:96677507-96677529 TGGATGAGGGTGGGGGCATGAGG + Intronic
1101519621 12:105469311-105469333 TGGAGGAGGACGAGTGCCAGGGG + Intergenic
1101761837 12:107665072-107665094 TGTCGGGGGGTGGGAGCAAGGGG + Intergenic
1101823743 12:108204328-108204350 TGGAGTAGGGTGGGAGAGAGAGG - Intronic
1102008322 12:109602825-109602847 TGGTGCAGCGTGAGGGCAAGGGG + Intergenic
1102200905 12:111057065-111057087 TGGGGGAGTGTGACAGGAAGTGG + Intronic
1102339939 12:112113573-112113595 AGGAGGAGGAGGAGAGGAAGAGG + Intergenic
1102554549 12:113718354-113718376 TGGGGGTGGGTGAGAGGCAGGGG + Intergenic
1102598785 12:114013025-114013047 GGGAGGAGGGAGAGGGGAAGAGG + Intergenic
1102657815 12:114497748-114497770 GGGAAGAGGGTGGGAGGAAGAGG - Intergenic
1102791433 12:115649587-115649609 GGGAAGGGGGTGAGAACAAGTGG + Intergenic
1102840350 12:116113701-116113723 TGGAGGAGGAAGAGGGGAAGAGG + Intronic
1103027714 12:117587322-117587344 GGGAGGAGGGTGAGAGTCAGAGG + Intronic
1103572483 12:121854474-121854496 TGCGGGAGGATGACAGCAAGGGG - Intronic
1103908114 12:124337676-124337698 GTGAGGAGTGAGAGAGCAAGGGG + Intronic
1104429684 12:128706094-128706116 TGGAGGTGGGCGAGTGCAGGGGG - Exonic
1104716230 12:131018198-131018220 TGGAGGAGTGGGAGAGGAGGGGG - Intronic
1104790755 12:131480688-131480710 TGGTGGAGGGTGGGGGCAGGAGG - Intergenic
1104871202 12:131997741-131997763 TGGGGGAGGGGGAGGGGAAGGGG + Intronic
1105533636 13:21243525-21243547 GGGAGGAGGGTGAGGGCCAGAGG + Intergenic
1105575800 13:21650543-21650565 AGGAGGAGGGAGAGAGAGAGGGG - Intergenic
1106233512 13:27841155-27841177 TGGATGAGGGTGAAAGGAAAAGG + Intergenic
1106296947 13:28423036-28423058 TGGAGGACTGTAAGATCAAGCGG + Intronic
1107043750 13:35974601-35974623 AGCAGGAGAGAGAGAGCAAGAGG - Intronic
1108329385 13:49370056-49370078 TTGAGGTGGGTGGGAGCAAGTGG + Intronic
1108373432 13:49792580-49792602 GGGAGGAGGGGGAGAGCGGGAGG + Exonic
1108573529 13:51772030-51772052 TGGAGGAGGGTGACATCAAGTGG - Intronic
1108573984 13:51776395-51776417 AGGAGGAGGGTGCGAGTCAGAGG - Intronic
1108711309 13:53035133-53035155 GGGAGGAGGATGAGAGGGAGAGG - Intronic
1108974264 13:56418389-56418411 TGGAGGAGGCTGGGAGGAGGGGG - Intergenic
1109262498 13:60160683-60160705 TGGAGGAGGCTGAGAGGACAGGG - Intronic
1109308566 13:60665580-60665602 GGGAGGAGGGAGGGAGGAAGAGG - Intergenic
1109357034 13:61244668-61244690 TAGAGGGAGGTGAGAGAAAGGGG - Intergenic
1109630124 13:65034441-65034463 CGGGGGAGGGTGAGAGGAGGTGG - Intergenic
1109826364 13:67727484-67727506 AGGGAGAGAGTGAGAGCAAGGGG + Intergenic
1110182373 13:72633129-72633151 TAGAGGAAGGAGAGAGGAAGAGG + Intergenic
1110338364 13:74359520-74359542 AGGAGGAGCAAGAGAGCAAGGGG - Intergenic
1110723718 13:78795335-78795357 GGGTGGAGGGGGAGAGAAAGTGG - Intergenic
1111742831 13:92226096-92226118 GGCAGGAGAGAGAGAGCAAGAGG - Intronic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1113280928 13:108786587-108786609 TGGAGGAGGCAGAGAGCACAAGG - Intronic
1113311433 13:109137116-109137138 TGGAGGTGAGGGAGAGCCAGAGG - Intronic
1113763891 13:112868908-112868930 TGCAGGAGAGAGAGAGCAAAGGG + Intronic
1113778627 13:112963160-112963182 TGGAGGTGGGTGGGAGCCACGGG - Intronic
1113841900 13:113365275-113365297 TGGAGAAGGGTGAAAGGCAGAGG - Intergenic
1114076403 14:19163571-19163593 AGGAGGAGGGAGAGAGAAGGGGG + Intergenic
1114085766 14:19235998-19236020 AGGAGGAGGGAGAGAGAAGGGGG - Intergenic
1115213494 14:30991704-30991726 GGGGTGAGGGTGAGAGGAAGAGG + Intronic
1116568591 14:46485505-46485527 TGGAGGTGGGTAAGAGGGAGAGG - Intergenic
1116681414 14:47974493-47974515 TGGAGGAGGTTGGGGGGAAGTGG + Intergenic
1116972938 14:51086698-51086720 TGGAGGAGGGTGAGCTGAACAGG + Intronic
1117211903 14:53509418-53509440 AGGAGGTGGGTGGGAGCAGGGGG + Intergenic
1118365218 14:65089206-65089228 TGGTGGAGAGAGAGAGCCAGAGG - Intronic
1118553570 14:66985800-66985822 TGGAGGGTGGTGGGAGGAAGGGG + Intronic
1118575036 14:67233685-67233707 TGGAGGAGGGTGGTAGCAGTGGG + Intergenic
1118597676 14:67448643-67448665 TGGAGGGGAGAGAGAGCAAAGGG + Intronic
1118727412 14:68638937-68638959 TGCAAGAATGTGAGAGCAAGGGG + Intronic
1118761305 14:68881825-68881847 AGGAGGAGGAGGAGAGGAAGGGG + Intronic
1118776588 14:68977889-68977911 GGGAGGAGGGGGAGGGAAAGGGG + Intronic
1118797074 14:69153187-69153209 TGGAGGAGGCGGAGAGGCAGAGG - Intergenic
1119397667 14:74339473-74339495 TGGAGGAGGGGGAGAGAAAAAGG + Intronic
1119484283 14:74977995-74978017 AGGAGGAGGAGGGGAGCAAGGGG - Intergenic
1119583749 14:75812240-75812262 GGGAGGAGGAGGAGAGCAAGGGG + Intronic
1119650190 14:76377655-76377677 GGGGGGAGGGGGAGAGCGAGTGG - Intronic
1119720983 14:76890347-76890369 TGGAGCAGTGAGAGAGGAAGGGG - Intergenic
1119773885 14:77236917-77236939 TGGAGAAGGGTGAGAGGTGGGGG - Intronic
1119921868 14:78454253-78454275 TGGTGAAGGTTGAGAGCTAGTGG - Intronic
1120203076 14:81559618-81559640 TGGAGGAGGAAGAGAGTGAGGGG + Intergenic
1120426469 14:84353901-84353923 TGGAGAAGGGTGGGAGGGAGAGG + Intergenic
1120469267 14:84902432-84902454 AGCAGGAGAGAGAGAGCAAGGGG - Intergenic
1120899905 14:89566851-89566873 AGGAGGGGGGTGAGAGTAAGAGG - Intronic
1120955572 14:90079176-90079198 TGGAGGAAAGGGAGAGCGAGGGG + Intronic
1121158340 14:91709171-91709193 TGGAGAGTGGTGACAGCAAGAGG - Intronic
1121424719 14:93841671-93841693 TGGGGGGGGGTGAGAGGGAGGGG - Intergenic
1121507150 14:94486006-94486028 TGGGGGAGGGGCAGGGCAAGTGG - Intergenic
1121526326 14:94621837-94621859 TGGAAGAAGGTGGGAGCAGGAGG - Intronic
1121718912 14:96095786-96095808 TGGAGGAGGGGGAGAGGAAGGGG + Intergenic
1122147751 14:99703334-99703356 TGGAGGAGGGAGACAGGAGGAGG - Intronic
1122253928 14:100463057-100463079 AGGAGCAGGGGGAGAGGAAGGGG - Intronic
1122425508 14:101603106-101603128 TGGAGGAGGGAGAAATGAAGAGG + Intergenic
1122603080 14:102930774-102930796 CGGAGGAGGGGGAAAGGAAGGGG - Exonic
1122727483 14:103767664-103767686 GGGAGGAGAGCGAGAGCAAGAGG - Intronic
1122822402 14:104354204-104354226 GGGAGGAGGGTGAGCTCTAGGGG + Intergenic
1122861601 14:104585052-104585074 AGGGGGAGGGTGAGAGTGAGGGG - Intronic
1202897318 14_GL000194v1_random:17711-17733 AGGAGGAGGGAGAGAGAAGGGGG - Intergenic
1123907699 15:24936667-24936689 AGCAGGAGAGAGAGAGCAAGGGG + Intronic
1124356358 15:28997851-28997873 TGCAGATGGGTGAGAGCAATTGG - Intronic
1125492989 15:40162214-40162236 AGGCTGAGGGTGAGAGCTAGGGG + Intronic
1125542072 15:40475359-40475381 GGGAGGAGGGTGTGAGGAAGAGG + Intergenic
1125928860 15:43585440-43585462 TGAAGGAGAGAGAGAGCATGGGG - Intronic
1125942026 15:43685275-43685297 TGAAGGAGAGAGAGAGCATGGGG - Intergenic
1127052754 15:55101718-55101740 AGAAGGAGGGTAAGAGCATGAGG - Intergenic
1127369352 15:58322914-58322936 TGGAGGTGGGAGGGAGGAAGAGG - Intronic
1127727605 15:61765429-61765451 TTGAGGAGGTTGAGAACAAATGG + Intergenic
1128095058 15:64947728-64947750 TGGAGGAGGGACAGAGCACCAGG - Intronic
1128108602 15:65062103-65062125 TGGAGGAGGAGGAGAGCAAGAGG + Intronic
1128130380 15:65223388-65223410 TGGAGGAGGCTGAGAAGCAGAGG - Intergenic
1128282141 15:66404746-66404768 TGAAGGAGGGTGAGAGCTGGAGG + Intronic
1128310759 15:66630646-66630668 GGAAGGTGGGTGAGAGAAAGGGG + Intronic
1128670607 15:69572237-69572259 TGGATGAGGGTGACTGCAGGGGG - Intergenic
1128756565 15:70187465-70187487 AGGAGGAGGAGGAGAGCCAGGGG + Intergenic
1128843896 15:70872419-70872441 AGGAGGAGGGGGAGGGCGAGGGG + Intronic
1129107475 15:73319595-73319617 TTGAGGAGGGTGAGAGCGAGTGG - Intergenic
1129145886 15:73646812-73646834 TGGAGGAGGGGGAGGGGGAGGGG + Intergenic
1129545074 15:76387129-76387151 TGGATGTGGGTGTGAGAAAGAGG + Intronic
1129602282 15:77007179-77007201 TGAAGAAGAGTGAGAGCAGGTGG - Intronic
1130106467 15:80932251-80932273 TTGAGCAGGGAGAGAGCAAGCGG - Intronic
1130226111 15:82059210-82059232 AGGAGGAGGGAGAGGGGAAGAGG - Intergenic
1130720977 15:86385976-86385998 AGGAGGAGGATGAGAGGGAGAGG - Intronic
1130720994 15:86386021-86386043 AGGAGGAGGATGAGAGGGAGAGG - Intronic
1130980837 15:88810944-88810966 TGGGGAAGGAAGAGAGCAAGTGG - Intronic
1131017871 15:89072549-89072571 AGCAGGAGGGGGAGAGGAAGGGG + Intergenic
1131266305 15:90917467-90917489 TGGAGGAGGGTGACAGCGGGAGG + Intronic
1131473264 15:92714586-92714608 AGGAGGAGGGCGAGGGGAAGCGG - Intronic
1131506120 15:93020981-93021003 TAGAGAAGGGTGGGAGCGAGGGG - Intronic
1132047297 15:98575172-98575194 GGGAGGAGGAGGAGAGAAAGGGG - Intergenic
1132399308 15:101495771-101495793 GGGAGGAGGGGAAGAACAAGAGG + Intronic
1132744969 16:1432727-1432749 AGGAGGAGGGCGAGGGCGAGGGG + Intergenic
1132989822 16:2786912-2786934 TGGAGGAGGGAGTGAGGATGAGG - Intronic
1133026228 16:2990042-2990064 GTGAGGAGTGTGAGAGAAAGAGG - Intergenic
1133176770 16:4021423-4021445 TGGAGGAGGCTGGTAGAAAGTGG - Intronic
1133460744 16:5984167-5984189 AGGAGGAGGGGGAGGGGAAGGGG - Intergenic
1133520263 16:6549476-6549498 AGGAGGAGGGGAAGAGGAAGAGG + Intronic
1133694413 16:8247906-8247928 TGGAGGAGTGTGTGGGCACGTGG + Intergenic
1133842741 16:9424928-9424950 TGGGGGAGGGAGGGAGAAAGTGG + Intergenic
1133927470 16:10204872-10204894 TGGAGGAGGGTTTAAGAAAGTGG + Intergenic
1134222001 16:12362384-12362406 TGGAGGAGGCTGGGAGGAGGTGG - Intronic
1134561473 16:15213678-15213700 CGGAGGAGGGACAGAGAAAGAGG - Intergenic
1134922011 16:18125298-18125320 CGGAGGAGGGACAGAGAAAGAGG - Intergenic
1135020198 16:18956623-18956645 TTGAGGAGGCTGAGAGGAGGTGG - Intergenic
1135516645 16:23141189-23141211 TGGAGGAGGTGGAGAGGCAGGGG - Intronic
1135969091 16:27059204-27059226 TGGGGGATGCTGAGGGCAAGAGG + Intergenic
1136050519 16:27646849-27646871 TGGAGGATGGTCAGAGTAACAGG - Intronic
1136173083 16:28499846-28499868 AGGAGGAGGAGGAGAGGAAGGGG - Exonic
1137260542 16:46825077-46825099 TGTAATAGGGTCAGAGCAAGGGG + Intronic
1137482958 16:48867531-48867553 TGGTTGAGGGAGAGAACAAGAGG + Intergenic
1137556995 16:49477135-49477157 AGGAGGAGGGTGAGCGGAAGGGG + Intergenic
1137753019 16:50880528-50880550 TGGAGGAGGGTATGAAAAAGGGG + Intergenic
1137767123 16:50986407-50986429 TGCTGGAGGGTGAGACCACGTGG + Intergenic
1138116291 16:54363048-54363070 TGGCGCAGGGTGAGAGCAAGGGG - Intergenic
1138153948 16:54685813-54685835 AGGAGGAGGGGGAAAGGAAGAGG - Intergenic
1138687569 16:58739023-58739045 TGGAGGAGAGAGTGAGCCAGGGG + Intergenic
1138963356 16:62053660-62053682 TGGAGGAAGGCAAGAGCAATGGG - Intergenic
1139649443 16:68355052-68355074 TGGAGGACGGCCAGAGCAGGAGG - Intronic
1139744856 16:69066169-69066191 TGAAGGCGAGTGAGAGGAAGAGG - Intronic
1140127827 16:72132640-72132662 TGGAGGAGGGCGAGGGGAAGTGG + Intronic
1140256268 16:73338928-73338950 GGCAGGAGGAAGAGAGCAAGGGG - Intergenic
1141170027 16:81685196-81685218 GGAAGGAGGGAGAGGGCAAGTGG - Intronic
1141269191 16:82523366-82523388 GGGAGGAGGGTCAGAGTCAGGGG - Intergenic
1141617951 16:85220933-85220955 TGGAGGAGGGGGTGGGCAGGAGG - Intergenic
1141629348 16:85278179-85278201 TGCAGGAGGGTGAGTCCAGGGGG - Intergenic
1142211886 16:88812318-88812340 TGGAGAAGGGCGTGAGGAAGCGG + Intergenic
1142358051 16:89613440-89613462 AGGAGGAGGGAGAGAGGAGGAGG - Intronic
1142358055 16:89613454-89613476 TGCAGGAGGGAGAGAGGAGGAGG - Intronic
1142692208 17:1613421-1613443 TAGAGGAGGGGGTGAGAAAGGGG - Intronic
1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG + Intronic
1142958200 17:3535305-3535327 GGGAGGAGGGAGAAAGGAAGAGG - Intronic
1143026289 17:3943769-3943791 TGAAGGAGGCTGACAGGAAGTGG - Intronic
1143054630 17:4153654-4153676 TGGAGGAGGGTGATGGCAGTGGG + Intronic
1143758690 17:9085334-9085356 TGGAAGAGGGAAAGAGGAAGGGG + Intronic
1144053634 17:11519066-11519088 TGAAGGAGGGAGAGGGGAAGAGG - Intronic
1144667622 17:17112637-17112659 GGGAGGAGGCTGGGAGTAAGTGG - Intronic
1144794485 17:17881766-17881788 GGGAGTACGGTGAGAGCAGGAGG - Intronic
1144964778 17:19070111-19070133 AGGAGGAGGGGGAGTGGAAGAGG - Intergenic
1144983189 17:19182067-19182089 AGGAGGAGGGGGAGTGGAAGAGG + Intergenic
1144985036 17:19196172-19196194 AGGAGGAGGGGGAGTGGAAGAGG - Intergenic
1145064484 17:19752900-19752922 CGGAGGTGAGTGCGAGCAAGGGG + Intergenic
1145283175 17:21483229-21483251 TGGAGGAGGTGGAAAGGAAGAGG - Intergenic
1146213175 17:30957759-30957781 TGGAGGAGAGGGACAGCAAAGGG - Intronic
1146987348 17:37232896-37232918 TGGAGGAGGAGGAGGACAAGGGG - Intronic
1147227564 17:38991582-38991604 AGCAGGAGAGAGAGAGCAAGCGG - Intergenic
1147309258 17:39584733-39584755 TGGAAGAGGGAATGAGCAAGGGG + Intergenic
1147310865 17:39595526-39595548 GGGAGGAGGGAGAGAGGAAAGGG + Intergenic
1147458632 17:40554405-40554427 CCAAGGAGGGTGAGTGCAAGGGG - Exonic
1147799036 17:43069166-43069188 TGGCGGAGGGTGGTAGCAAAAGG - Intronic
1147934808 17:44005379-44005401 TGGGGGAGGGGCAGTGCAAGCGG - Intronic
1147977205 17:44254706-44254728 TGGGGAAGGGTGGGAGCAGGAGG + Intronic
1148670756 17:49408399-49408421 TTGAGGAGGGTGAGGGGAAGGGG - Intronic
1148736621 17:49868738-49868760 GGGAAGAGAGTGAGGGCAAGAGG - Intergenic
1149422161 17:56521476-56521498 GGGGGCAGGGTGAGAGCAGGGGG + Intergenic
1149563972 17:57628689-57628711 TGGAGGAGTTTGAGTGCAGGTGG + Intronic
1149604859 17:57917269-57917291 TGGAGGAAGATGACAACAAGAGG + Intronic
1149834890 17:59903681-59903703 TGGGGGAGGATGAGAGAAACTGG - Intronic
1150103914 17:62447892-62447914 TGGAAGAGGGTGTGAGCAGCAGG - Intronic
1150266036 17:63832993-63833015 TGGAGAAGGGAGAAACCAAGTGG + Intronic
1151334144 17:73430220-73430242 TGGAGGAGGGGGTGAGGGAGGGG - Intronic
1151343463 17:73486752-73486774 TGAAGCAGGGTGACAGGAAGTGG + Intronic
1151540222 17:74760981-74761003 TGGAGGAGGGGGAGAGGGACAGG + Intronic
1151872689 17:76847211-76847233 AGGAGGAGGAGGAGAACAAGGGG + Intergenic
1152094805 17:78266865-78266887 TGGAGCATGGTGTGAGCAGGAGG + Intergenic
1152353576 17:79796351-79796373 AGGAGCAGGGTGAGAGCAGAGGG + Intronic
1152400781 17:80065091-80065113 GGGAGGAGGGGGAGAGGGAGGGG - Intronic
1152598358 17:81249208-81249230 GGGAGGAGGGAGGGAGAAAGAGG + Intronic
1152863417 17:82709109-82709131 TGGAGCAGGGGGAGGGCATGGGG - Intergenic
1153040864 18:812184-812206 TGGAGGAGGGAGAGGGCCCGCGG - Intronic
1153285663 18:3452209-3452231 TGGAGGAGGGGGGGCGCAGGAGG - Exonic
1153324818 18:3807729-3807751 TGGGGGAGGGAGAGAGCATCAGG - Intronic
1153588867 18:6652226-6652248 TGTAGGAGTGTGGGAACAAGGGG + Intergenic
1153828032 18:8895289-8895311 TGGAGGAGGAAGAGAGAAAAGGG - Intergenic
1154220342 18:12447420-12447442 TGGAGGGGGGTGGTAGAAAGGGG + Exonic
1155130353 18:22928568-22928590 TGAAAGAGGGAAAGAGCAAGGGG + Intronic
1155169896 18:23259667-23259689 TGGAGGAGGGTGAGAGATGCAGG + Exonic
1156501505 18:37562479-37562501 TTAAGGAAGGGGAGAGCAAGAGG + Intronic
1156779797 18:40837701-40837723 TGGTGGAGGGTGAGCAGAAGGGG - Intergenic
1157170186 18:45396810-45396832 GGGTGGAGGGTGGGAGGAAGGGG - Intronic
1157191221 18:45583347-45583369 TGGATGAGGGTGAGATGCAGGGG - Intronic
1157242368 18:46023119-46023141 TGGAGGATGGGAAGAGGAAGAGG + Intronic
1157302018 18:46485962-46485984 TGGGGGAGGGAGAGGGAAAGAGG - Intronic
1157323166 18:46649485-46649507 ACGAGGAGGCTGAGGGCAAGAGG + Intronic
1157643410 18:49242060-49242082 TGGGGTGGGGTGAGAGCAAGTGG - Intronic
1157932631 18:51840179-51840201 TGGAGGCGGGGGAGTACAAGTGG + Intergenic
1158106939 18:53896111-53896133 GGAAGGAGGGTAAGAGAAAGAGG + Intergenic
1158196163 18:54887070-54887092 GGGAGGAGAGAGAGAGAAAGAGG - Intronic
1158220521 18:55146080-55146102 TGGAAGTGGCTGAGAGCAAATGG - Intergenic
1158382703 18:56951383-56951405 AGGAAGAGGGTGTGAGGAAGAGG - Intronic
1158462673 18:57660294-57660316 AGGAGGATGATGAGAGCACGTGG + Intronic
1158680821 18:59565203-59565225 TAGAGGAGGGAGGGAGGAAGGGG + Intronic
1158938230 18:62384474-62384496 TGGAGGAGGGAGGGGGGAAGGGG - Intronic
1159116124 18:64114977-64114999 TGGAGGAGGGTGGGAGGAGAAGG - Intergenic
1159543821 18:69814697-69814719 TGAAGGAGAGAGAGTGCAAGGGG + Intronic
1159982795 18:74806419-74806441 AGGAGGAAGGCGAGAGCCAGGGG + Intronic
1160197857 18:76771651-76771673 TGGAGCAGGGTGACAGTGAGAGG + Intergenic
1160370487 18:78368753-78368775 TGGTGGAGCGTGGGAGGAAGTGG + Intergenic
1160527894 18:79548023-79548045 TGGAGGAGTGAGAGAGTGAGTGG + Intergenic
1160819788 19:1052546-1052568 AGGAGGAGGGGGAGAAGAAGGGG + Intronic
1160819813 19:1052609-1052631 AGGAGGAGGGGGAGGGAAAGGGG + Intronic
1161195396 19:2983605-2983627 TGGAGCAGAGTGAGAGGAGGAGG + Intronic
1161264508 19:3358295-3358317 AGGGTGAGGGTGAGAGCAGGTGG - Intergenic
1161501008 19:4615722-4615744 TGGAGGGAGGTGGGAGCCAGAGG - Intergenic
1161950975 19:7467784-7467806 TGCAGGAGTGTAAGAGCAAACGG + Intronic
1162021574 19:7870568-7870590 TGAGGGAGGGGGAGAGAAAGGGG + Exonic
1162569004 19:11460079-11460101 TGGAGGCGGGCGGGAGCAGGAGG - Intronic
1162740828 19:12772694-12772716 TGGGGGAGGCTGAGACCCAGGGG + Intronic
1162770952 19:12949024-12949046 TGGAGGAGGGTGGCAGCAGGAGG + Intronic
1163083338 19:14959668-14959690 TTCAGGAAGGTGAGAGCATGGGG - Intronic
1163444667 19:17339410-17339432 TGGGGGAGGGTCAGAAGAAGAGG - Intronic
1163556574 19:17996840-17996862 TGGAGGAAGCTGGGAGGAAGAGG + Intronic
1163674265 19:18647526-18647548 TGGAGGAGGAAGAGAGGAGGAGG + Intronic
1163827819 19:19533464-19533486 AGGAGGAGGGTAAGAGGAGGGGG - Intronic
1164760231 19:30722987-30723009 TGGAGGGTGGTGGGAGCAGGTGG + Intergenic
1164855879 19:31520295-31520317 TGTAGGAGATTGAAAGCAAGGGG - Intergenic
1165941691 19:39417720-39417742 TGGATGAGGGAGTGAGCGAGGGG + Intronic
1166273368 19:41732974-41732996 TGGATGAGGGTGACAGAAATAGG - Intronic
1167078625 19:47264460-47264482 TGGAGCACGCTGAGAGCAAATGG + Intronic
1167111453 19:47464522-47464544 TGAAAGAGGGAGAGAGAAAGAGG - Intronic
1167120118 19:47511867-47511889 TGGGGGAGAGTGACAGCAGGAGG - Intronic
1167130523 19:47582276-47582298 AGGAGGAGGGGGAAAGGAAGAGG - Intergenic
1167354270 19:48993568-48993590 AGGAGGAGGGTGGGATAAAGAGG + Exonic
1167482209 19:49740013-49740035 GGGAGGAGGGTGAGATCTTGGGG - Intronic
1167535404 19:50047786-50047808 TGGAGGAAGGTCATAGGAAGAGG - Exonic
1167611292 19:50508908-50508930 CGGAGGAGGCTTGGAGCAAGAGG + Intronic
1167665477 19:50820933-50820955 TGGGGGAGGGTGGGGGCAGGTGG + Intronic
1167694638 19:51007548-51007570 TGGAAGAGAGTGAGAGGCAGGGG - Intronic
1167698384 19:51027881-51027903 TGGAGGAGGGAGGGAGTGAGGGG - Intronic
1167747022 19:51357838-51357860 TGGAAAAGGATGAGAGGAAGTGG + Intronic
1167794047 19:51697604-51697626 TGTAGGTGGGTGAGGGCAATGGG + Intergenic
1167852927 19:52215744-52215766 AGGAGGAGGGGGAGAGTGAGAGG - Intronic
1168236656 19:55067940-55067962 CGGAGGAGGGGGACAGAAAGAGG - Intronic
1168263694 19:55209594-55209616 GGGAGGAAGGTGAGGGCCAGCGG - Intergenic
1168433887 19:56302612-56302634 AGGAGGAGGGAGGGAGGAAGAGG - Intronic
925032274 2:660180-660202 GGGAGGAGGGAGGGAGCAGGTGG + Intergenic
925058383 2:872509-872531 GGGAGGAGGATGGGAGGAAGGGG - Intergenic
925537098 2:4929415-4929437 TGGAGGAGGCTGAGGGCCAAGGG + Intergenic
925582283 2:5423256-5423278 AGCAGGAGAGAGAGAGCAAGGGG - Intergenic
925600563 2:5604748-5604770 TGGAAGAGCAAGAGAGCAAGGGG + Intergenic
925669854 2:6300057-6300079 TGGAGGAGGGAGAGATCACTAGG - Intergenic
926373654 2:12205291-12205313 AGGAGGAGGAAGAGAGCAAAGGG - Intergenic
926731903 2:16041881-16041903 TGGAGGAGGGTGGGAGAGGGAGG + Intergenic
927464807 2:23329025-23329047 AGGAGGAGGATGAGAGCAGAGGG - Intergenic
927711354 2:25328379-25328401 TGGGAGAGGGTGGGAGCCAGGGG - Intronic
927901100 2:26819097-26819119 TGGAGGAGAGCAAGAGCAGGAGG - Intergenic
927963494 2:27255188-27255210 GGTAGGAGGGAGAGAGGAAGGGG + Exonic
927967449 2:27279951-27279973 AGGAGGAGGGGGAGGGGAAGAGG + Intronic
927981598 2:27378181-27378203 TGGAGGAGGGTGAGGGTAGTCGG - Exonic
928878872 2:36073862-36073884 TGGAGGAGTGAGACAGCAGGAGG + Intergenic
929967377 2:46545208-46545230 TGGAGGATGTGGAGGGCAAGGGG + Intronic
930812695 2:55559614-55559636 AGCAGGAGAGAGAGAGCAAGGGG - Intronic
931245884 2:60492516-60492538 GTGAGGAAGGAGAGAGCAAGGGG - Intronic
931373754 2:61688879-61688901 AGGAGGAGGGTGGGGGCATGGGG + Intergenic
931440338 2:62285799-62285821 TGGAGGCGGGGAAGAGGAAGGGG + Intergenic
932577037 2:72968388-72968410 GGGAGGAGGGGGAGAGGGAGGGG - Intronic
932695477 2:73952699-73952721 GGGAGGAGTGAGAGAGGAAGTGG + Intronic
932801782 2:74747742-74747764 TGGAGGTGGGTGGGAGCTTGGGG - Intergenic
932822000 2:74909412-74909434 TGGGGGAGCGTAAGAGCAAGCGG - Intergenic
933296843 2:80500671-80500693 AGGGGGAGGGAGAGAGAAAGTGG - Intronic
933600258 2:84321738-84321760 GGGAGTGGGGTGAGAGGAAGAGG - Intergenic
934103611 2:88676479-88676501 AGGAGCAGGGTGGGAGCCAGTGG - Intergenic
934658340 2:96129704-96129726 GGGAGCAGGGTGAGATCACGGGG - Intronic
934658903 2:96132723-96132745 TGCAGGGTGATGAGAGCAAGTGG + Intronic
935108969 2:100074274-100074296 TGGAGGAGGAACAGAGCAGGAGG - Intronic
935556755 2:104518731-104518753 TGGAAGAGAGGGAGTGCAAGGGG + Intergenic
935660227 2:105460478-105460500 TGTAGGAGGGAGAGGGAAAGGGG + Intergenic
936521532 2:113214854-113214876 GGGAGGATGGTGAGGGCAGGTGG + Intergenic
936976352 2:118225388-118225410 TGGAGGATGGTGAGAGAGGGAGG - Intergenic
937342188 2:121098415-121098437 GGGAGAAGGGTGTGAGCTAGGGG - Intergenic
937635627 2:124152598-124152620 TTGTGGAGGGAGAGAGCATGTGG + Intronic
937686847 2:124707049-124707071 AGGAGGAGGAGGAGAGGAAGAGG + Intronic
937705068 2:124911175-124911197 AGGAGCAGGGTGAGGGCATGTGG + Intronic
937872206 2:126793880-126793902 TGGGGGAGGGGGAGAGGGAGGGG + Intergenic
938106310 2:128532954-128532976 TGGGAGGGGGTGAGAGCCAGGGG + Intergenic
938289990 2:130143923-130143945 GGGAGGAGGGAGGGAGAAAGGGG + Intronic
938451730 2:131426681-131426703 AGGAGGAGGATGAAAACAAGAGG + Intergenic
938466534 2:131529014-131529036 GGGAGGAGGGAGGGAGAAAGGGG - Intronic
938490995 2:131761086-131761108 AGGAGGAGGGAGAGAGAAGGGGG + Intronic
938685827 2:133736824-133736846 AGGAGGAGGAAGAGAGAAAGAGG + Intergenic
938706210 2:133929784-133929806 TAGAGGAGGGAGAGAATAAGGGG + Intergenic
940139299 2:150475586-150475608 TGAATGAGGGAGAGAGGAAGAGG + Intronic
940204110 2:151183629-151183651 AGGAGGAGGGGAAGAGCCAGTGG - Intergenic
940353487 2:152715503-152715525 TGGAGGAGGGTGAGGGAGGGTGG - Intronic
941749015 2:169116238-169116260 TGGAGGAGTGTGGGGACAAGAGG - Intergenic
941918692 2:170828675-170828697 AGGAGGAGGGTGAGGACAACAGG - Intronic
942075809 2:172356239-172356261 GGGAGGAGGGTGACAGCGAGAGG - Intergenic
942133883 2:172906548-172906570 AGGAGGAGGGGGAAAGCAAGGGG + Intronic
942277885 2:174336052-174336074 AGGAGGAGGGCAAGAGGAAGTGG - Intronic
942298245 2:174537722-174537744 TGGGGGAAGGGGAGAGCAAGTGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942659178 2:178246092-178246114 TGGAGATAGGTGAGAGCAGGTGG - Intronic
942919888 2:181359682-181359704 TGGAGGATGGGGAGAGGGAGAGG + Intergenic
943277765 2:185889966-185889988 TGTAGGATGGCGAGAGTAAGTGG - Intergenic
944087825 2:195869716-195869738 GGGATGAGGATGAGAGCAGGAGG + Intronic
945197561 2:207251467-207251489 GGAAGGAGGGAGAGAGGAAGAGG - Intergenic
945869720 2:215213996-215214018 AGGAGGAGGATGAGAGAAGGAGG + Intergenic
946401113 2:219468868-219468890 TGGAGGAGAGTGAGAACTTGCGG + Exonic
946449547 2:219768164-219768186 TGAAGGAGGGTCAGAGTCAGTGG + Intergenic
946701992 2:222424070-222424092 TGCAGGAAGGTGAGAGTACGTGG + Intergenic
946705831 2:222457942-222457964 TGGAGCAGGGTCAGAGCAGGGGG + Intronic
946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG + Intergenic
947367535 2:229412651-229412673 AAGAGGAGGGAGAGAGAAAGGGG + Intronic
947427837 2:229999849-229999871 GGGTGGAGGGTGGGAGGAAGAGG - Intronic
947991091 2:234488050-234488072 TGGAGGAGGCTGAGGACATGTGG + Intergenic
948224820 2:236300677-236300699 TGGATGAGAGAGAGAGAAAGAGG - Intergenic
948458437 2:238118014-238118036 TGGAGGAGGGTGAATGGAGGAGG + Intronic
948458445 2:238118043-238118065 TGGAGGAGGGTGAATGGAGGAGG + Intronic
948458633 2:238118728-238118750 TGGAGGAGGGTGGTTGCAGGAGG + Intronic
948458664 2:238118828-238118850 TGGAGGAGGGTGGAAGGAAGAGG + Intronic
948458714 2:238119025-238119047 TGGAGGAGGGTGAATGGAGGAGG + Intronic
948458762 2:238119210-238119232 TGGAGGAGGGTGGAAGGAAGAGG + Intronic
948458791 2:238119334-238119356 TGGAGGAGGGTGAATGGAGGAGG + Intronic
948883614 2:240872485-240872507 CGGAGGAGGGTGAGAGTTTGTGG + Intronic
1168996202 20:2135058-2135080 GGGAGTAGGGAGAGAGCTAGAGG + Intronic
1170589520 20:17761288-17761310 TGTGGGAGTGGGAGAGCAAGAGG + Intergenic
1171110132 20:22473129-22473151 TGGGGGAGGGGGAGAGAAAGAGG + Intergenic
1171255918 20:23689008-23689030 GAGAGGAGGGTGAGAGCCCGAGG + Exonic
1171263266 20:23750905-23750927 GAGAGGAGGGTGAGAGCCCGAGG + Exonic
1171363269 20:24605419-24605441 TGGGGGAGGGAGAGAGAGAGAGG - Intronic
1171457657 20:25281004-25281026 TCGAGGAGGGGGACTGCAAGCGG + Exonic
1171773312 20:29343917-29343939 AGCAGGAGGATGAGAGAAAGGGG + Intergenic
1172205647 20:33161083-33161105 AGGAGGAGGAGGAGAGCCAGGGG - Intergenic
1173280296 20:41620916-41620938 TGGGGAGGTGTGAGAGCAAGAGG + Intergenic
1173283444 20:41649403-41649425 TGGAGGAGGGAGACAGAGAGGGG + Intergenic
1173400555 20:42722300-42722322 TGGAGGTGGGTGTGAGGCAGTGG - Intronic
1173437002 20:43042473-43042495 TGCAGGAGGGAAAGAGAAAGGGG + Intronic
1173575956 20:44113095-44113117 TGGGGCAGGGTGGGAGGAAGGGG + Exonic
1173681123 20:44882880-44882902 TGGAGGAGGGAGAGGGAATGTGG + Intergenic
1173937155 20:46876760-46876782 TGGAGATGGGTGAGAGAAAGAGG - Intergenic
1174011655 20:47454619-47454641 AGGAGGAGGAGGAGAGGAAGAGG - Intergenic
1174525868 20:51170705-51170727 TGGAGGAAGGAGAAAGAAAGAGG - Intergenic
1174725669 20:52859228-52859250 TGGTGGTAGGTGTGAGCAAGTGG - Intergenic
1174933082 20:54836934-54836956 TGGAGGGGGGTGAGGGGAAGTGG - Intergenic
1175009336 20:55719186-55719208 AGGAGGAGACTGAGAGCAAGGGG + Intergenic
1175100621 20:56576240-56576262 AGGAGGAGGAGGAGGGCAAGGGG - Intergenic
1175195137 20:57238109-57238131 TGGAGGAGGGAGGAAGAAAGGGG - Intronic
1175238437 20:57528533-57528555 GGGAGGAGGGATAGAGAAAGGGG + Intergenic
1175570173 20:60012244-60012266 TGCAAGAGGGTGGGAGCAGGTGG + Intronic
1175657799 20:60787010-60787032 AGGAGGAGGGGGAAAGGAAGGGG - Intergenic
1175791001 20:61739665-61739687 TAGAGGAGGGTGAGTGACAGCGG + Intronic
1175890313 20:62313036-62313058 TGGGGCAGGGTCAGTGCAAGTGG + Intronic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1176019198 20:62953916-62953938 GGGAAGAGGAAGAGAGCAAGGGG - Intronic
1176037893 20:63049243-63049265 AGGAGGAGGAGGAGAGGAAGAGG - Intergenic
1176160932 20:63648266-63648288 CGGGGGAGGGAGAGAGCAAGAGG + Intronic
1176222459 20:63976238-63976260 GGGAGGAGAGAGAGAGGAAGCGG + Intronic
1176419995 21:6506374-6506396 TGGAGGAGGGTGGGAGAAGCTGG + Intergenic
1176617003 21:9033700-9033722 AGGAGGAGGGAGAGAGAAGGGGG - Intergenic
1177788472 21:25696409-25696431 AGGAGGAGGGGGAGAGGGAGAGG + Intronic
1178213948 21:30571967-30571989 TGGAGGAGGGTGGCAGGAGGGGG + Intergenic
1178307462 21:31502504-31502526 TGGGGGAGGGTGGTAGGAAGTGG - Intronic
1178709956 21:34908014-34908036 TGGAGGAGTGGCAGAGCATGGGG - Intronic
1178742584 21:35216033-35216055 TGGACTAGGGTGAAAGCAAAAGG + Intronic
1178892107 21:36528829-36528851 TGGAGAAGGGGGAGAGGAGGAGG - Intronic
1179030025 21:37712458-37712480 GGGAGGAGGGAGAGAGGAGGAGG - Intronic
1179080204 21:38163686-38163708 TGGAGGAGGAGAAGAGAAAGAGG - Intronic
1179301571 21:40116165-40116187 GGGTGGAGGGTGAGAGGAGGGGG + Intronic
1179473959 21:41631658-41631680 TGGAGGAGGGCAACAGCCAGTGG + Intergenic
1179626240 21:42651092-42651114 TGGAGGAGGGTGCATGGAAGGGG - Intergenic
1179695486 21:43114694-43114716 TGGAGGAGGGTGGGAGAAGCTGG + Intergenic
1180230365 21:46423696-46423718 AGGAGGAGGGGGAGAGGAGGAGG + Intronic
1180292208 22:10857195-10857217 AGGAGGAGGGAGAGAGAAGGGGG + Intergenic
1180495013 22:15886617-15886639 AGGAGGAGGGAGAGAGAAGGGGG + Intergenic
1180872532 22:19154640-19154662 AGGAGGAGGGGGAGGGGAAGGGG - Intergenic
1181033733 22:20160184-20160206 TGGAGGAGCTGGAGAGCTAGAGG - Intergenic
1181047541 22:20222752-20222774 TGGAGGAGGGAGGGAGCAGCAGG + Intergenic
1181116056 22:20633148-20633170 TGGAGGAGGGAGAGGGCAGAGGG - Intergenic
1181260477 22:21593666-21593688 TTCAGGAGAGTGAGAGGAAGGGG - Intronic
1181495195 22:23283698-23283720 TGGAAGAGGGTGGGAGGATGGGG - Intronic
1181551424 22:23641063-23641085 TGGATGGGGGTGAGAGCCTGGGG - Intergenic
1181775972 22:25160531-25160553 TGGAGGAGGGAGAGCAGAAGAGG - Intronic
1182018335 22:27059972-27059994 TGGAGGTGTGTGAGGGAAAGGGG + Intergenic
1182072442 22:27473310-27473332 GGGAGGAAGGGGAGAGGAAGAGG - Intergenic
1182182070 22:28360122-28360144 AGGAGGAGAGAGAGAGAAAGAGG - Intronic
1182279817 22:29211778-29211800 TGAAGGAGGGAGGGAGGAAGAGG - Intronic
1182930142 22:34165892-34165914 TGGAGGAGGATGGGAGCCAAGGG + Intergenic
1183005185 22:34895376-34895398 GGGCGGAGGGCGAGAGAAAGTGG - Intergenic
1183078961 22:35444212-35444234 GGGAGGAGGGAGAGAGGGAGAGG + Intergenic
1183773273 22:39945376-39945398 TGCAACAGGGTGATAGCAAGGGG - Intronic
1184297828 22:43537026-43537048 TGGAGGAGGGCGGGATGAAGGGG - Intronic
1184479265 22:44737498-44737520 AGGAGGAGCGTGGGAGCGAGCGG - Exonic
1184617673 22:45648934-45648956 AGGAGGAGGCTGAGAGCATGGGG - Intergenic
1184700838 22:46171594-46171616 TGGAAGCAGGTGAGAGCAGGTGG + Intronic
1184803488 22:46776687-46776709 GGGAGGAGAGAGAGAGGAAGGGG + Intronic
1184874287 22:47263271-47263293 TGGAGGAGCATGAGAGGGAGAGG + Intergenic
1185013764 22:48331788-48331810 AGGAGGTGGCTGAGGGCAAGGGG + Intergenic
1185239448 22:49734917-49734939 TGCAGGAGGGTGAGTGGGAGGGG - Intergenic
1185276814 22:49953499-49953521 TGGGGGTGGGGGAGAGGAAGGGG - Intergenic
949616231 3:5756786-5756808 TGGAGGAGTGTGAGAGAACAGGG + Intergenic
949768184 3:7550240-7550262 AGGAGGAGGAGGAGAGAAAGTGG - Intronic
949843907 3:8351457-8351479 AGGATGAGGGTGAGCACAAGTGG + Intergenic
949933674 3:9100241-9100263 TGGAGAAAGGTAAGAGCCAGTGG - Intronic
950106450 3:10391979-10392001 TGGAGGAGGTTGTGAGCAAGAGG - Intronic
950353265 3:12378662-12378684 AGCTGGAGGGTGAGAGCAATGGG + Intronic
950396378 3:12737237-12737259 AGGAGGAAGGGGAGGGCAAGAGG - Intronic
950405139 3:12799611-12799633 TCAGGGAGGGTGAGAGCAGGAGG - Intronic
950544299 3:13629610-13629632 TGGAGGAAGGCGAGAGGAAGAGG - Intronic
950575974 3:13832250-13832272 AGCAGGAGGATGGGAGCAAGAGG - Intronic
950940885 3:16890204-16890226 TGGAGGAGGAGGAAAGCAAAAGG - Intronic
951595740 3:24316474-24316496 GGAACAAGGGTGAGAGCAAGAGG - Intronic
951747878 3:25999366-25999388 TGAAGCAGGGTGAGCACAAGGGG - Intergenic
952166952 3:30760543-30760565 TGGAAGATGGTAAGAGAAAGAGG - Intronic
952450033 3:33422755-33422777 AGGAGGAGGGGGGGAGAAAGGGG + Intronic
954320863 3:49831190-49831212 TGGAGGTGGAAGGGAGCAAGAGG - Intronic
954327538 3:49871658-49871680 TGCATGTGGGTGAGAGCACGTGG + Intergenic
955146437 3:56324791-56324813 TGAATGAAGGTGAGAGCCAGAGG - Intronic
955506136 3:59635037-59635059 TGGGGGCAGGTGAGAGCAAGGGG - Intergenic
955670241 3:61394403-61394425 AGGGGGAGGGGGAGAGCGAGAGG + Intergenic
956313947 3:67913792-67913814 AGGAGGAGGAGGAGAGGAAGAGG - Intergenic
956737580 3:72249722-72249744 GGGTGGAGGGTGGGAGGAAGGGG + Intergenic
956847435 3:73196319-73196341 AGGAGGAGGATGAGAAGAAGAGG - Intergenic
957718180 3:83960410-83960432 TAGAGGAGGGAGAGAGGGAGAGG - Intergenic
958107489 3:89095387-89095409 TGGAGTAAGGTGATAGAAAGGGG + Intergenic
958859611 3:99430505-99430527 TGGAGGAGAGAGAGTGCATGAGG - Intergenic
958906603 3:99948634-99948656 AGGAGGAGGGAGAAAGAAAGAGG + Intronic
958937385 3:100271612-100271634 TGGAGGGGGCTGAGATCAAAGGG + Intronic
959828346 3:110829578-110829600 TGGACTATGGTGTGAGCAAGAGG - Intergenic
960047378 3:113211453-113211475 TGGAGGAGGCTGGGAGGAGGGGG - Intronic
960668105 3:120130834-120130856 TGCAGGTGGATGAGAGGAAGCGG - Intergenic
960991279 3:123313283-123313305 TGGAGGGTGGAGAGAGAAAGGGG + Intronic
961004040 3:123392743-123392765 TGGTGGAGGGAGAGAGAGAGAGG - Intronic
961191726 3:124968039-124968061 TGGGGGAAGGTGAGAGGAAGGGG - Exonic
961481510 3:127183739-127183761 TGGAGGAGGGGGAGAGGGAGGGG - Intergenic
961677352 3:128575896-128575918 TGGAGGCTCCTGAGAGCAAGGGG + Exonic
961741157 3:129033920-129033942 TGGAGCAGTGTGAGTGCAGGTGG + Intronic
962878626 3:139554915-139554937 AGGAGGAGGGAGAGAGAGAGGGG + Intergenic
962910993 3:139849345-139849367 AGGAGGAGAGGGAGAGCAAAAGG + Intergenic
962925494 3:139989324-139989346 GGGAGGAAGGTGAGTGGAAGAGG - Intronic
963942183 3:151106133-151106155 TGGAGTAGGGTCAGACCAACTGG - Intronic
964225734 3:154399163-154399185 TGGAGGAGGTTGAGAACCACTGG + Intronic
964267801 3:154920388-154920410 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
964509638 3:157436844-157436866 CGGAGGAGAGTGAGAGTGAGAGG - Exonic
964708045 3:159642002-159642024 TGGAGGAGATTTAGAGCCAGAGG + Intronic
965192718 3:165552196-165552218 TGTAGGAGGGTGAGAGGATAGGG - Intergenic
966168626 3:177051296-177051318 GGGTGGAGGGTGGGAGGAAGAGG + Intronic
966377133 3:179307771-179307793 TGGAGGAGGGGCAGAGCATTAGG + Intergenic
966417068 3:179700318-179700340 AGGGAGAGGGAGAGAGCAAGAGG + Intronic
966838120 3:184065478-184065500 TGGAGGAAGGAGAGAGGGAGAGG - Intergenic
966934078 3:184694415-184694437 TGTAGGTGGGTGTCAGCAAGGGG - Intergenic
966975628 3:185080785-185080807 TGGAGGCAGGTGTGAGCATGAGG - Exonic
967228704 3:187317720-187317742 TGGAGGAGAATGAGAGGAGGAGG - Intergenic
967514307 3:190348802-190348824 TGGAGGGAGGTAAGAGAAAGAGG - Intronic
968066369 3:195761793-195761815 TGGAGGAGGGCGGGAGGATGTGG + Intronic
968131683 3:196196039-196196061 TGGAGGAGGGTGGGGGCAGAAGG - Intergenic
968186528 3:196636631-196636653 TGGAGCAGGCTCAAAGCAAGAGG + Intergenic
968530089 4:1086891-1086913 TGGGGTGGGGTGAGAGCATGGGG + Intronic
968540753 4:1167221-1167243 AGGAGGAGGCTGAGAGCAGACGG + Exonic
968656070 4:1778988-1779010 TCGAGCAGGGTCAGGGCAAGGGG - Intergenic
968789762 4:2651488-2651510 GGCAGGAGAGAGAGAGCAAGAGG + Intronic
969183415 4:5458773-5458795 TGGAGTCGTGAGAGAGCAAGGGG + Intronic
969402133 4:6962655-6962677 TGGAGCAGGCTGAGAGCTGGGGG - Intronic
969666607 4:8560988-8561010 GGGAGGAGGGTGAGAGCAGGAGG - Intronic
969688382 4:8689639-8689661 TGGGGCAGGGAGAGAGCAGGAGG - Intergenic
970571769 4:17390389-17390411 AGGAGGAGGGAGAGAGCATCAGG - Intergenic
970579703 4:17464085-17464107 TGGAGTAGGGTGGGGGCAACTGG - Intronic
970787521 4:19816933-19816955 GGGAGGGGGGTGAGAACAGGAGG - Intergenic
971042449 4:22769025-22769047 TGTCGGAGGGTGAGGACAAGGGG - Intergenic
971344170 4:25797118-25797140 AGAAGGAGGGAGAGAGGAAGGGG + Intronic
971596435 4:28535006-28535028 AGGAGGAGCAAGAGAGCAAGGGG - Intergenic
972096350 4:35351423-35351445 AGGAGGAGGGAGAGAGAGAGAGG + Intergenic
972331720 4:38070015-38070037 TGGAGCAGGGTCAGAGCTGGAGG + Intronic
972818328 4:42670122-42670144 TGAATGAGGGTGACAGCAACTGG + Intergenic
973798741 4:54455126-54455148 TGAAGGAGCCTGAGAGCAGGGGG - Intergenic
973926969 4:55748622-55748644 GAGAGGAGGGAGAGAGGAAGAGG + Intergenic
973959148 4:56092143-56092165 TGGAGGAGGGTGACAGGTTGGGG + Intergenic
974103278 4:57440568-57440590 AGGAGGAAGGAGAGAGAAAGAGG - Intergenic
974151190 4:58011288-58011310 TGGAGGAAGGTGGAAGCAAATGG + Intergenic
974378679 4:61109473-61109495 TCCAGGAGGGTGGGAGCAGGAGG - Intergenic
974999905 4:69210603-69210625 TGGAGGAGGAAGAGAGTAGGAGG - Intronic
975000919 4:69222915-69222937 TGGAGGAGAGTCAGTGCAGGAGG + Intergenic
975005868 4:69284606-69284628 TGGAGGAGGAAGAGAGTAGGAGG + Intronic
975012942 4:69378328-69378350 TGGAGGAGAGTCAGTGCAGGAGG - Intronic
975014282 4:69393558-69393580 TGGAGGAGGAAGAGAGTAGGAGG + Intronic
976510828 4:85907994-85908016 TGGAGGAAGTTCAGAGCAGGTGG + Intronic
977386679 4:96348930-96348952 TGGAGCAGTGAGAGAGGAAGGGG + Intergenic
978073097 4:104494958-104494980 GGGGGGAGGGTGAGAGAGAGGGG - Intergenic
978483264 4:109219488-109219510 TTGAGGAGGGTGAGAACCAGAGG - Intronic
978911133 4:114065455-114065477 GGGTGGAGGGTGGGAGGAAGGGG - Intergenic
979073200 4:116238576-116238598 TGCAGGGGGGTGAGAGATAGTGG - Intergenic
979377121 4:119960301-119960323 TAGAAGAGGGTGAGTGGAAGAGG + Intergenic
980552675 4:134360190-134360212 TAGAGGATGGAGAGAGAAAGGGG + Intergenic
980666008 4:135936391-135936413 TAGAAGAGGGAGAGAGAAAGTGG + Intergenic
981303269 4:143215244-143215266 TGGGTGAGGCTGAGAGGAAGAGG - Intronic
981545141 4:145885930-145885952 AGGAGGAGGGACAGAGCTAGTGG - Exonic
982358250 4:154491831-154491853 GGGAGGAGGGAGAGAGGGAGGGG + Intergenic
982401456 4:154972389-154972411 GAGAGGAGGGAGAGAGCAGGAGG + Intergenic
982407490 4:155036432-155036454 TGGAGGTGGGTGGGAGGGAGGGG + Intergenic
982618285 4:157670612-157670634 GGGAGGAGGGTGAGAGGAGAAGG - Intergenic
983646225 4:169994232-169994254 TGGAGGAGGGTGAGAAGGTGAGG + Intronic
984476554 4:180242593-180242615 TGGATATGGGTGAGAGCCAGAGG + Intergenic
984784393 4:183554269-183554291 TGGGGGAGGGTGAGCGTGAGTGG + Intergenic
984891485 4:184498074-184498096 TGGAGGAGTGTTAAAGCTAGAGG - Intergenic
985145316 4:186889686-186889708 TGGAAGAGGCTGAGTGTAAGTGG - Intergenic
985666403 5:1183631-1183653 GGGAAGAGGGGGAGAGCAGGTGG + Intergenic
985671611 5:1209671-1209693 AGGAGGAGGATGAGAGAGAGGGG - Intronic
986035056 5:3929571-3929593 TGGAGGATGATGAGAGCATCGGG + Intergenic
986362400 5:6993118-6993140 GGGAGGAGGAGGAGGGCAAGGGG - Intergenic
987807520 5:22788383-22788405 TGGATGAGGGTAAGGGTAAGGGG + Intronic
988438537 5:31205408-31205430 TGGAGGAAGGTGAGGGCTGGTGG - Intronic
988462573 5:31453691-31453713 TGGAGCAGGTTTAGAGGAAGTGG - Intronic
988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG + Intronic
989156166 5:38346961-38346983 TGGAGGTGGGTGGGAGGGAGGGG + Intronic
989318077 5:40104931-40104953 AGGATGAGGGTGTGAGAAAGAGG - Intergenic
989474226 5:41856232-41856254 TGGAGAAGGGAGAAATCAAGAGG + Intronic
989725942 5:44586969-44586991 TGGATGAGGGGGAGAGAAGGGGG - Intergenic
990791357 5:59483660-59483682 TGGAGGAGCAGGAGAGTAAGTGG + Intronic
992441535 5:76801540-76801562 TGGGTGAGGGTGGGAGCAAGAGG + Intergenic
993885281 5:93408794-93408816 TGGAGGAAGGGCAGAGCAATTGG - Intergenic
994339462 5:98609365-98609387 TGTAGGGGGGTGGGAGCAAAGGG + Intergenic
994819302 5:104628176-104628198 TGAAGGATGGTGAAAGCAGGTGG - Intergenic
995190064 5:109310314-109310336 TGGAGGAAGGTGGGTGCAGGTGG + Intergenic
995640720 5:114253590-114253612 TGGAGCAGTGAGAGAGGAAGGGG - Intergenic
995682412 5:114734758-114734780 GGGTGGAGAGTGAGAGGAAGGGG - Intergenic
996939298 5:128984593-128984615 TGGGGGAGGGTGGGAGAGAGAGG - Intronic
997227879 5:132223023-132223045 GGGAGATGGGTGAGACCAAGAGG - Intronic
997533155 5:134595118-134595140 TGGAGGAGGTTTATAGAAAGGGG - Intergenic
997876946 5:137558065-137558087 GTGAGGAGGGTGAGAGCAGGGGG + Intronic
997999510 5:138613234-138613256 TGGTGGAGTGTGAGAGGGAGAGG - Intronic
998206689 5:140162354-140162376 TGGAGCAGAGTGAGGGGAAGAGG - Intergenic
998255448 5:140583532-140583554 TGGAGCAGTGTGAGAGGAATTGG - Intronic
998987942 5:147782772-147782794 TGGGGGAGGGGGAGAGAGAGAGG - Exonic
998990309 5:147808218-147808240 GGGAGGAGCATCAGAGCAAGAGG + Intergenic
999409721 5:151340191-151340213 TGGAGGAGGAGGAGAGGAGGAGG + Intronic
1000270360 5:159678186-159678208 AGCAGGAGGAAGAGAGCAAGTGG + Intergenic
1000334045 5:160228864-160228886 TGGAGGAGGCTGAGAACAAAGGG - Intronic
1000834375 5:166135674-166135696 GGGAGGAGGGAGGGAGGAAGAGG + Intergenic
1000989262 5:167895209-167895231 AGGAGGAGGGGGAGAGGAAGAGG - Intronic
1001044178 5:168358900-168358922 GGGAGGAGGGTTAGAGGGAGAGG - Intronic
1001253578 5:170167048-170167070 GGCAGGAGGGTGAGAGAAGGAGG - Intergenic
1001522857 5:172407352-172407374 TGGAAGAGGGAAATAGCAAGTGG - Intronic
1001679935 5:173549063-173549085 TGGTGGAGGGTGAGAAAGAGTGG - Intergenic
1001740207 5:174046896-174046918 TGGGGGCTGATGAGAGCAAGAGG - Intronic
1001842807 5:174893519-174893541 TGGTGGAGGGTGAGGGTAGGGGG + Intergenic
1001966644 5:175914362-175914384 GGGAGGAGGGAGGGAGAAAGAGG + Intergenic
1002060102 5:176620887-176620909 AGGAGGAGTTTGAGACCAAGTGG + Intronic
1002250303 5:177924842-177924864 GGGAGGAGGGAGGGAGAAAGAGG - Intergenic
1002681309 5:180967485-180967507 AGGAGGAGGGAGAGAGACAGAGG - Intergenic
1002681313 5:180967505-180967527 AGGAGGAGGGAGAGAGATAGAGG - Intergenic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1003040042 6:2679245-2679267 TGGAGAAGGGTCAGAGACAGAGG + Intronic
1003377450 6:5593018-5593040 GGGAGGAGGGTGAGGGCCAGAGG - Intronic
1004756419 6:18615380-18615402 GGGAGGAGGGCCAGAGGAAGAGG + Intergenic
1004816604 6:19317925-19317947 AAGAGAAGAGTGAGAGCAAGAGG - Intergenic
1004923091 6:20395202-20395224 CGGAGGTAGGTGAGAGCAGGGGG + Intergenic
1004945596 6:20609313-20609335 GGGAGGAGGGAGAGAGGAGGGGG - Intronic
1005048868 6:21665928-21665950 TGGAGGAGGGTGAATCCGAGAGG + Intergenic
1005260654 6:24055893-24055915 TTGCTGAGGGTGAGAGCAGGAGG - Intergenic
1005338594 6:24821776-24821798 TGGAGGGGGTTGATGGCAAGTGG - Intronic
1005988900 6:30891356-30891378 TGGGGCAGGGTGAGAGGATGGGG - Intronic
1006149538 6:31979237-31979259 AGGAGGAGGGGGGGAGGAAGAGG + Intronic
1006321385 6:33321608-33321630 GGGAGGGGGTTGAGAGAAAGGGG + Intronic
1006340721 6:33445122-33445144 TGGTGGAGGCTGAGGGCAAAGGG + Intronic
1006411869 6:33878488-33878510 TGGGGTGGGGTGAGGGCAAGAGG + Intergenic
1006470775 6:34227442-34227464 TGGGGGAGGGGTAGAGGAAGTGG - Intergenic
1006513494 6:34533826-34533848 TGGGGGTGGGTGGGAGCAAAGGG + Exonic
1006599384 6:35215413-35215435 TGGGGGAGGGGTACAGCAAGAGG - Intronic
1007107684 6:39294887-39294909 AGGAGAAGGTTGAGACCAAGAGG + Intergenic
1008067043 6:47061155-47061177 TGGAGCAGGGAGAGGGCAAACGG + Intergenic
1008073207 6:47118373-47118395 AGGAAGAGGGAGAGAGGAAGTGG - Intergenic
1008944545 6:57083266-57083288 GGGAAGGGGGTGGGAGCAAGTGG + Intergenic
1010210515 6:73359628-73359650 TGGAAGAGGGTGAAAGATAGTGG + Intergenic
1010773473 6:79859110-79859132 GGGAGGAGGTTGAGATCAAGAGG - Intergenic
1010955775 6:82089306-82089328 TGGAGCAGGGTGAGCGCAAAGGG - Intergenic
1011009890 6:82692025-82692047 GAGAGGAGGCTGAGAACAAGGGG - Intergenic
1011908851 6:92409684-92409706 TGGAAAAGGGCTAGAGCAAGAGG - Intergenic
1012163768 6:95922841-95922863 AAGAGGAGGATGAGAGCGAGGGG - Intergenic
1012499165 6:99869608-99869630 AGCAGGAGCATGAGAGCAAGGGG - Intergenic
1012576141 6:100802341-100802363 AGCAGGAGCATGAGAGCAAGGGG - Intronic
1012896419 6:104954532-104954554 TGGGGGAGGGTAAAAGAAAGGGG - Intergenic
1013082374 6:106823849-106823871 TGAAGGTAGGTAAGAGCAAGAGG + Intergenic
1013276682 6:108592127-108592149 TGGAGGAGGTTGACTGCAAAAGG + Intronic
1013398485 6:109768151-109768173 TGGAGGAGGGTGCCAGCATGGGG + Intronic
1013609083 6:111777555-111777577 GGGAGGAGGGTGTGTGCTAGTGG - Intronic
1014242402 6:119032482-119032504 TGGGGGAGGGGGAGAGGGAGAGG + Intronic
1014559471 6:122872886-122872908 AGGATGAGAGAGAGAGCAAGAGG - Intergenic
1015560377 6:134508934-134508956 AGCAGGAGCGAGAGAGCAAGGGG - Intergenic
1015703437 6:136061499-136061521 TGGGGGTGGGAGAGAGGAAGAGG - Intronic
1016410772 6:143781158-143781180 AGGACGAGGGTGAGAGGTAGAGG - Intronic
1016812510 6:148274914-148274936 TAGAGGAGGGGCAGGGCAAGAGG - Intronic
1017978695 6:159379722-159379744 TGCAGGATGGGGAGAGCAATGGG + Intergenic
1018044302 6:159952355-159952377 AGGAGGAGGATGGGAGGAAGAGG - Intergenic
1018378609 6:163236906-163236928 AGCAGGAGGGAGAGAGCAAAGGG + Intronic
1018518968 6:164622591-164622613 TGAATGATGGTTAGAGCAAGCGG + Intergenic
1018705646 6:166461582-166461604 TGGGGGAGGGGGAGGGGAAGGGG + Intronic
1018734224 6:166675337-166675359 TGGGGGAGAGGGAGAGAAAGTGG - Intronic
1018760758 6:166892382-166892404 TGGAGGAGAGAGAGAGACAGAGG + Intronic
1018887418 6:167951655-167951677 AGGAGGAGCGGGAGAGGAAGCGG + Exonic
1018994924 6:168703288-168703310 GGGAGGAGAGTGAGAGGATGCGG - Intergenic
1019227950 6:170530633-170530655 TGGAGGAGCCTGAAGGCAAGTGG - Intergenic
1019316705 7:390320-390342 GGCAGGAGGGTGGGAGGAAGGGG + Intergenic
1019781202 7:2940825-2940847 AGGAGGAGGAGGAGAGGAAGAGG + Intronic
1021000602 7:15325930-15325952 AGGAGGAGAGGGAGAGCAAGAGG + Intronic
1021622924 7:22565674-22565696 GAGAGCAGGGTGTGAGCAAGTGG - Intronic
1021798485 7:24281796-24281818 TGGAGGAGGGGGTGAGGAAGAGG + Intergenic
1021839189 7:24708449-24708471 GGGAGGAGAGAGAGAGAAAGAGG + Intronic
1021924893 7:25524883-25524905 TAGAGGAGAGGCAGAGCAAGGGG + Intergenic
1021955020 7:25815717-25815739 TGGTGAAGAGAGAGAGCAAGAGG + Intergenic
1022143588 7:27514738-27514760 TGGGGAAAGGTGACAGCAAGAGG + Intergenic
1022254585 7:28643466-28643488 TGGGGGAGGGTGACAGCCAAAGG - Intronic
1022719690 7:32931663-32931685 TGGAGGAGGGAGGGATTAAGGGG + Intergenic
1022723987 7:32964581-32964603 GGGAGGAGAGAGGGAGCAAGCGG - Intronic
1023580136 7:41672890-41672912 TTGGGGAGGGAGAGAGAAAGAGG + Intergenic
1023845985 7:44120709-44120731 AGCAGGAGAGAGAGAGCAAGGGG - Intronic
1023850330 7:44146432-44146454 AGGAGGAGGGTGGGTGCAAAGGG - Intronic
1023878680 7:44306720-44306742 AGGAGGAGGGTGTGGGCAGGAGG + Intronic
1023878689 7:44306740-44306762 AGGAGGAGGGTGTGGGCAGGGGG + Intronic
1023878746 7:44306955-44306977 GGGAGGAGGATGTGAGAAAGGGG + Intronic
1023878751 7:44306975-44306997 GGGAGGAGGGTGTGAGCAGGAGG + Intronic
1023878773 7:44307055-44307077 GGGAGGAGGGTCTGAGCAGGGGG + Intronic
1023878790 7:44307112-44307134 AGGAGGAGGGTGTGAGCAGGGGG + Intronic
1023878795 7:44307132-44307154 GGGAGGAGGGTGTGAGCAGAGGG + Intronic
1023878800 7:44307152-44307174 GGGAGGAGGGTGTGAGCAGAGGG + Intronic
1023878813 7:44307209-44307231 AGGAGGAGGGTATGAGCAAGGGG + Intronic
1023878818 7:44307229-44307251 GGGAGGAGGGTGTGAGCAGAGGG + Intronic
1023878823 7:44307249-44307271 GGGAAGAGGGTGTGAGCAAGGGG + Intronic
1023878828 7:44307269-44307291 GGGAGGAGGGTGTGAGCAGAGGG + Intronic
1023878832 7:44307289-44307311 GGGAAGAGGGTGTGAGCAGGCGG + Intronic
1023878839 7:44307309-44307331 CGGAGGAGGGTGTGAGAAGGGGG + Intronic
1023878866 7:44307409-44307431 AGGAGGAGGGTGTGATCAGGGGG + Intronic
1023897356 7:44445073-44445095 TGGAGGAGAGGGAGAACAGGTGG - Intronic
1023978940 7:45054719-45054741 TGAAGCAGTGAGAGAGCAAGGGG - Intronic
1024062513 7:45709583-45709605 AGGAGGAGCCTGAGAGCAGGCGG - Intronic
1024121134 7:46241977-46241999 GTGGGGAGGGTGAGAGGAAGGGG - Intergenic
1024326254 7:48111464-48111486 TGGAGGAGGGGTTGAGGAAGGGG - Intergenic
1024471365 7:49771024-49771046 CGGAGGAGGGAGGGAGAAAGGGG + Intergenic
1024741497 7:52359976-52359998 AGCAGGAGAGAGAGAGCAAGAGG + Intergenic
1024947215 7:54820866-54820888 GGGTGGAGGGTGAGAGGATGGGG - Intergenic
1026028886 7:66771736-66771758 TGAAGGAGGGAGGGAGAAAGAGG - Intronic
1026287810 7:68978708-68978730 TAGAGGAGGGAGAGAGGAAGAGG - Intergenic
1026649512 7:72203181-72203203 TGTCGGGGGGTGAGGGCAAGGGG + Intronic
1026833044 7:73621854-73621876 TGGAGGAGGGAGGGAGAAGGAGG - Intronic
1027289142 7:76683861-76683883 TGGAGGATGGGGGTAGCAAGAGG - Intergenic
1027462002 7:78466048-78466070 AGGAGGATGTTAAGAGCAAGTGG - Intronic
1027902953 7:84141652-84141674 GGGTGGAGGGTGGGAGGAAGGGG - Intronic
1028010739 7:85640505-85640527 TGGGGGAGTGTGAGTGCATGGGG - Intergenic
1028263707 7:88696271-88696293 GAGAGGATGGTGAGAGCATGTGG - Intergenic
1028465880 7:91151157-91151179 ATGAGAAGGGTAAGAGCAAGAGG - Intronic
1028881961 7:95890429-95890451 CGGTGGAGGGTGAGAGGAGGAGG + Intronic
1029282355 7:99444132-99444154 TGGAGGAAGGTGTGAGCTAGGGG + Intronic
1029405904 7:100373860-100373882 GGGAGGAGGGGGAGAGGATGGGG - Intronic
1029795850 7:102893813-102893835 TGGGGGAGGGGGAGAAGAAGGGG + Intronic
1029914771 7:104198048-104198070 AGGATGAGAGTGAGAGCAAGAGG - Intronic
1029964789 7:104728182-104728204 TGGAGGAGACAGAGACCAAGAGG - Intronic
1029996660 7:105013731-105013753 GGGAGGAGGGGGAGAGGAACGGG + Intergenic
1031129057 7:117810114-117810136 TGGGGGAGGGGGAGAGGAGGAGG + Intronic
1031242388 7:119263133-119263155 TAGAGGGGGGTGGGAGGAAGAGG - Intergenic
1031386433 7:121157440-121157462 TAGAGGAGGGTGTGAGCAACGGG + Intronic
1032033095 7:128501089-128501111 TGGAAGAGGGTGTGAGCAGCGGG - Intronic
1032099048 7:128957882-128957904 AGGAGGAGGGAGAGAGGAAAGGG + Intronic
1032238137 7:130141714-130141736 TGGAGGAGAGGGAGAGCAGTGGG - Intergenic
1032366619 7:131306081-131306103 GGCAGGAGGGAGAGAGCAAGGGG - Intronic
1032455208 7:132067962-132067984 TTGAGGAGGGAGAGAGGACGAGG - Intergenic
1032626328 7:133595199-133595221 TGCAGGAGAATCAGAGCAAGTGG + Intronic
1033264517 7:139873259-139873281 TGCAGTTGGGTGAGAGAAAGGGG + Intronic
1033437527 7:141347017-141347039 GGCAGGAGAGAGAGAGCAAGGGG - Intronic
1034338878 7:150340072-150340094 TGAAGGGGTGTGAGAGCAATGGG - Intronic
1035244075 7:157551027-157551049 AGGAGGAGGAGGAGAGGAAGCGG - Intronic
1035864211 8:3064369-3064391 AGCAGGAGGGAGAGAGCTAGGGG - Intronic
1036155241 8:6336029-6336051 TGGGGGAGGCTGTGAGCATGTGG - Intergenic
1036705925 8:11046965-11046987 AGGAGGACGGTGAGTGCCAGGGG + Intronic
1037033927 8:14142833-14142855 GGCAGGAGGAAGAGAGCAAGGGG - Intronic
1037459772 8:19097224-19097246 TGGAGCAGTGGGAGGGCAAGAGG - Intergenic
1037497080 8:19450312-19450334 AGGAGGAGGAGGAGAGGAAGAGG + Intronic
1037858320 8:22387500-22387522 TGGAGGAGTGAAAGGGCAAGTGG + Intronic
1038328443 8:26589665-26589687 TGGGGGAGGGTGGCAGAAAGAGG + Intronic
1038804319 8:30776543-30776565 TGGAGGAGGCTGAGACCAGGAGG + Intronic
1038927236 8:32154276-32154298 AGGAAGAGGGGGAGAGCAAAAGG - Intronic
1039473814 8:37829036-37829058 TGTGGGGGGGTGAGAGGAAGGGG - Intronic
1039518667 8:38153253-38153275 TGGAGGAGGTTTTGAGGAAGGGG - Intergenic
1039968467 8:42300717-42300739 CTGAGGAGGGTGAGAGAAGGAGG + Intronic
1040402692 8:47068215-47068237 TGGAGTAGTGAGAGAGGAAGGGG + Intergenic
1040573046 8:48626550-48626572 TGGATGAGGAGGAGAGCCAGTGG + Intergenic
1042968364 8:74380055-74380077 TTGAGTGGGGTCAGAGCAAGAGG + Intronic
1043871488 8:85438519-85438541 TGGAGGAAGGAGAGAGGACGAGG + Intronic
1044257557 8:90082965-90082987 AGAAGGCTGGTGAGAGCAAGAGG - Intronic
1044285513 8:90408272-90408294 TGGAGGAGGCTGGGAGGAATAGG - Intergenic
1044681163 8:94778910-94778932 TGGAGGAAGGTGAGGCCATGGGG + Intronic
1045128687 8:99123645-99123667 TGGACTAGGGTGATAGCAAGTGG + Intronic
1045743456 8:105388342-105388364 TGGGGGAGGGAGAGAGAAAGAGG + Intronic
1046009438 8:108528489-108528511 TGGAGGAGAGTGACAAGAAGAGG + Intergenic
1046399882 8:113691787-113691809 AGGAGGAGGGGGAGAGGGAGGGG - Intergenic
1046673211 8:117080479-117080501 TAGAGGAGGGAGAGAGGGAGGGG - Intronic
1047218072 8:122895165-122895187 TAAAGAAGGGAGAGAGCAAGAGG - Intronic
1047248088 8:123161330-123161352 GGGAGGAGGGTGGGAGAAGGAGG - Intergenic
1047533742 8:125700274-125700296 TGGAGGAAGGTGGGAAGAAGGGG + Intergenic
1047546378 8:125821684-125821706 TGGTGGAGAGAGAGAGCAAGGGG + Intergenic
1047889913 8:129296371-129296393 GGCAGGAGAGAGAGAGCAAGGGG + Intergenic
1048039137 8:130708070-130708092 TGGTGGAGTGGGAGAGAAAGAGG + Intergenic
1048069174 8:131003879-131003901 TGGAGGAGGAGAAGAGGAAGAGG + Intronic
1049122012 8:140747623-140747645 AGGAGGAAGGGGAGAGGAAGGGG + Intronic
1049226302 8:141452110-141452132 TGGAGGAGGCTGAGCGGGAGTGG + Intergenic
1049245597 8:141560566-141560588 GGGAGGAGGGAGGGAGCCAGGGG + Intergenic
1049266665 8:141671326-141671348 AGCAGGAGGGTGAGAGGATGGGG - Intergenic
1049318340 8:141981570-141981592 GGAAGGAGGGTGACAGGAAGTGG + Intergenic
1049576364 8:143391737-143391759 TGGAGGAGGGTGAGGCAAGGGGG - Intergenic
1049708785 8:144054547-144054569 AGGAGGAGGGTGAGTGGGAGTGG - Exonic
1050122412 9:2321097-2321119 GGGAGGAGGGAGAGAGGAACTGG + Intergenic
1050377171 9:4985246-4985268 TGCAGGAAGGAGAGAGGAAGAGG + Exonic
1050517612 9:6461359-6461381 AGGAGGAGGGGGAGAGGAGGAGG - Intronic
1051133840 9:13895090-13895112 GGGTGGAGGGTGGGAGGAAGAGG + Intergenic
1051274300 9:15384226-15384248 TGGAGGTGGGTGGGAGCAGTGGG - Intergenic
1051796124 9:20872524-20872546 AGGAGGAGGGGGAGGGGAAGAGG - Intronic
1052382596 9:27788117-27788139 AGGAGGAGGAAGAGAGCAAAGGG - Intergenic
1052707502 9:32010908-32010930 TGGAGGAGGCTGAGAGACAGGGG - Intergenic
1052966856 9:34346901-34346923 TGGATGAGGGTGGGAGAGAGAGG + Intergenic
1052988880 9:34506932-34506954 TGGAGGAGGGAGGGAGCTTGGGG + Intronic
1053145035 9:35706398-35706420 GGGAGTAGGGTGAGAGAGAGGGG - Intronic
1053170176 9:35872953-35872975 TGGAGGAGGTTGAGGGGAAAAGG - Intergenic
1053428324 9:38025620-38025642 ATGAGGAGGGTGAGAGCAGAGGG - Intronic
1054865056 9:69991443-69991465 AGGAGGAAGGAGAGAGCCAGAGG + Intergenic
1055434078 9:76274904-76274926 TGGAAGGGGGAGAAAGCAAGGGG + Intronic
1055496370 9:76859450-76859472 TGGAGGAAGGAAAGAGCAAATGG - Intronic
1056663446 9:88561609-88561631 TGGAGGAGGGGGAAAGGTAGGGG + Intronic
1056687051 9:88775521-88775543 TGGAGGAGGGTGAATGCAAGGGG + Intergenic
1056978296 9:91282089-91282111 AGGAGGAGGAGGAGAGCAATAGG - Intronic
1057259282 9:93575417-93575439 GGGAGGATGGGGAGAGAAAGAGG + Intergenic
1057598729 9:96438732-96438754 TGGGGGAGGGTGGGATGAAGAGG + Intergenic
1057807365 9:98229134-98229156 TTGAGCAGGGAGAGAGCCAGAGG - Exonic
1057824927 9:98365043-98365065 AGGGGGAGGGAGAGAGCAGGAGG + Intronic
1058124383 9:101174593-101174615 TGGAGCATGGTGATAGCAGGAGG - Intronic
1060827987 9:126697209-126697231 GGGAGGAAGGGGAGAGGAAGAGG + Exonic
1061229625 9:129307324-129307346 GGGAGGAGGGTCAGAGCTAGAGG + Intergenic
1061290260 9:129646682-129646704 TGGAGGTGGGTGGCAGGAAGGGG - Intergenic
1061418399 9:130460560-130460582 TGGAAGAGTGTGAGAGGCAGAGG + Intronic
1061869908 9:133515109-133515131 TGGAGGAGGGAGGGAGGAACAGG - Intronic
1061869923 9:133515161-133515183 TGGAGGAGGGAGGGAGGGAGGGG - Intronic
1061893190 9:133633459-133633481 CTGAGGAGGGTGAGGGCAGGAGG + Intergenic
1062191768 9:135251507-135251529 GGGAGGTGGGTGACAGCAGGGGG + Intergenic
1062253334 9:135609081-135609103 GGGAGGAGGGGGAGCGGAAGTGG - Intergenic
1062453313 9:136624556-136624578 TGGGTGAGGCTGAGAGCCAGGGG - Intergenic
1062472797 9:136713600-136713622 TGGGGCAGGGTGAGAGCTAAGGG + Intronic
1062550402 9:137083449-137083471 TGGAAGAGGCTGAGAGGCAGAGG - Exonic
1062603821 9:137333644-137333666 GGCAGGAGCGAGAGAGCAAGAGG - Intronic
1062621857 9:137426429-137426451 TGGAGGAGGGGGTGGGCAAGAGG - Intronic
1062637775 9:137500588-137500610 GGGAAGAGGGTGAGAGCACCAGG + Intronic
1185670079 X:1801968-1801990 GGTAGTAGGGAGAGAGCAAGGGG - Intergenic
1185851093 X:3489384-3489406 GGGAGGAGGAAGAGAGGAAGAGG + Intergenic
1185955090 X:4480347-4480369 TGAAGGAGGGAGAGAGGAAATGG + Intergenic
1186386227 X:9112866-9112888 TGGAGGGGGGAGAGTGAAAGGGG - Intronic
1187386437 X:18852846-18852868 TGGGGCAGGGTGAGAGCAGTAGG - Intergenic
1187464235 X:19514552-19514574 GGGAGGGGGATGAGAGGAAGGGG + Intronic
1187507537 X:19888769-19888791 TGGAGGAGGCTGAGGGCTAGTGG + Intergenic
1187685003 X:21807324-21807346 AGTGGGAGGGTGAGAGGAAGGGG - Intergenic
1187782987 X:22850122-22850144 ATGAGGAGGCTGAGAGGAAGTGG - Intergenic
1187854412 X:23623202-23623224 GGGAGGAGGGTGAAAGGAGGAGG - Intergenic
1188146677 X:26622279-26622301 AGGAGGGGGTTGAGATCAAGAGG + Intergenic
1188779445 X:34263131-34263153 TGGAGTAGGGGGACAGAAAGAGG - Intergenic
1189271537 X:39755496-39755518 TGGAGTAGGGTGGGAGAAGGAGG - Intergenic
1189288106 X:39866437-39866459 AGGTGGAGGGAGAGAGGAAGGGG + Intergenic
1189289090 X:39872727-39872749 AAGAGGAGGGAGAGAGGAAGGGG - Intergenic
1189348176 X:40258303-40258325 TAGAGCAGGGAGAGAGCAACTGG + Intergenic
1189909835 X:45799402-45799424 GGGAGGAGGGAGAGAGGGAGAGG + Intergenic
1191611571 X:63120875-63120897 GGGAGAAGGGTGGGAGCAGGTGG + Intergenic
1191724913 X:64269158-64269180 TGGGGGAGGGGGTGAGCAAAAGG - Intronic
1192442208 X:71182832-71182854 AGGAGGAGGGGGAAAGGAAGGGG + Intergenic
1192655524 X:72989313-72989335 TGAATGAGGGAGAGAACAAGAGG + Intergenic
1193057855 X:77173764-77173786 AGCAGGAGAGAGAGAGCAAGGGG + Intergenic
1193186709 X:78521979-78522001 TGCAGGAGGCAGAGAGCAAGAGG + Intergenic
1193329781 X:80223224-80223246 TGGTGGAAGGAGAGAGCAAGGGG - Intergenic
1195085379 X:101408426-101408448 GGGAGGAGGGAGAGAGCGCGAGG - Intronic
1195129355 X:101838887-101838909 GGGAGGAGTGTGAGAGGGAGTGG - Intronic
1195176882 X:102320942-102320964 GGGAGGAGTGTGAGAGGGAGTGG + Intronic
1195181982 X:102366151-102366173 GGGAGGAGTGTGAGAGGGAGTGG - Intronic
1196141903 X:112272418-112272440 TGGAGGAGGGGGAAAGCAACAGG + Intergenic
1196406392 X:115366843-115366865 TGGAGCTGGGTGAGATAAAGTGG + Intergenic
1196606735 X:117665679-117665701 GGGTAGAGGGTGAGAGTAAGGGG - Intergenic
1196657339 X:118232219-118232241 AGGAGGAGGGGGAGAGGAAGGGG + Intergenic
1196828402 X:119758487-119758509 AGGAGGAGGGAGGGAGCTAGGGG - Intergenic
1197145792 X:123170882-123170904 TGGGGGAGGGGGAGGGCAGGGGG - Intergenic
1197640135 X:128958826-128958848 TAGAGCAGGAAGAGAGCAAGAGG + Intergenic
1198127605 X:133661654-133661676 AGGAGGAGGGGGAGAGAGAGAGG - Intronic
1198316435 X:135471413-135471435 TGGAAGAGAGGGAGAACAAGTGG - Intergenic
1199267689 X:145847535-145847557 TGGAAGAGGGTGGGAGATAGAGG - Intergenic
1199341470 X:146682628-146682650 TGGAGGATGGTGGGGGGAAGTGG - Intergenic
1199489061 X:148378969-148378991 TGGAGGAGGCTCAGAGTGAGAGG + Intergenic
1199500510 X:148501260-148501282 CAGAGGTGGCTGAGAGCAAGTGG - Intronic
1199599768 X:149535021-149535043 GGGAGGAGGAGGAGAGTAAGAGG - Intergenic
1199650802 X:149944867-149944889 AGGAGGAGGAGGAGAGGAAGGGG + Intergenic
1199650871 X:149945226-149945248 GGGAGGAGGAGGAGAGTAAGAGG + Intergenic
1199698550 X:150360883-150360905 CTGAGGAAGATGAGAGCAAGTGG + Intergenic
1199783514 X:151083838-151083860 TGGGGGAGGGGGAGATCATGAGG - Intergenic
1199886916 X:152029438-152029460 TGCAGGAGGGTGAGAAGACGGGG - Intergenic
1199983335 X:152933179-152933201 TGGAGGAGCTTGAGGGCCAGTGG - Intronic
1200078203 X:153562302-153562324 TGAAGCAGGGTTAGGGCAAGTGG - Intronic
1200775213 Y:7164494-7164516 AGGAGGAGGATGATAGGAAGAGG - Intergenic
1201150402 Y:11092551-11092573 AGGAGGAGGGAGAGAGAAGGGGG - Intergenic
1201330112 Y:12809465-12809487 TGGAGGAGAGAGAGAGAGAGGGG + Intronic
1201490278 Y:14533744-14533766 TGGTGCAGGGTGGGAGAAAGGGG - Intronic
1201757531 Y:17502475-17502497 TGGCAGAGGATGAGAGAAAGAGG - Intergenic
1201844023 Y:18403507-18403529 TGGCAGAGGATGAGAGAAAGAGG + Intergenic
1201928431 Y:19315270-19315292 AGGAGGAGGAGGAGAGGAAGAGG - Intergenic