ID: 1142718199

View in Genome Browser
Species Human (GRCh38)
Location 17:1759065-1759087
Sequence CTTTTAAAGAAGTCGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142718190_1142718199 24 Left 1142718190 17:1759018-1759040 CCGAGAAATGGGCAGTGGCTTTA No data
Right 1142718199 17:1759065-1759087 CTTTTAAAGAAGTCGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142718199 Original CRISPR CTTTTAAAGAAGTCGGGGGC CGG Intergenic
No off target data available for this crispr