ID: 1142721403

View in Genome Browser
Species Human (GRCh38)
Location 17:1778415-1778437
Sequence CTCAAACATTTGTAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142721403_1142721408 28 Left 1142721403 17:1778415-1778437 CCTTCATTCTACAAATGTTTGAG No data
Right 1142721408 17:1778466-1778488 GCTATTGCCAGGTATCTCTGGGG No data
1142721403_1142721405 17 Left 1142721403 17:1778415-1778437 CCTTCATTCTACAAATGTTTGAG No data
Right 1142721405 17:1778455-1778477 ATTCTCAAAAAGCTATTGCCAGG No data
1142721403_1142721406 26 Left 1142721403 17:1778415-1778437 CCTTCATTCTACAAATGTTTGAG No data
Right 1142721406 17:1778464-1778486 AAGCTATTGCCAGGTATCTCTGG No data
1142721403_1142721407 27 Left 1142721403 17:1778415-1778437 CCTTCATTCTACAAATGTTTGAG No data
Right 1142721407 17:1778465-1778487 AGCTATTGCCAGGTATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142721403 Original CRISPR CTCAAACATTTGTAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr