ID: 1142730425

View in Genome Browser
Species Human (GRCh38)
Location 17:1851058-1851080
Sequence GGATGGAGCTAGAGCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142730425_1142730429 10 Left 1142730425 17:1851058-1851080 CCAGTTTTGCTCTAGCTCCATCC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1142730429 17:1851091-1851113 CACTATCCTCTGTAATTTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142730425 Original CRISPR GGATGGAGCTAGAGCAAAAC TGG (reversed) Intronic
903694800 1:25198833-25198855 GGAAGGAGCTGGAACCAAACTGG - Intergenic
903885352 1:26537737-26537759 GCATGGTGTTAGAGCAAATCCGG + Intronic
906182457 1:43833911-43833933 GAAAGGATCTAGCGCAAAACTGG - Intronic
909349013 1:74626757-74626779 TGAAGGTGCTAGAACAAAACAGG + Intronic
911253954 1:95612810-95612832 GGATGGAGATGGATGAAAACAGG - Intergenic
911987768 1:104651765-104651787 GGTTGGAGCTGGAGCTATACAGG - Intergenic
913496844 1:119435112-119435134 GGATATGGCTGGAGCAAAACAGG + Intergenic
915082835 1:153363759-153363781 GGATGGTTCTAGAGCAGAAATGG + Intergenic
916080878 1:161231303-161231325 AGATGGTGCTAGAGCAATAGGGG - Intronic
916662157 1:166932584-166932606 GGATGGATCCAGAGCAGCACAGG + Intronic
917578233 1:176346489-176346511 GGCTGGAGCTAGAGTAAGACTGG - Intergenic
917623012 1:176817317-176817339 GGATGGAGCATGTGGAAAACTGG + Intronic
920231530 1:204473809-204473831 GGATGGGGCAAGAGCAGAAGAGG - Intronic
920421700 1:205838832-205838854 GTATGGAGCGAGAGAAAAGCAGG - Intronic
921377982 1:214493609-214493631 AGATGGCGAGAGAGCAAAACAGG + Intronic
922979072 1:229809656-229809678 GGGTGGGGGTAGAACAAAACAGG + Intergenic
924291712 1:242543199-242543221 GGGTGGAGATAGAACAGAACTGG - Intergenic
1064857194 10:19782625-19782647 GGATGGTGGGGGAGCAAAACTGG - Intronic
1064940507 10:20729841-20729863 GGAGGGAGATAGAAAAAAACAGG + Intergenic
1067495660 10:46757907-46757929 GGATGTGGCTGGAGAAAAACAGG - Intergenic
1067598992 10:47582481-47582503 GGATGTGGCTGGAGAAAAACAGG + Intergenic
1067669933 10:48310102-48310124 AGGTGGAGCTAGAGCAATCCAGG + Intronic
1067948655 10:50709066-50709088 GGATGTGGCTGGAGAAAAACAGG + Intergenic
1070070931 10:73088521-73088543 GGATGAAGCAAGAGTGAAACAGG - Intronic
1070883975 10:79874063-79874085 GGATGTGGCTGGAGAAAAACAGG + Intergenic
1071650529 10:87390363-87390385 GGATGTGGCTGGAGAAAAACAGG + Intergenic
1073984331 10:109191285-109191307 AGATGGAGATAGACCAAAAGTGG + Intergenic
1075989529 10:126823511-126823533 GGAGGCAGTTAGAGCAGAACTGG + Intergenic
1079861317 11:25675233-25675255 GGCTGGAAGTAGAGCAAAAGAGG + Intergenic
1083556040 11:63629023-63629045 GGAGGAAGCTAGAGGAAAAATGG - Exonic
1084561800 11:69909770-69909792 GGCTGGAGGGAGAGCAGAACAGG - Intergenic
1090145943 11:124322745-124322767 GGATGGAGCTACAATAAAAAGGG - Intergenic
1090982052 11:131731656-131731678 GGAAGCAGTCAGAGCAAAACTGG + Intronic
1091112964 11:132987651-132987673 GGATGGTGCTAGAGCCAAAGCGG + Intronic
1094067011 12:26372012-26372034 GGTTGGAGCTAAAGGGAAACAGG - Intronic
1096070851 12:48774771-48774793 GGGTGGAGCTGGGGCAGAACAGG + Exonic
1096675405 12:53223179-53223201 GGATGGGGCTTGAGGATAACTGG + Intronic
1099279751 12:80629098-80629120 GGATGGAGATAGAGAAAATATGG + Intronic
1099720320 12:86353954-86353976 GGATGGAACTGGAGAAAAGCTGG + Intronic
1106278974 13:28245672-28245694 GAATGGAGAGAGAGAAAAACGGG - Intronic
1110365843 13:74684774-74684796 TGATGGGGATAGAGAAAAACAGG + Intergenic
1111897850 13:94163299-94163321 GGATGGAGATGAAACAAAACTGG - Intronic
1112493801 13:99889736-99889758 GGATGGAGGTAAAGAAAAATGGG - Intronic
1119603435 14:75993693-75993715 GGAAGGAGCTAGAGTAATGCAGG - Intronic
1120866073 14:89296561-89296583 AGATGAAGCTAGAACCAAACTGG - Intronic
1121117560 14:91354371-91354393 GGATGGAGCTAGACCAGCTCCGG - Intronic
1124608988 15:31194643-31194665 GGCTGGAGCAGGAGCAAAAGAGG + Intergenic
1124825980 15:33096234-33096256 GGATGGAGCTAAGGCAAAGGTGG - Intronic
1129744871 15:78011337-78011359 GCATGGAGCAGGAGCAAAAAAGG + Intronic
1133427120 16:5702280-5702302 GGCAGGAGATAGAGCAAAAGGGG + Intergenic
1137467767 16:48726486-48726508 GGATGGAGGGACAGCAAAAAAGG - Intergenic
1137931311 16:52590069-52590091 GGAGGGAGCTAGAGAAAAGGGGG + Intergenic
1141639109 16:85330817-85330839 GGAGGGAGATAGAGAAAGACAGG - Intergenic
1142596975 17:1034639-1034661 GGAGGGAGGTAGAGTAAAGCTGG - Intronic
1142730425 17:1851058-1851080 GGATGGAGCTAGAGCAAAACTGG - Intronic
1144309793 17:14002111-14002133 GGATGGAGGAATAGCAAAATAGG + Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1146953211 17:36920874-36920896 GGCTGGGGCTGGAGCAATACTGG - Intergenic
1147122571 17:38344157-38344179 GGAGGGAGAAAGAGCACAACTGG - Intergenic
1148989595 17:51653988-51654010 GGATGGAGCCAGAGCCAGATGGG - Intronic
1149528645 17:57377751-57377773 GGATGGAGCGAGTGGAAGACAGG - Intronic
1150621036 17:66807845-66807867 GGAAGGAGCCAGAGAAGAACAGG + Exonic
1153597334 18:6741011-6741033 GTATGGAGCTAGAGAAAAGGTGG + Intronic
1157296242 18:46447339-46447361 TGAAGGAGCTAGAGCAATCCAGG - Intronic
1158186995 18:54781619-54781641 GGATGGAGCTAGAACCAAAATGG - Intronic
1158411259 18:57208128-57208150 GGAGGGAACTTGAGCCAAACAGG + Intergenic
1158561652 18:58519091-58519113 GGTTGGAGCTGCAGGAAAACAGG + Intronic
1162070824 19:8151285-8151307 GGAGGGAGCAAGAGGAAAGCAGG + Intronic
1165438670 19:35811504-35811526 GGAAGGAGAGAGAGCAAAAGAGG + Intronic
1166078400 19:40427331-40427353 GGATGGGGCTAGAGGTAGACAGG + Intergenic
1166818020 19:45558495-45558517 AGATGGCGCTAGGGGAAAACAGG - Intronic
1166863334 19:45822036-45822058 GGTTGGTGCTAGAGAAAAAATGG - Intronic
1167263226 19:48470380-48470402 GGATGGAGCTGGAGAACATCCGG + Exonic
928404519 2:31004404-31004426 GGATGTAGGTAGAGCAAAGCTGG + Intronic
928971193 2:37031166-37031188 GGATGAAGTTAGAGGAAACCAGG - Intronic
929834785 2:45385542-45385564 AGGTGGAGGTAGAGCCAAACAGG - Intergenic
930383116 2:50657181-50657203 GGATGTGGCTAAAGCAAAACTGG - Intronic
931175014 2:59845650-59845672 CACTGGAGCTAGAGCAAGACAGG + Intergenic
931591176 2:63885079-63885101 TGATGGGGCAAGAGGAAAACGGG - Intronic
932178540 2:69624069-69624091 GGAGGGAGCTAGAGGAGAAAGGG + Intronic
933472338 2:82742046-82742068 GGATGGAGGAAGAGCAAAAGAGG - Intergenic
934905384 2:98196617-98196639 GGAGGGAGCAGGTGCAAAACAGG + Intronic
935700828 2:105810369-105810391 GGAGGGAGAGAGAGAAAAACAGG + Intronic
937726711 2:125175671-125175693 GGCTGGAGCTGGAGCAGTACTGG - Intergenic
937863138 2:126729194-126729216 GGATGTAGCTAGAGAAAGGCTGG + Intergenic
938105687 2:128528437-128528459 GGAGGGAGGTAGAGGAAGACAGG - Intergenic
941034520 2:160553564-160553586 GGAGGGCACTAGAGCAAGACTGG - Intergenic
941265576 2:163357566-163357588 GGATGCAGGTTGAACAAAACAGG - Intergenic
943591654 2:189804977-189804999 GGATGAAGCTAGCTCAAAAGAGG + Intronic
945913506 2:215677503-215677525 GGATGGAGGTAGAGCAGGATAGG - Intergenic
946373406 2:219294313-219294335 GGAAGGAGGTGGAGAAAAACAGG + Intronic
946374415 2:219299473-219299495 GGATGGGGCTGGAGCAGATCGGG + Intronic
1173252712 20:41373152-41373174 GGATGGAAATAGAGCAAGAATGG - Intergenic
1175247245 20:57589583-57589605 GGATGGACCAAGAGCCACACTGG - Intergenic
1178304173 21:31476922-31476944 GAAAGTATCTAGAGCAAAACTGG - Intronic
1180035315 21:45245387-45245409 GTACGGAGCTAGAGGAAAAAGGG - Intergenic
1185180359 22:49356774-49356796 GGATGGAGCTAATAAAAAACAGG - Intergenic
1185364319 22:50429930-50429952 GGTTGGAGCTAGAGAAAGGCAGG - Intronic
950452561 3:13073407-13073429 GGATGCTGCGAGAGCAAACCCGG - Intergenic
950827908 3:15845007-15845029 GGCTGGAGCAGGAGCAAAATGGG + Intronic
951744290 3:25960293-25960315 GGATTGGGCTAGAGAAAAAATGG + Intergenic
952385988 3:32842020-32842042 TTATGGTGCTAGAGCAAAGCAGG - Intronic
954991419 3:54843770-54843792 GGATGGAATTGGAGCAAACCTGG + Intronic
955193011 3:56779333-56779355 GGATGGAAAAAGAGGAAAACAGG + Intronic
956186717 3:66569725-66569747 GGATGGAGATGAAGCAAAAGAGG - Intergenic
959667883 3:108941923-108941945 GGTTACAGCTAGAGCATAACTGG - Intronic
960993905 3:123328807-123328829 GGATGGAGCAGGAGTAAAGCTGG + Intronic
961611922 3:128146223-128146245 GGCTGGAGCCAGAAGAAAACAGG + Intronic
963426283 3:145130289-145130311 TGATTGAGCTATAGAAAAACAGG - Intergenic
968192375 3:196678327-196678349 GGATGGATACAGAGCAAAACAGG - Intronic
974736144 4:65935624-65935646 GGATTGTGCTAGAGCAGCACAGG - Intergenic
975376346 4:73650824-73650846 GGAAGGAGGGAGGGCAAAACTGG - Intergenic
980880870 4:138708911-138708933 GGATGGAGAAAGAGCAGAAAAGG - Intergenic
982362716 4:154538431-154538453 GGAGGGAGGGAGAGCAAGACAGG + Intronic
982499699 4:156137813-156137835 GGATTTAGGTAGAGGAAAACAGG - Intergenic
983263727 4:165485949-165485971 GGAAGGGGATAGAGCTAAACAGG + Intronic
983488530 4:168360585-168360607 AAATGGAGCTAGACAAAAACTGG + Intronic
984108215 4:175576725-175576747 GAATGGAGCTAGAGGGAGACTGG + Intergenic
985969514 5:3364048-3364070 GGATGTCGCTGCAGCAAAACAGG + Intergenic
990073701 5:51816729-51816751 GCAGGGAGGTAGAGAAAAACAGG - Intergenic
990770527 5:59239086-59239108 TGCTGGAGCTAAAGTAAAACAGG + Intronic
994293514 5:98060324-98060346 GGATGCAGATGTAGCAAAACAGG - Intergenic
995066935 5:107873060-107873082 GGATGGAAATAGATCATAACAGG + Intronic
997955548 5:138275888-138275910 GGGTGGAGCTGGGGGAAAACAGG - Intergenic
998092480 5:139379429-139379451 GGAAGGAGCAAGAGCAGATCAGG + Intronic
998298266 5:140992848-140992870 GGAGGGAGCTAGAGTGAAACTGG - Intronic
1001768712 5:174276208-174276230 GGAAGAAGATGGAGCAAAACAGG + Intergenic
1003026644 6:2560825-2560847 GGATGAAGCTGGAGAAAAACAGG - Intergenic
1004959958 6:20776873-20776895 GGTTGCAACTAGGGCAAAACAGG + Intronic
1005243630 6:23857297-23857319 GGATGGAGATAGCACAAAACTGG + Intergenic
1006272366 6:32974119-32974141 GGATGGGGCTTAAGCAAAATGGG - Intronic
1007182218 6:39937590-39937612 AGCTGTAGCCAGAGCAAAACAGG - Intergenic
1007329613 6:41095143-41095165 TGAAGGAGCTTGAGCAGAACAGG - Intronic
1009055437 6:58329058-58329080 GGATGGGGGTAGTGCAAAATAGG - Intergenic
1009235727 6:61121525-61121547 GGATGGGGGTAGTGCAAAATAGG + Intergenic
1015563076 6:134537348-134537370 AAATGGGGCTAGAACAAAACTGG - Intergenic
1021405239 7:20260169-20260191 GGATGGAGATAGGGCAATACAGG - Intergenic
1022260812 7:28703160-28703182 GGATAGAAGAAGAGCAAAACTGG + Intronic
1025968425 7:66297846-66297868 GTATGGAGATAGAAAAAAACAGG - Intronic
1026849119 7:73713989-73714011 GGATGGGGCTCTGGCAAAACAGG - Intronic
1027867677 7:83668139-83668161 GGGTGGAGTTAGTGCAAAATTGG + Intergenic
1027979858 7:85203783-85203805 AGATTGAGCTAGAGAAATACAGG + Intergenic
1028986688 7:97015153-97015175 GGAGGGAGTTAGAGCAAGAGAGG + Intergenic
1030579879 7:111341662-111341684 GGATAGAGCTAGAACCAAAAAGG + Intronic
1032054191 7:128671734-128671756 TGCTGGAGCCAGACCAAAACAGG - Intergenic
1032086143 7:128884869-128884891 GGGTGGAGTGAGAGCAGAACGGG + Intronic
1035055695 7:156034542-156034564 GGAGAGAGCGAGAGCAAAAGGGG + Intergenic
1036723974 8:11201877-11201899 GGGCGGAGCTAGTGCAAAGCAGG + Intergenic
1038087150 8:24211339-24211361 GGATGGAGTGAGTGCAAGACAGG - Intergenic
1040815531 8:51504361-51504383 GGATTGAGGTAGAGCAAGAAGGG - Intronic
1046967317 8:120182028-120182050 GGGAGGAACTAGAGGAAAACTGG - Intronic
1047091137 8:121577099-121577121 GGAGGAAGATAGAGCAAAACAGG + Intergenic
1047370706 8:124253531-124253553 GGAGGGAGCTAGAGAAGAAAAGG - Intergenic
1056411741 9:86334873-86334895 GGGTAGAGCTACAGAAAAACAGG + Intronic
1058659097 9:107252597-107252619 TGATGGAGCTAGAACAAAGGTGG + Intergenic
1188510057 X:30926201-30926223 GGGTAGAGGTAGAGCACAACTGG - Intronic
1189359081 X:40334980-40335002 GCATGGAGTTAAAACAAAACTGG - Intergenic
1190408545 X:50111881-50111903 GGCTGGAGCTGGCTCAAAACAGG - Intergenic
1192152286 X:68719721-68719743 GGATGGAGCGGGACCAGAACAGG - Intronic
1194746489 X:97634187-97634209 GCATGGAGATAGAGCAAACTGGG + Intergenic
1195321814 X:103727112-103727134 AGAGGCAGTTAGAGCAAAACGGG - Intronic
1198408680 X:136343086-136343108 TGATGGAGATAGAGATAAACTGG + Intronic
1198672548 X:139096523-139096545 GGCTGGAGCTAGATCATAAAGGG + Intronic
1200742544 Y:6869811-6869833 GGAGGGTGCTGGAGCAACACAGG + Intronic