ID: 1142730831

View in Genome Browser
Species Human (GRCh38)
Location 17:1855895-1855917
Sequence TACCAAAGTCTACTCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142730831_1142730833 -6 Left 1142730831 17:1855895-1855917 CCCTTCTTGAGTAGACTTTGGTA 0: 1
1: 0
2: 1
3: 22
4: 190
Right 1142730833 17:1855912-1855934 TTGGTAGATTATGTGCTTCAAGG 0: 1
1: 0
2: 7
3: 103
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142730831 Original CRISPR TACCAAAGTCTACTCAAGAA GGG (reversed) Intronic
902083861 1:13841535-13841557 TACAAAAATCCACTCAAGATGGG - Intergenic
908196995 1:61754951-61754973 TACCAAGGGATACTCCAGAATGG + Intronic
909224048 1:72993625-72993647 TCCCTAAGTCAACTGAAGAATGG + Intergenic
916391295 1:164333736-164333758 TACCACGGTGTACTCGAGAATGG - Intergenic
916771123 1:167909669-167909691 TAGCAAGATCTACTCAAGCAGGG - Intronic
917604957 1:176617831-176617853 CACCACAGTTTACTCAAAAATGG - Intronic
918561740 1:185877062-185877084 TACAAAAATCAACTCAAGATGGG - Intronic
918707147 1:187678458-187678480 TACCAAAGTCTATGAAAGAAGGG - Intergenic
919111572 1:193226077-193226099 TACAAAAATCAACTCAAGATGGG - Intronic
921768109 1:218997528-218997550 TCCCACATTCTACTTAAGAAGGG + Intergenic
922411503 1:225380352-225380374 TACCTCACTCTCCTCAAGAAAGG + Intronic
923827794 1:237519433-237519455 TACAAAAATCAACTCAAGATGGG - Intronic
924779862 1:247137282-247137304 TACCAAAATTAACTCAAGATGGG + Intronic
924867809 1:248004752-248004774 TACCAAAATCAACTCAAAATGGG - Intronic
1062997969 10:1885259-1885281 CACCAAAGATTACTTAAGAAAGG + Intergenic
1076045278 10:127288246-127288268 TATCAAAGACTACTTAAGCAGGG - Intronic
1077450659 11:2641793-2641815 TACTAAAATCAACTCAAGATGGG - Intronic
1079502000 11:21111438-21111460 TACAAAAGTTATCTCAAGAAAGG - Intronic
1080211537 11:29792548-29792570 TACCAGAGTTTAGCCAAGAATGG + Intergenic
1080981653 11:37414636-37414658 TACGGAAGTCTACACAAAAATGG - Intergenic
1081324932 11:41732635-41732657 AAGCAAACTCTACTAAAGAATGG + Intergenic
1086243813 11:84727249-84727271 TACAAAAATCAACTCAAGATGGG - Intronic
1086923947 11:92619328-92619350 TACCAAAATCATCACAAGAAAGG - Intronic
1087550574 11:99642121-99642143 GACCAGAGGCTACTCAAGACTGG - Intronic
1088145060 11:106666751-106666773 TACAAAAATCAACTCAAGATAGG - Intergenic
1088215441 11:107503064-107503086 TACCAAAATTGACTCAAGAAGGG - Exonic
1089384178 11:118057242-118057264 AACCAAAGTGCACTCAGGAAGGG + Intergenic
1090843893 11:130515220-130515242 TACCAAAGCCTAACCAACAAGGG - Intergenic
1090859235 11:130638407-130638429 TGCCAGAGTCTACTCAAGGCAGG - Intergenic
1093640909 12:21526344-21526366 TCCCAAACTCTACTCCAGATGGG + Exonic
1095558229 12:43533963-43533985 TACAAAAATCAACTCAAGATGGG + Intronic
1095574963 12:43726381-43726403 TACAAAAATCAACTCAAGATGGG + Intergenic
1095947340 12:47760884-47760906 TAGGAGAGTCTACTCAAAAAAGG + Intronic
1096422593 12:51472711-51472733 AACCAAAGTCTACTCAATCCGGG - Intronic
1098513989 12:71352633-71352655 TACAAAAATCAACTCAAGATGGG + Intronic
1099322376 12:81166552-81166574 AAGCAAAGTGTACTAAAGAAGGG + Intronic
1099680887 12:85826262-85826284 AACCAAAATCTAGTCACGAATGG + Intronic
1101161406 12:101979992-101980014 TACCATAGTCCTATCAAGAAGGG - Intronic
1101298179 12:103448279-103448301 TACAAAAATCAACTCAAGATGGG + Intronic
1102313491 12:111866164-111866186 TAAAGAAATCTACTCAAGAACGG + Exonic
1105689946 13:22827319-22827341 TACAAAAGTCTACTCAGGATAGG + Intergenic
1106260796 13:28064782-28064804 TGCCAAATTCTTCTCCAGAAGGG - Intronic
1106465755 13:30013223-30013245 TAACTAAATCTACTCCAGAAGGG + Intergenic
1107220634 13:37974912-37974934 TACCAAAGACTATGCTAGAATGG - Intergenic
1108787266 13:53920130-53920152 TAACAAAATCTACTCAAGAATGG - Intergenic
1109658193 13:65422055-65422077 TACAAAAATCAACTCAAGATGGG + Intergenic
1111284504 13:86071199-86071221 TACAAAAATCAACTCAAGATGGG + Intergenic
1112148749 13:96732328-96732350 TACAAAAATCAACTCAAAAATGG - Intronic
1115293957 14:31804772-31804794 TACAAAAATCAACTCAAGATGGG + Intronic
1117173097 14:53120784-53120806 TACAAAAATCAACTCAAAAATGG + Intronic
1118069228 14:62227139-62227161 TACCAAAGATTATTCAAAAAAGG - Intergenic
1118919906 14:70140405-70140427 TACCAAAAGCCACACAAGAAGGG + Intronic
1122912700 14:104840326-104840348 TACAAAAATGTACTCAAAAATGG - Intergenic
1125145428 15:36461958-36461980 TACAAAAATCAACTCAAGATGGG - Intergenic
1125204153 15:37132378-37132400 TAACAAAGTATACACAAGAACGG + Intergenic
1126201029 15:45986284-45986306 TACAAAAGTTAACTCAAGATGGG + Intergenic
1126213165 15:46123006-46123028 TACAAAAATCAACTCAAGATAGG - Intergenic
1126988276 15:54340440-54340462 TACAAAAATCTACTCATGATAGG - Intronic
1132412494 15:101593686-101593708 TACAAAAATCAACTCAAGATGGG - Intergenic
1135838258 16:25848485-25848507 TACCAAAGTAAACTCAAAAAGGG - Intronic
1135922269 16:26661925-26661947 TACAAAAATCAACTCAAGATGGG - Intergenic
1138743842 16:59340333-59340355 TACAAGAGACTCCTCAAGAAAGG - Intergenic
1142730831 17:1855895-1855917 TACCAAAGTCTACTCAAGAAGGG - Intronic
1147568056 17:41549560-41549582 TTCCAAAGTGTAACCAAGAAGGG + Intergenic
1148288181 17:46415345-46415367 GACAAAAGTCTACTGCAGAAAGG - Intergenic
1148310351 17:46632929-46632951 GACAAAAGTCTACTGCAGAAAGG - Intronic
1149149806 17:53547609-53547631 TACAAAAGTATACTGGAGAAGGG + Intergenic
1154392336 18:13949367-13949389 CGCCAAACTCAACTCAAGAAAGG - Intergenic
1156164159 18:34397977-34397999 TACAAAAATCAACTCAAGATGGG - Intergenic
1157347911 18:46856786-46856808 TACTCCAGTCTTCTCAAGAAAGG - Intronic
1159589603 18:70319142-70319164 TACCAAAGTCTTCCCAGAAAGGG - Intronic
1162941483 19:14012373-14012395 TACAAAAATCAACTCAAGATGGG + Intergenic
1167830632 19:52018600-52018622 TACCAAAGTATATTTGAGAAAGG - Intronic
928463151 2:31494621-31494643 TACAAAAGTTAACTCAAGATTGG + Intergenic
929642928 2:43599699-43599721 TACAAAAATCAACTCAAGATGGG + Intergenic
929821355 2:45276574-45276596 TTCAAAAGTTTAGTCAAGAATGG + Intergenic
930161409 2:48160988-48161010 TACAAAAATCAACTCAAAAATGG + Intergenic
931111780 2:59118724-59118746 TCCCAAAGTCTAGCCAAGAGTGG - Intergenic
931991941 2:67799255-67799277 AACCAATGTCTATTGAAGAAAGG - Intergenic
932651235 2:73559867-73559889 TACAAAAGTTAACTCAAAAAGGG + Intronic
934614261 2:95761556-95761578 TTCCAGAGTCTGCTCAAGATGGG - Intergenic
936631544 2:114208355-114208377 TATCAATGACTCCTCAAGAATGG + Intergenic
938246234 2:129779939-129779961 TCCCAAAGTCAACTCCAGCACGG - Intergenic
939492332 2:142891485-142891507 TACTAAAGTCTACTAAAGTTGGG - Intronic
940423250 2:153503233-153503255 TACAAAAATCAACTCAAGATGGG - Intergenic
941976727 2:171413893-171413915 TACCAAAGCCCCCTCAGGAAAGG - Intronic
943022826 2:182596155-182596177 AAACAAAGTCTAATCAAGTAAGG + Intergenic
944286744 2:197959033-197959055 TACCGAAATATACTCTAGAAAGG + Intronic
946603909 2:221380620-221380642 GACCAAAATCCACTCAACAAAGG + Intergenic
948265570 2:236633133-236633155 TATCAAAGTCTTCCCAAGAGAGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170259740 20:14390727-14390749 TACAAAAATTAACTCAAGAATGG + Intronic
1170755428 20:19200942-19200964 TAGAAGAGTCTACCCAAGAATGG - Intergenic
1171146653 20:22790020-22790042 TACCAAATGCAACTCTAGAATGG - Intergenic
1174241283 20:49137279-49137301 TAATAAAGTCTCCTCAACAAAGG + Intronic
1174522187 20:51140370-51140392 TTCCAAAATCTGCTCTAGAAAGG - Intergenic
1182179772 22:28335009-28335031 TACAAAAATCAACTCAAGATGGG - Intronic
1184816661 22:46877074-46877096 TACAAAAGTCTTTTTAAGAATGG + Intronic
952434739 3:33261822-33261844 TACAAAAATCAACTCAAGATGGG - Intergenic
953113602 3:39968479-39968501 TACAAAAATCAACTCAAGATAGG - Intronic
953491658 3:43357780-43357802 TACAAAAATCAACTCAAGACAGG + Intronic
954479404 3:50784162-50784184 TACAAAAATCAACTCAAGGATGG - Intronic
955048207 3:55380563-55380585 TACCAAAATTGATTCAAGAAAGG + Intergenic
956048414 3:65220925-65220947 TACCAAAGTTTACTTTGGAAAGG + Intergenic
957457033 3:80465082-80465104 TACAAAAATTAACTCAAGAAGGG - Intergenic
959038500 3:101393180-101393202 TACAAAAATCTACTCAAAATGGG + Intronic
959799400 3:110473640-110473662 TTACAGAGTGTACTCAAGAAAGG - Intergenic
960616721 3:119602354-119602376 TACCAAAACTTAGTCAAGAAAGG - Intronic
962651408 3:137497299-137497321 TACAAAAATCAACTCAAGATGGG - Intergenic
963001582 3:140686674-140686696 TACCAAATTTTACTCAGGAGTGG - Intronic
965240972 3:166196849-166196871 TACCAGACTCTACTCCAGAATGG - Intergenic
966158459 3:176943787-176943809 TACAAAAGTCAACTCAAGATGGG + Intergenic
970184614 4:13437200-13437222 TACAAAAATCAACTCAAGATGGG + Intronic
970820620 4:20207712-20207734 TACTAAAATTGACTCAAGAAAGG + Intergenic
972279982 4:37592382-37592404 TACAAAATTATACTCAAGGAAGG + Intronic
972983461 4:44734165-44734187 TACCAAAACTGACTCAAGAAAGG - Intergenic
974661364 4:64894222-64894244 TACCAAAATTTAGTCAAGCATGG - Intergenic
975404457 4:73973869-73973891 TACAAAAATCAACTCAAGATGGG + Intergenic
976303120 4:83534464-83534486 TACCAAAGTTTACCCCACAAGGG - Intergenic
978208642 4:106109612-106109634 TACAAAAATCTACTCAAGGTGGG + Intronic
978601733 4:110435320-110435342 TACAAAAATCAACTCAAAAATGG - Intronic
978607883 4:110502427-110502449 TACAAAAGTCAACTCAAGACAGG - Intronic
979387417 4:120085722-120085744 TACAAATGTTTACTAAAGAAAGG - Intergenic
981664856 4:147212522-147212544 TACAAAAATCGACTCAAGATGGG - Intergenic
982438517 4:155405216-155405238 TATCAAAGTTTACTCAAGTTTGG - Intergenic
983357365 4:166680933-166680955 AACAAAAGTCTTCTAAAGAATGG + Intergenic
984126042 4:175812233-175812255 TACCAGATTCTACTGAAGAAAGG - Exonic
985762850 5:1760349-1760371 TGCCAAACTCTAAGCAAGAATGG - Intergenic
986776330 5:11017209-11017231 TTCCAAAATCTGCTCAATAAGGG - Intronic
987475984 5:18393045-18393067 GTCAAAAGTCTACTCAACAATGG - Intergenic
988302327 5:29447462-29447484 GACCAAAGTCTACATAAAAATGG + Intergenic
989689696 5:44126312-44126334 TACAAAAATCAACTCAAGATGGG + Intergenic
990113340 5:52355845-52355867 TACCAAAAACTACTCTGGAATGG + Intergenic
990134177 5:52625284-52625306 TACAAAAATCAACTCAAGATGGG - Intergenic
990171643 5:53057713-53057735 TACCAAAGGACACTCAACAAAGG - Intronic
993575815 5:89599151-89599173 TACAAAAGTTAACTCAAGATTGG + Intergenic
994469672 5:100187209-100187231 TATTAAAGACTACACAAGAAGGG - Intergenic
994653487 5:102559766-102559788 TACAAAAATCAACTCAAGATGGG + Intergenic
995093474 5:108208466-108208488 TACAAAAATCAACTCAAGATGGG - Intronic
996032364 5:118720206-118720228 TACAAAAATCAACTCAAGAAGGG + Intergenic
996679733 5:126218876-126218898 TACAAAAGTCAACTCAAGATGGG + Intergenic
999565972 5:152862151-152862173 TGCCAAAGTCTACTGAATAATGG + Intergenic
1000358452 5:160423706-160423728 TACTACAGTCTACTATAGAAGGG - Intronic
1000922571 5:167156209-167156231 TACCAAAGTCTCGTAAAGCAGGG - Intergenic
1001330917 5:170761774-170761796 TACCAAACATTACTCAGGAAGGG + Intergenic
1001333747 5:170781195-170781217 TACCCAAGTCCATTCAATAATGG - Intronic
1001612260 5:173012432-173012454 TACAAAAGTCAACTCAGGATGGG + Intronic
1003246980 6:4390762-4390784 TACCTAAATGTACACAAGAATGG - Intergenic
1005787052 6:29254692-29254714 TACAAAAATCAACTCAAGATGGG + Intergenic
1006978838 6:38129477-38129499 TACAAAAATCAACTCAAGATGGG - Intronic
1008742716 6:54629066-54629088 TACCAAAGAAAATTCAAGAATGG + Intergenic
1009849307 6:69175293-69175315 TACAAAAATCGACTCAAGATGGG - Intronic
1009940908 6:70286827-70286849 TACCAAAGGCTACAGCAGAATGG + Intronic
1010178625 6:73058079-73058101 TACAAAAATCAACTCAAGATGGG + Intronic
1010675031 6:78733159-78733181 TACAAAAATCAACTCAAGAGGGG + Intergenic
1010675219 6:78735656-78735678 TACAAAAGTCAACTCAAAAGGGG - Intergenic
1011332080 6:86220215-86220237 TACAAAAGTCAACTCAAGATGGG - Intergenic
1014973613 6:127849730-127849752 TACAAAAATCAACTCAAGATGGG + Intronic
1017818885 6:158034835-158034857 TACAAAAATCAACTCAAGATGGG - Intronic
1018756098 6:166850949-166850971 TCCCACAGTGTACTCAACAATGG - Intronic
1019034459 6:169042865-169042887 TACCAAACTCTACCAAAGAGTGG + Intergenic
1022762967 7:33377200-33377222 TACAAAAATCAACTCAAGATGGG - Intronic
1022904121 7:34839567-34839589 TACCAATCTCTACTTTAGAAGGG + Intronic
1023075440 7:36477494-36477516 TACAAAAATCAACTCAAGATGGG - Intergenic
1023279424 7:38554397-38554419 TGCCAAAGTGTACTCCAGAAAGG - Intronic
1024280746 7:47717285-47717307 TACAAAAATCTACTCAAAAATGG + Intronic
1024328138 7:48129470-48129492 TACCAAAGTCTCCGCAACAAAGG - Intergenic
1024344913 7:48303490-48303512 TACAAAAATCAACTCAAGATGGG - Intronic
1024847451 7:53663732-53663754 TACAAAAATCAACTCAAGATGGG - Intergenic
1025060480 7:55801957-55801979 TCCCAAAGTCTTCCAAAGAATGG + Intronic
1028813156 7:95112105-95112127 TACCCAAGGATACTCAAGCATGG + Intronic
1031760698 7:125709992-125710014 TACAAAAATCAACTCAAGATGGG - Intergenic
1031799064 7:126219776-126219798 TACAAAAATCAACTCAAGATGGG - Intergenic
1032249797 7:130245854-130245876 TACAAAAATCAACTCAAGACGGG + Intergenic
1032547064 7:132752763-132752785 TACCATAATCTTCTCAAGATTGG + Intergenic
1033027228 7:137786961-137786983 TACAAAAATCAACTCAAGATAGG + Intronic
1033931448 7:146528058-146528080 TACCAGAGTCTTCTCAAAGAGGG + Intronic
1037660026 8:20918420-20918442 TTCCAAAGTCTACTCAGTCATGG - Intergenic
1038671952 8:29589851-29589873 CTGCAAAGTCTAATCAAGAAAGG - Intergenic
1038819263 8:30937271-30937293 TTCCAAAGTCCACTCATGAGTGG + Intergenic
1039714106 8:40089806-40089828 TTTCAAAGTCTCTTCAAGAAGGG + Intergenic
1040820529 8:51551661-51551683 TACAAAAATCAACTCAAGAAGGG + Intronic
1042394357 8:68275004-68275026 TACAAAAGTCAACTCAAAATAGG - Intergenic
1042751799 8:72165506-72165528 TACAAAAATCAACTCAAGATGGG - Intergenic
1043329748 8:79100915-79100937 TACAAAAATCAACTCAAGATGGG - Intergenic
1043681314 8:83028968-83028990 TACAAAACTCAACTCAAGATGGG + Intergenic
1043951551 8:86315034-86315056 TACCAAAATCAAGTCAAGATTGG - Intronic
1044312078 8:90705352-90705374 TACAAAAGTCAACTCAAGATAGG - Intronic
1044571762 8:93726879-93726901 TACCAAATTATACTAAAAAAGGG + Intronic
1046060772 8:109136897-109136919 TACAAAAGTCAACTCAGGATGGG - Intergenic
1050145690 9:2565013-2565035 TACAAAAGACTCCTCAAGAATGG - Intergenic
1051363103 9:16299448-16299470 TACAAAAGTCAACTCAAGATGGG + Intergenic
1051368918 9:16341801-16341823 TAGCAAAGTCTACTTGAGATTGG + Intergenic
1051492434 9:17681539-17681561 TACAAAAGTTAACTCAAGATGGG + Intronic
1052176301 9:25467178-25467200 TACAAAAATCAACTCAAGATGGG - Intergenic
1052274475 9:26661838-26661860 TCCTGAAGTCTAATCAAGAATGG + Intergenic
1055412053 9:76041340-76041362 TACAAAAGTCATCTCATGAATGG - Intronic
1056396345 9:86184911-86184933 TAACACAGCCTACTCATGAAGGG + Intergenic
1058248597 9:102662586-102662608 TACCTAAGTTTACTCACGATAGG - Intergenic
1060605165 9:124907492-124907514 TAAGAAAGTCTATTCAACAAAGG + Intronic
1186723239 X:12328658-12328680 TAACAATGTGTACTCTAGAAAGG - Intronic
1189055366 X:37694036-37694058 TACCAAAGGCCACTGAAGCAAGG - Intronic
1189154375 X:38741774-38741796 CACCAAGGTCTACTCAAGAGTGG - Intergenic
1190941232 X:55043180-55043202 TACAAAAATCAACTCAAGATAGG + Intergenic
1192068698 X:67914195-67914217 TACAAAAGTCAACTCAAGAGGGG - Intergenic
1192672840 X:73164645-73164667 TACAAAAATCAACTCAAGATGGG - Intergenic
1194113599 X:89869153-89869175 TACAAAAATCAACTCAAGATGGG - Intergenic
1194125941 X:90016798-90016820 TACAAAAATCAACTCAAGATGGG + Intergenic
1194383258 X:93221896-93221918 TACCAAACTATACTCAAAAGAGG + Intergenic
1195483347 X:105373672-105373694 TACAAAAATCAACTCAAGATGGG - Intronic
1197188777 X:123621302-123621324 AATCAAAATCAACTCAAGAAAGG - Exonic
1198892603 X:141415195-141415217 GAACAAAGTCTATTAAAGAAAGG + Intergenic
1199469380 X:148177296-148177318 TACAAAAGTTAACTCAAGATGGG - Intergenic
1201618800 Y:15931578-15931600 TTGTGAAGTCTACTCAAGAAAGG - Intergenic