ID: 1142721428

View in Genome Browser
Species Human (GRCh38)
Location 17:1778616-1778638
Sequence CCTGGTTGCTGTGTTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142721428_1142721437 18 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721437 17:1778657-1778679 CCGTAACCTTCTGACTGGAACGG No data
1142721428_1142721439 20 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721439 17:1778659-1778681 GTAACCTTCTGACTGGAACGGGG No data
1142721428_1142721434 13 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721434 17:1778652-1778674 GAATCCCGTAACCTTCTGACTGG No data
1142721428_1142721438 19 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721438 17:1778658-1778680 CGTAACCTTCTGACTGGAACGGG No data
1142721428_1142721442 26 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721442 17:1778665-1778687 TTCTGACTGGAACGGGGTCTGGG No data
1142721428_1142721441 25 Left 1142721428 17:1778616-1778638 CCAGTGGTAACACAGCAACCAGG No data
Right 1142721441 17:1778664-1778686 CTTCTGACTGGAACGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142721428 Original CRISPR CCTGGTTGCTGTGTTACCAC TGG (reversed) Intergenic