ID: 1142726525

View in Genome Browser
Species Human (GRCh38)
Location 17:1818992-1819014
Sequence CAGAATGTGAAACGTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142726525_1142726527 2 Left 1142726525 17:1818992-1819014 CCAGAAAAACGTTTCACATTCTG 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1142726527 17:1819017-1819039 TTCGCTTCATTGTTTCCTCATGG 0: 1
1: 0
2: 1
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142726525 Original CRISPR CAGAATGTGAAACGTTTTTC TGG (reversed) Intronic
903429442 1:23281850-23281872 AAGAATTTGAAACGTTTTGTGGG + Intergenic
903655144 1:24944343-24944365 CAGAATGGGAAGGGTTTTCCAGG - Intronic
905697739 1:39987900-39987922 CAGAATGTGGAACATTCTACAGG - Intergenic
907928606 1:58978350-58978372 CAGAAAGAGAAACATCTTTCTGG - Intergenic
909598586 1:77435935-77435957 CAGATCGTGAAAGGTTTTTGAGG - Intronic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
913575921 1:120174855-120174877 GCTAATGTGAAATGTTTTTCAGG - Intronic
914558234 1:148790426-148790448 GCTAATGTGAAATGTTTTTCAGG - Intergenic
914614600 1:149339804-149339826 GCTAATGTGAAATGTTTTTCAGG + Intergenic
914994611 1:152531874-152531896 CAAAATGTGAGAAATTTTTCAGG - Intronic
918546166 1:185686709-185686731 CAGAATGTGAAAGGAGTTGCAGG + Intergenic
919504951 1:198386989-198387011 CAGAATGTGAAGCGATTTCAGGG + Intergenic
924315165 1:242787781-242787803 CAGAATGTGATAAGTGTTTATGG - Intergenic
1063476833 10:6336230-6336252 CAGCATGTGGAGCGCTTTTCTGG - Intergenic
1071742151 10:88371478-88371500 AAGAATGTCAAAAGTATTTCGGG + Intronic
1072813013 10:98478166-98478188 CAGAATGGGAACCATTGTTCTGG + Intronic
1073895984 10:108158463-108158485 CAGACTGTGAAAAGATATTCTGG - Intergenic
1076030887 10:127156979-127157001 CTAAGTGTGAAACATTTTTCTGG + Intronic
1076178048 10:128383786-128383808 CAGAATGAGACACATTTTGCAGG - Intergenic
1076522030 10:131087314-131087336 AAGAATGTGAAGCGTGTTGCAGG - Intergenic
1076617960 10:131769323-131769345 GAAAATGTGAAACCTTTTGCCGG + Intergenic
1077744560 11:4887529-4887551 CAGAACATGAACTGTTTTTCAGG + Intronic
1079313206 11:19384941-19384963 CTGGATGTGAAACCTTTGTCAGG - Intronic
1080216150 11:29843637-29843659 CAGAATGTGAAAAGGCTTTGAGG - Intergenic
1080404824 11:31969743-31969765 CAGAATGCTATACATTTTTCTGG + Intronic
1081187892 11:40067175-40067197 CAGAATGAGAAAGCCTTTTCAGG - Intergenic
1082169652 11:48987932-48987954 AAGAATGTGAAACTTGTTCCAGG + Intergenic
1082238240 11:49846026-49846048 AAGAATGTGAAACTTGTTCCAGG + Intergenic
1082595058 11:55067993-55068015 CACAAAGTTAAACATTTTTCTGG - Intergenic
1082597498 11:55102132-55102154 CAGATTGTTAAACGTTTCTTTGG + Intergenic
1082597596 11:55103847-55103869 CAGATTGTTAAACGTTTCTTTGG + Intergenic
1086181204 11:83953794-83953816 CACAATGTGAAGCTTATTTCTGG - Intronic
1088369775 11:109076461-109076483 TAGAATGAGAACTGTTTTTCAGG + Intergenic
1088421367 11:109651395-109651417 CAGAATCTGAAACATTTTCTTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1091463388 12:663021-663043 CAGAATGTGAAATCATTTTCTGG + Intronic
1092983955 12:13826857-13826879 CAGAATTATTAACGTTTTTCAGG - Intronic
1093675702 12:21937629-21937651 CAGAATGTCAAAGCTTTTCCTGG - Intronic
1094122987 12:26993665-26993687 CAGCAGGTGAAAGGTTTTTGGGG - Intronic
1094206068 12:27842152-27842174 AAGAATTTGAAACATTTTTAAGG - Intergenic
1100141213 12:91621097-91621119 CAGACTGTGAAACGCTTTTACGG + Intergenic
1101798358 12:107999235-107999257 CATATTGTGAATTGTTTTTCTGG + Intergenic
1102996448 12:117355105-117355127 CAGAAGCTGAAATGCTTTTCAGG + Intronic
1105276741 13:18936537-18936559 GAGAATGTAAAACATTTTTTTGG + Intergenic
1105707529 13:22977360-22977382 CAGAATGGGAAAGGTCTTCCTGG + Intergenic
1108172587 13:47757740-47757762 CAGAATGTTAAAAGTTTGTCAGG - Intergenic
1108493578 13:51003963-51003985 CAGAAAGTAATACGTTTTTCTGG + Intergenic
1108537243 13:51396744-51396766 CAGAATGTGGAACATTATACAGG + Intronic
1109244135 13:59932009-59932031 CAGAATTTAAAACTTGTTTCTGG + Intronic
1109988955 13:70028494-70028516 CAAAATGTGACACATTTTTCAGG + Intronic
1110083767 13:71350631-71350653 CAGAATGTGAAACTTTTACAGGG - Intergenic
1110110701 13:71742082-71742104 CAGAATCTGATAGGTTTATCAGG + Intronic
1110366357 13:74690614-74690636 CAAAAAGTGAAACTTATTTCTGG + Intergenic
1112190633 13:97173942-97173964 CAGAATGTGATAAATTTTTACGG - Intergenic
1113986373 13:114319616-114319638 CAGAATGTGAAACATTTATATGG + Intronic
1114331260 14:21639201-21639223 CAGAAGGTGAAACTTCTTTTTGG - Intergenic
1116074370 14:40091156-40091178 ATGAATATGAAACATTTTTCAGG - Intergenic
1117788109 14:59308814-59308836 CAGAATGTCAGTCATTTTTCTGG - Intronic
1117926983 14:60791801-60791823 GAAAATGTGAAACCTTTTTAAGG + Intronic
1119759939 14:77143128-77143150 TAGAATGTGAAAAGGTTTCCTGG - Intronic
1120549788 14:85856154-85856176 TAGCATGTGAAACAATTTTCAGG + Intergenic
1121169351 14:91840333-91840355 CAGCATGAGAAACATTTTTTTGG - Intronic
1121599579 14:95193214-95193236 AAGAATTTGAGACGTTTTTCTGG + Intronic
1122197385 14:100098885-100098907 TAGAATGTAAAATGTTTCTCAGG + Intronic
1124611245 15:31210530-31210552 CAGAATGTGAGACATTCTTCAGG + Intergenic
1125904910 15:43382522-43382544 CAGATTGTGAAACATTATACAGG - Intronic
1127670289 15:61188220-61188242 CAGAAAGTGAATCGTCTTTGCGG + Intronic
1128926672 15:71662492-71662514 TAGAATGGGAAATGTTCTTCTGG + Intronic
1129963234 15:79709172-79709194 CAGTATGTGAAACTTTCTCCAGG - Intergenic
1133526157 16:6607784-6607806 TAGGATGTGAAACATTATTCGGG - Intronic
1138748167 16:59388055-59388077 CATAATATAAAACATTTTTCAGG + Intergenic
1140272595 16:73480181-73480203 CAGCATTTGAAATGTTTTTAAGG + Intergenic
1141965574 16:87440507-87440529 CAGAATTTGTAACATGTTTCAGG + Intronic
1142568561 17:856887-856909 CAGAATGTGAAAGGCAGTTCCGG - Intronic
1142726525 17:1818992-1819014 CAGAATGTGAAACGTTTTTCTGG - Intronic
1143368144 17:6421743-6421765 GAGAATGTGAAACTTCTATCAGG - Intronic
1143785220 17:9250688-9250710 CAGAATGTGTGATGCTTTTCTGG - Intronic
1146258812 17:31408262-31408284 AAGAATGTAACACATTTTTCAGG + Intronic
1156803390 18:41146105-41146127 CAGAATGTGACTCATCTTTCTGG + Intergenic
1157634095 18:49131872-49131894 CAGAATGTGAAAGATTCTACAGG + Intronic
1158138162 18:54228329-54228351 CAATATTTGAAACGTTTTTCTGG - Intergenic
1159185205 18:64962134-64962156 TAAAATGTGAAATGTGTTTCTGG - Intergenic
1160000860 18:75020425-75020447 TACAATGTGAAACTTTTTCCTGG + Intronic
1166630096 19:44399171-44399193 TAGAATGTGAAATGTCTTTTTGG + Intronic
925847645 2:8048202-8048224 CAGCATGTGGAATGTTTGTCTGG + Intergenic
926106741 2:10156942-10156964 CAGCATCTGAAACGTTCCTCTGG - Intronic
926902967 2:17776396-17776418 CAGAGTGTGAAAGTTTTTTGTGG + Intronic
929127971 2:38538178-38538200 CAGAAGGGGAAATGCTTTTCAGG - Intergenic
929300056 2:40293069-40293091 CAGCATGTGTAAAGATTTTCTGG - Intronic
930261495 2:49152249-49152271 AAGAATGTGAAATTTGTTTCTGG + Intronic
931246886 2:60499375-60499397 CAGAATGTGCAACCTTTCCCAGG - Intronic
935434067 2:103009190-103009212 CAGAATGGGAAACCTCTATCGGG - Intergenic
935616126 2:105083675-105083697 CAGACTGTGAAATATTCTTCAGG + Intronic
935742633 2:106163966-106163988 AAGAATGTAAAAGGTGTTTCAGG + Intronic
937772619 2:125738703-125738725 CAGCATGTGAAACATTCTCCAGG + Intergenic
938212857 2:129483184-129483206 TAGAATGGGAAAGGTTATTCTGG - Intergenic
938609187 2:132929494-132929516 CAGAATCTGAAAAGTATTTTGGG + Intronic
939119688 2:138101455-138101477 TAGAATGTGAACAGTTGTTCAGG - Intergenic
939638522 2:144611596-144611618 CAGAGTGTGCAAGATTTTTCAGG + Intergenic
940489278 2:154336903-154336925 CAGAATATTAGACTTTTTTCTGG + Intronic
940906846 2:159177208-159177230 CTGAAGGTGAAACATTTTTAAGG + Intronic
942322646 2:174749360-174749382 CAGAATGTAAAATATTTGTCAGG - Intronic
942428615 2:175885002-175885024 CACAGTTTGAAATGTTTTTCAGG - Intergenic
942716029 2:178893112-178893134 CAGACTGTGAAAGCTTCTTCAGG + Intronic
942757878 2:179363419-179363441 GAGAAAGAGAAATGTTTTTCTGG + Intergenic
943738046 2:191378747-191378769 GAGAATGAGCAATGTTTTTCAGG + Intronic
946003840 2:216506119-216506141 CAGAATATGAAACACTTTTGAGG + Intronic
946668789 2:222079968-222079990 CTGATTGTGAAATGTTTTTAAGG - Intergenic
947299553 2:228673871-228673893 TAGAATGTTGAATGTTTTTCTGG + Intergenic
947516786 2:230812911-230812933 CTGTTTGTGAAAAGTTTTTCTGG - Intronic
1170540081 20:17378930-17378952 CAAAATGTGAAATATTTTACTGG + Intronic
1172680207 20:36708173-36708195 CATAATGGGAGACTTTTTTCAGG - Intronic
1173119278 20:40274200-40274222 CAGAATGGGCAATGTTTCTCAGG - Intergenic
1174738778 20:52991809-52991831 AAGAGTGTGAAAAGCTTTTCTGG + Intronic
1175455792 20:59112761-59112783 CAGAATGTGAAACTTGCTACAGG + Intergenic
1176629260 21:9121862-9121884 CATAATGTTGAACCTTTTTCAGG + Intergenic
1179208801 21:39308787-39308809 CAGAATGTAAAACATTCTACAGG + Intronic
1179924397 21:44526170-44526192 CAGGTTGTGATGCGTTTTTCTGG - Intronic
1183191192 22:36323003-36323025 CAGAAAGTGAAGCATTTATCAGG - Intronic
1183339045 22:37268118-37268140 CACAATGTGCAACTTTTTTAAGG + Intergenic
949859054 3:8489053-8489075 AAGCATGAGAAAGGTTTTTCGGG - Intergenic
950303096 3:11898853-11898875 CAGAAGGTGGAACGTCTGTCTGG + Intergenic
952484571 3:33797465-33797487 CAGAAGGTGAAACATTCTGCAGG - Intergenic
953136259 3:40184850-40184872 CAGAATGTGAAATCTTTTTTTGG - Intronic
955662413 3:61315486-61315508 CATAAAATGAAACATTTTTCAGG + Intergenic
957150445 3:76479484-76479506 CAGCATGTGAAAGATTTTTATGG - Intronic
957360049 3:79143633-79143655 CAAAATTTGAAAAGTTTTTATGG - Intronic
964306505 3:155346700-155346722 CAGAATTTGAAACTATATTCTGG - Intergenic
964674295 3:159260431-159260453 CAGAATGTGTAACATTTTAAAGG - Intronic
965124001 3:164600815-164600837 CAGAATTTGAAAAGTATTTAAGG + Intergenic
966223820 3:177576980-177577002 CAAACTGTGAACCGTTTTACAGG + Intergenic
966298356 3:178450364-178450386 CAGAATATAAAATGTTCTTCAGG - Intronic
970636190 4:18012068-18012090 AAGAATGTGAAAAGTGTTTGTGG - Intronic
973115858 4:46458080-46458102 CAGCATATGGAACATTTTTCAGG + Intronic
973553049 4:52054297-52054319 CAACAGGTGAAAAGTTTTTCAGG - Intronic
977611933 4:99044504-99044526 TAGAATGTGTGAGGTTTTTCAGG + Intronic
979129487 4:117023846-117023868 AAGCATGTGAAACGTTTTCATGG + Intergenic
979773673 4:124560524-124560546 CAGAAAGTGAAATGTGTTTTTGG + Intergenic
979893269 4:126127385-126127407 GAAAATGTCAAACATTTTTCGGG + Intergenic
980215233 4:129844236-129844258 GAGAATATGATTCGTTTTTCAGG - Intergenic
980816429 4:137952229-137952251 CTGATTGTGAAACATTTTCCAGG + Intergenic
980888676 4:138790559-138790581 CTGAAGATGAAACGCTTTTCTGG + Intergenic
981105523 4:140876294-140876316 CAGAATGTGAAACTCCCTTCAGG + Intronic
982447472 4:155510090-155510112 CAAAATGTGCAACGTTTTTCTGG - Intergenic
983007946 4:162508432-162508454 CAGAATGTGAAAGGTTTTTGAGG + Intergenic
984122288 4:175760820-175760842 TAGAATGAGAAATGTTTGTCTGG + Intronic
986622443 5:9689608-9689630 CACAATGTAATACATTTTTCAGG + Intronic
987662902 5:20900175-20900197 CAGAATCTGAGATTTTTTTCGGG + Intergenic
989850736 5:46206758-46206780 CACAGTGTTAAAAGTTTTTCTGG + Intergenic
992847022 5:80760811-80760833 GAGAATGTGAAAGCTTATTCAGG + Intronic
993763462 5:91826313-91826335 CAGAATCTCAAACGTCTTCCAGG - Intergenic
994872344 5:105367736-105367758 CAGAATGTGTAATGATTGTCAGG - Intergenic
995124514 5:108567064-108567086 CCGTAGGTGAAACGATTTTCTGG + Intergenic
996202306 5:120691349-120691371 CAGAATATGAAAGGGATTTCAGG + Intergenic
998231108 5:140361971-140361993 CAGAATATGAAAGGTTATTTGGG - Intronic
1000480091 5:161762878-161762900 CAGAAGTTGAAACCTCTTTCAGG - Intergenic
1000699651 5:164433053-164433075 CTGGTTGTGAAACATTTTTCTGG - Intergenic
1004969415 6:20892170-20892192 CAGACTGTGAAACTCTTTACTGG + Intronic
1005410913 6:25545616-25545638 GAGAATGTGAAATTTTTTTCAGG + Intronic
1005669032 6:28086204-28086226 CAGGAGGTGACACTTTTTTCTGG - Exonic
1006241948 6:32689740-32689762 CAGATTTTGAAACATTGTTCTGG + Intergenic
1006525393 6:34600220-34600242 CAGATTGTGGAGCGTTTTGCGGG - Intronic
1006785277 6:36662483-36662505 TAGAAGGTGAAATGTGTTTCAGG + Intergenic
1008423062 6:51325160-51325182 CTGAATTTGAAAGTTTTTTCTGG + Intergenic
1009569749 6:65369461-65369483 CAGATTGGGAAATCTTTTTCTGG - Intronic
1012469835 6:99558841-99558863 CAAAATTTGAAACGTTTTGAGGG - Intronic
1014491202 6:122064150-122064172 GAGATTGAGAAAAGTTTTTCTGG + Intergenic
1015642688 6:135352973-135352995 CAGAATTTTAAGAGTTTTTCAGG + Intronic
1017329428 6:153178314-153178336 CAGAATGGGTAAGGTTTTCCTGG + Intergenic
1018164823 6:161083284-161083306 AAAAATGTGAAATGTATTTCAGG - Intronic
1021736252 7:23640812-23640834 CAGAATGTCATTCCTTTTTCTGG + Intronic
1022810404 7:33862413-33862435 CAGAATTTGAAATCTTTTTCAGG + Intergenic
1023665598 7:42519950-42519972 CAGAATGTGTAATGTTTTGAAGG - Intergenic
1024529095 7:50376038-50376060 CACAATAAGAGACGTTTTTCAGG + Intronic
1025040275 7:55637114-55637136 CAGCATGTGAAACATTCTCCAGG - Intergenic
1032654064 7:133908457-133908479 AAGCATGTGAAGCATTTTTCAGG - Intronic
1032816287 7:135478351-135478373 CTGGTTGTGAAATGTTTTTCTGG + Intronic
1033677011 7:143552706-143552728 CAGCATGTGGAACATTTTTCAGG - Intergenic
1033694824 7:143776731-143776753 CAGCATGTGGAACATTTTTCAGG + Intergenic
1034588542 7:152118580-152118602 CAAAATGTGAAAGGTTATTCCGG - Intronic
1035932597 8:3799702-3799724 CAGAATGTCAAACGTTCAGCTGG - Intronic
1039689043 8:39842437-39842459 CAGAATGTGAAGTGTTTTCTGGG + Intergenic
1041963184 8:63643666-63643688 CAGAAAGAGAAAAGCTTTTCTGG - Intergenic
1042782447 8:72506935-72506957 CAGAATATAAAAGGTTTTACAGG + Intergenic
1043756407 8:84009273-84009295 CATAATGAGAAAAGTTTTTGTGG + Intergenic
1044955067 8:97471560-97471582 CTGAAAGTGAAATGTTTTTAGGG - Intergenic
1050401546 9:5261478-5261500 AAGAATGTGAAATGTGTTTTTGG - Intergenic
1051821389 9:21173482-21173504 CAGAAAGTAAAACGGTTGTCAGG + Intergenic
1055923533 9:81487300-81487322 AAGAATGTGAAAAGTTCTACAGG + Intergenic
1056746350 9:89307102-89307124 CAGAATGTGTAACGTTCCACAGG + Intergenic
1057010817 9:91599852-91599874 CAGTATGTGAAACCTTTTTATGG + Intronic
1058132083 9:101264697-101264719 CAGAATGAGAAACTTCTTTGGGG + Intronic
1058720072 9:107756225-107756247 CAAAATCTGAAAATTTTTTCTGG - Intergenic
1203752101 Un_GL000218v1:89536-89558 CATAATGTTGAACCTTTTTCAGG + Intergenic
1186660834 X:11665834-11665856 CAGAACGTGAAGAGTTTTCCAGG + Intergenic
1187566528 X:20455046-20455068 CAGAAGGTGAAATATTTTTGTGG - Intergenic
1188074842 X:25762435-25762457 CAGAATCTGAACTGTTTTTCCGG - Intergenic
1189261463 X:39681927-39681949 CAGAATGTGAACTGCTTTTAAGG + Intergenic
1189626767 X:42905884-42905906 CAGTATATGAAACATTTTTGAGG + Intergenic
1195090784 X:101457125-101457147 CAGAATGTGGAAAATTTTACAGG - Intronic
1198246257 X:134834970-134834992 CAGAATGTGGGACATTTTACAGG - Intronic
1198701690 X:139403784-139403806 CAGAAAGAGAAACATTTTGCTGG + Intergenic
1198990251 X:142505616-142505638 CATAATTTGAAACATTTTTATGG - Intergenic
1199049144 X:143215645-143215667 CCGAATGTGAGTCGTTTTACAGG + Intergenic
1201017668 Y:9622636-9622658 CAGTATTTGAAACATGTTTCAGG - Intergenic
1201491851 Y:14550184-14550206 CAGAATGGTTAAAGTTTTTCAGG + Intronic