ID: 1142732166

View in Genome Browser
Species Human (GRCh38)
Location 17:1867096-1867118
Sequence TTTAAATTGGAGAGGGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142732161_1142732166 22 Left 1142732161 17:1867051-1867073 CCTACTAGATATTAATTTTTATT 0: 1
1: 0
2: 2
3: 72
4: 982
Right 1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG 0: 1
1: 1
2: 1
3: 18
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142732166 Original CRISPR TTTAAATTGGAGAGGGAATC GGG Intronic
905928218 1:41767175-41767197 TCCAAATAGGAGATGGAATCAGG - Intronic
906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG + Intergenic
906259398 1:44375284-44375306 TAGAAATTAGAGAGGGAATGTGG + Intergenic
907602600 1:55785923-55785945 TTTAAATCTGAGAGGGAAAAAGG + Intergenic
912391812 1:109308161-109308183 TTTAAAATGCAGAGGGATGCTGG - Intergenic
913272101 1:117104446-117104468 TTTAGTTTGGAGAGGGATGCAGG + Exonic
913382594 1:118227783-118227805 TTTAAATCGGAGAGGGAGAAGGG - Intergenic
914906256 1:151747843-151747865 TATAAATTAGAGAGGGAAAAGGG - Intergenic
916391557 1:164336334-164336356 TTATTATTGGAGAGGGATTCTGG + Intergenic
916493121 1:165319180-165319202 TTTAAATAGTAGAGGTAATATGG - Intronic
916673845 1:167049679-167049701 TGTAAAATGGAGAGGGTATGTGG + Intergenic
919426097 1:197432985-197433007 TTGGAATTGGAGAGTTAATCAGG + Intronic
919604393 1:199663542-199663564 TTAAAATTAGAGAGGGAATTGGG - Intergenic
920142113 1:203823970-203823992 TTAAAAAAGGAGAGGGAAGCCGG + Intronic
921771086 1:219040742-219040764 TTTACATTGAAGAGAGAACCTGG + Intergenic
922059058 1:222070019-222070041 TTTCAATAGGATAGGGAATAGGG + Intergenic
922801899 1:228368279-228368301 CTTAAAGTGGAGAGGGAGGCTGG + Intronic
922827871 1:228534150-228534172 TTCAAATTGGAGACAGACTCTGG - Intergenic
923281864 1:232450890-232450912 ATTAAGTTGAAGAGAGAATCTGG + Intronic
924132550 1:240926999-240927021 TTTAAACTGGGGATGGAAACAGG + Intronic
1063270501 10:4504822-4504844 TTTAAATTGTAGTGGGATGCAGG + Intergenic
1063939596 10:11113641-11113663 CTTAAATTGGAGAAGGCCTCTGG + Intronic
1064254881 10:13734883-13734905 TTTATTTTTGAGATGGAATCTGG + Intronic
1064260870 10:13785210-13785232 TTGAAATTGGTGAGTGAATTTGG + Intronic
1067243283 10:44515055-44515077 TTTAACTTGGCTAGGGAATGTGG + Intergenic
1067814220 10:49459830-49459852 TTAAAATTGGAGTCTGAATCTGG + Intronic
1068240627 10:54297718-54297740 TTTAAATCGGAGAGGGAGAAGGG - Intronic
1068690442 10:59908297-59908319 GTTAAATTGGAAACGGATTCTGG + Intergenic
1070408674 10:76119373-76119395 TTAAAAATGAAGAGGGAACCTGG + Intronic
1070530279 10:77331000-77331022 TGTACGTTGGAGAGGGAATGGGG - Intronic
1071169896 10:82852059-82852081 TTGGAATTGGAAAGGGAATGTGG + Intronic
1072153225 10:92699969-92699991 TTTATTTTGGAGGGGGAATTTGG + Intergenic
1072549210 10:96464370-96464392 TTTATTTTTGAGATGGAATCTGG - Intronic
1074790546 10:116882207-116882229 TTTAAAAAGGAGAGGGAATTAGG - Exonic
1075472786 10:122705376-122705398 TTGAATTTGGAGAGGTAATATGG + Intergenic
1077845526 11:6019685-6019707 TTTAAATTGGAAAGACAATTGGG - Intergenic
1078678106 11:13445885-13445907 ATTAAATTGGATAGTGAATGTGG - Intronic
1078986287 11:16603007-16603029 TTTTTATTTGAGACGGAATCTGG - Intronic
1082608522 11:55272369-55272391 TTTAAAATGATGAAGGAATCTGG - Intergenic
1082645865 11:55724204-55724226 TTTGAAAGGGAGAAGGAATCAGG - Intergenic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1087319253 11:96638640-96638662 TTTAAATTAGAGAGGGAGAAGGG - Intergenic
1087680360 11:101213095-101213117 TTCAAACTCAAGAGGGAATCTGG - Intergenic
1087909292 11:103734817-103734839 TCTACACTGGAGATGGAATCAGG - Intergenic
1088404590 11:109459776-109459798 TTTAAATTTGAGATAGAATATGG + Intergenic
1090005543 11:122999145-122999167 TTTAATTTGGAAGGGAAATCAGG - Intergenic
1090137797 11:124217087-124217109 TTTAAATTGGGGAGAGACACAGG - Intergenic
1092866734 12:12768302-12768324 ATTATATTGGAAAGGGAATATGG - Intronic
1093277256 12:17145147-17145169 TTTGAATTGGAGATGATATCAGG + Intergenic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1095116285 12:38356283-38356305 TCTAAATTGGGGAGGAAATTAGG + Intergenic
1095622699 12:44277655-44277677 CTTAAATTTGAGAGTGACTCTGG - Intronic
1095796829 12:46228492-46228514 GTGACATTTGAGAGGGAATCAGG + Intronic
1095853654 12:46837670-46837692 TTTCAATGGGAGAGGAAATTGGG + Intergenic
1096862352 12:54538986-54539008 TTTAAATTGGTGTGAGAATAGGG + Intronic
1097355247 12:58593846-58593868 GTTAAGTGGGAGAGGGTATCTGG + Intronic
1098953087 12:76662014-76662036 TTCAAATTGGAGTTGGAATTTGG - Intergenic
1100985972 12:100201941-100201963 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1103515245 12:121503624-121503646 TTTAACTTGGAGGGGGGATGAGG + Intronic
1104767091 12:131337090-131337112 TTTAAATCAGAGAGGGAAAAGGG - Intergenic
1105406128 13:20134067-20134089 TTTATTTTTGAGATGGAATCTGG + Intergenic
1106355586 13:28979688-28979710 TTCAAAATGGAAAGGGAATCTGG + Intronic
1106554666 13:30799232-30799254 TCTAAATTGAAGTGGGAGTCGGG - Intergenic
1106821185 13:33466377-33466399 TTGAAATAGGAGAGGGATGCAGG - Intergenic
1107242844 13:38257984-38258006 TTTAGATTGGGGAGGTAATAGGG + Intergenic
1107296687 13:38916561-38916583 ATTAAATGGGAGAGGGAAAGAGG - Intergenic
1109244677 13:59939301-59939323 TACAATTTGGAGAGGTAATCTGG - Intronic
1109419588 13:62094077-62094099 TTTTCCTTGGAGAGGGAAGCTGG - Intergenic
1110384062 13:74888083-74888105 TTTAAATGTGAGAGGTAAGCTGG - Intergenic
1110933347 13:81250835-81250857 TTTAAATAAGAGAGTGAACCAGG - Intergenic
1112564513 13:100541602-100541624 TATAAGTGGGAGAGGGCATCAGG + Intronic
1112773508 13:102818833-102818855 TTTAAAAAGGAGAGGGAAAGGGG - Intronic
1113166757 13:107451322-107451344 AATAAATAGGAGGGGGAATCAGG - Intronic
1114028295 14:18550501-18550523 TTTAAATTTGGGAGGTAGTCTGG + Intergenic
1114463688 14:22905043-22905065 TTTTAAGGGGAGAGGGAATGTGG - Intronic
1115776276 14:36719098-36719120 TTCAAAGTGGAGAGGAAAACTGG + Intronic
1115919304 14:38355030-38355052 TTTAAACTTGAGAGAGTATCTGG + Intergenic
1116963071 14:50986689-50986711 TTTGAATAGGAGAGGAAATGTGG + Intronic
1120096278 14:80391644-80391666 TTTAAATAAGAGATGGAACCAGG - Intergenic
1120216487 14:81686041-81686063 GGTAAATTGGTGAGAGAATCGGG - Intergenic
1120934353 14:89879413-89879435 TTTAAATTGAATAAGGAATATGG - Intronic
1123711217 15:22989153-22989175 TTAAAATTGCAGATGGAATTAGG - Intronic
1124121963 15:26895248-26895270 TATTAATAGGAGAGAGAATCTGG - Intronic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1126063827 15:44809925-44809947 CTGAAATTGGAGATGTAATCTGG + Intergenic
1126600422 15:50422609-50422631 TTTACTTGGGAGTGGGAATCAGG + Intergenic
1126842311 15:52729116-52729138 TTTTAATTGGAAGAGGAATCTGG - Intergenic
1127789030 15:62381825-62381847 TGAAAATTGAAGTGGGAATCAGG - Intergenic
1129907334 15:79197668-79197690 ATTAAATAGGAGAGGGGATGGGG + Intergenic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131674303 15:94655339-94655361 TTAAAAGTGGAGAGAGAAGCTGG + Intergenic
1131676082 15:94672070-94672092 TTTACAGTGGAGAGGGGAGCTGG + Intergenic
1132329557 15:101002743-101002765 TTTTATTTTGAGATGGAATCTGG + Intronic
1135813178 16:25608348-25608370 TTTAACTTGGTGAGGGAGACCGG + Intergenic
1139628090 16:68208045-68208067 TTTATTTTTGAGACGGAATCTGG + Intronic
1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG + Intronic
1142933088 17:3304570-3304592 TTAAAATGGGAGAGTAAATCTGG + Intergenic
1146976119 17:37113508-37113530 TATAAAATGGAAAGGCAATCTGG - Intronic
1147441106 17:40447737-40447759 TTTAAAGTGGGGAGGGCAACAGG + Intronic
1147696668 17:42360208-42360230 TTTAAATTAGAGATGGCGTCTGG + Intronic
1148407758 17:47433657-47433679 TTTAAAATGTAGAAGGAATGAGG - Intronic
1148448574 17:47757548-47757570 TTTAGTTTGGAGTGGGAGTCTGG + Intergenic
1149357658 17:55859459-55859481 TTTAAATTGGGGAGGCAACTTGG + Intergenic
1152067622 17:78120478-78120500 TTTAGATTGGAAAGGAAAACAGG - Intronic
1152208813 17:78991955-78991977 TTTAAAATAGAGATGCAATCAGG - Exonic
1153447842 18:5194371-5194393 CTTAAATTGGACAGGGTATTTGG - Intronic
1155055715 18:22181094-22181116 TCTAAATTGGAGAAGAAACCAGG + Intronic
1155189426 18:23416220-23416242 TTGACATTTGAGAGGGAATGGGG + Intronic
1155891039 18:31269535-31269557 TTTATTTTGAAGAAGGAATCAGG - Intergenic
1156786732 18:40923998-40924020 TTTAGATGGCAGAGGGAATTAGG - Intergenic
1156897555 18:42263628-42263650 TTTCAATTGGAAAGGCAACCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158407999 18:57177643-57177665 TTTTTATAGGAGAGGGAATGTGG + Intergenic
1159658985 18:71070277-71070299 TTAAAGCTGGAGATGGAATCAGG + Intergenic
1160969048 19:1759367-1759389 TTGAAATGGGCGAGGCAATCTGG + Intronic
1161494485 19:4580046-4580068 TTTATTTTGGAGAGGGAATTTGG + Intergenic
1162094643 19:8303126-8303148 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1163520824 19:17790648-17790670 TTTAAAATGAAGAAGGCATCTGG + Intergenic
1163925415 19:20337057-20337079 TTTACGTTGGAGAGGAAAGCAGG + Intergenic
925293735 2:2764622-2764644 AAAAAATTGCAGAGGGAATCTGG + Intergenic
926830550 2:16957612-16957634 TTTAAATATAAGTGGGAATCTGG + Intergenic
928047398 2:27949911-27949933 TTTAAAAAGGAGAGGGCAACAGG - Intronic
928492815 2:31801738-31801760 TTTATTTTTGAGATGGAATCTGG - Intergenic
929330345 2:40674380-40674402 TTTAAATCGGAGAGGGAAAAGGG - Intergenic
929422196 2:41803752-41803774 TCTAAAATGGAGAGATAATCTGG - Intergenic
929876452 2:45800729-45800751 TTAAAATTGGAGAAGGAACTTGG + Intronic
930231953 2:48852305-48852327 TTTAAATTGGAAAGAGATTAAGG + Intergenic
931176252 2:59858010-59858032 TTTTAATTGGAGATGCAATTTGG - Intergenic
931245816 2:60491950-60491972 TTGGAAATTGAGAGGGAATCTGG + Intronic
931301790 2:60987314-60987336 TTTAAATTGGACAGGAATTAAGG - Intronic
933019644 2:77174600-77174622 TTAAGATTGCAGAGGGAATAAGG + Intronic
933343973 2:81060296-81060318 TTTAAATTAGGGAGAGAATCTGG + Intergenic
933900147 2:86843930-86843952 TCTAAATTGAAGAGGGCAACAGG - Intronic
937849966 2:126623278-126623300 TTTAAATTGGAGAGCAACCCTGG - Intergenic
939390597 2:141564293-141564315 TTAAACTTGGAGAGGCAAACTGG + Intronic
939907113 2:147930783-147930805 TTTAACTTGGGGATGGAATGGGG - Exonic
940039116 2:149341347-149341369 TTTACACTGATGAGGGAATCAGG - Intronic
940386015 2:153072654-153072676 GTTAAATTGGAGAGGTAGGCTGG - Intergenic
942257243 2:174115637-174115659 TTGAAGTTGGAGAAGGAAACAGG - Intronic
942620463 2:177839517-177839539 ATGAAACTGGAGAGGGAAGCAGG - Intronic
944215271 2:197248172-197248194 GTCAAATTGGAGAGGGGTTCTGG + Intronic
944368540 2:198954268-198954290 TTTATTTTTGAGATGGAATCTGG + Intergenic
946607889 2:221425664-221425686 TTCCAAATGGAGAGAGAATCAGG + Exonic
948118152 2:235509236-235509258 TTTAAACTTGAGATGGAGTCTGG + Intronic
1170785672 20:19465211-19465233 TTTACATTGGAGATGCCATCAGG + Intronic
1171168845 20:22997562-22997584 CTCAAATTTGAGAGGGCATCAGG - Intergenic
1171727454 20:28638230-28638252 CTTAAAATGGAGATGGAATGTGG + Intergenic
1171750783 20:29046389-29046411 CTTAAAATGGAGATGGAATGTGG - Intergenic
1172133989 20:32675044-32675066 TTCAAATTTGAGAGAGACTCAGG + Intergenic
1173803239 20:45908059-45908081 ATTAGACTGGAGAGGGAATTTGG - Intronic
1174284562 20:49463442-49463464 TTTAAAATGAAGAGTGAAGCAGG - Intronic
1175756616 20:61534298-61534320 TTTGCATTGGGGAGGGTATCGGG + Intronic
1178881032 21:36450220-36450242 TTTTAATTGGAGGGGGATGCAGG - Intergenic
1179034457 21:37747615-37747637 TTTAAGTGGGAGAGGGAGGCAGG + Intronic
1179240065 21:39582028-39582050 TTGAAATTGCAGATGGAATTAGG + Intronic
1180239071 21:46487092-46487114 GTTAAATTGGAGAGGGCCACAGG + Intronic
1180452417 22:15477553-15477575 TTTAAATTTGGGAGGTAGTCTGG + Intergenic
1183041340 22:35180757-35180779 TTTTAATTGTAGTGGCAATCTGG - Intergenic
1183972396 22:41487510-41487532 TTTAAATTGGGGAGGTAGTATGG + Intronic
1184954140 22:47871774-47871796 TTTAAACTGAAGAAGGAATATGG - Intergenic
1185305096 22:50110917-50110939 TTTTAATTGGAGATGGAGTCTGG - Intronic
949656941 3:6231726-6231748 TTGAAATTCGAGATGAAATCCGG + Intergenic
950142266 3:10623517-10623539 TTTAACTTGGGGTGGCAATCAGG + Intronic
953314250 3:41911172-41911194 TTGAAATTGGAGAGTGAAACTGG + Intronic
953401045 3:42617496-42617518 TTTAAATGGGAGAAAGAAACAGG - Intronic
956694719 3:71908436-71908458 TTTTAATTGGACAGGCAATGTGG + Intergenic
957496744 3:81002212-81002234 TTTAAATAAGAGAGGGATCCTGG + Intergenic
958124983 3:89344378-89344400 TTTAAATGGGAGAGAGACTAGGG - Intronic
958191032 3:90185226-90185248 GTTAAATTGGCAAGGGAATGAGG - Intergenic
958903330 3:99914060-99914082 TTTAAATTAGAGAGGGAATTTGG + Intronic
963549622 3:146703041-146703063 TTTAAATTCCATAGGGCATCTGG - Intergenic
964276923 3:155018677-155018699 ATCAAATTGGAGAGAGATTCTGG + Intergenic
965665559 3:171090017-171090039 ATTAAATTCCAGTGGGAATCTGG - Intronic
967668270 3:192200716-192200738 TTAAAATGGGAGAGGGAATGGGG + Intronic
969135247 4:5024022-5024044 TTGAAAATATAGAGGGAATCTGG + Intergenic
971279639 4:25232342-25232364 TTTAAAGCGGAGAAGGCATCAGG + Intronic
972168323 4:36314100-36314122 TTTATATTTGAGAGGCAACCTGG - Intronic
972686707 4:41359951-41359973 TCTACATTGTAGAGGGAATTGGG - Intronic
973041381 4:45474054-45474076 TTTAAATTAGAGAGATAATCTGG - Intergenic
973934823 4:55833804-55833826 TTCAAATTGGAAAGGGAAAAGGG - Intergenic
974318506 4:60313033-60313055 TGTAATTTGGGAAGGGAATCAGG - Intergenic
974875387 4:67697977-67697999 TTGAAATTGGAGAGATAATTGGG - Intronic
975058471 4:69966306-69966328 AATAACTTGAAGAGGGAATCTGG + Intergenic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
976228832 4:82819512-82819534 TTCAGTTTGGAGAGGAAATCGGG - Intronic
976519482 4:86009368-86009390 ATGAAATTGGAGAGAGAAGCAGG - Intergenic
976932782 4:90589190-90589212 TTAAAATTAGAGAGGGTGTCTGG + Intronic
977149611 4:93493981-93494003 TTAAATTTCGGGAGGGAATCTGG - Intronic
978609862 4:110525855-110525877 ATTAATTGGGAGAGGGAAGCAGG + Intronic
980799442 4:137730477-137730499 TTTAAATGGGATAGGGAACAGGG + Intergenic
980854857 4:138427127-138427149 TTTAATTTGCTGAGGGAATGAGG + Intergenic
981820932 4:148886702-148886724 TTCACATTGGACAGGGAATCTGG + Intergenic
982328460 4:154155257-154155279 ATTAAATAGGAGGGGGAATGAGG - Intergenic
982367231 4:154592763-154592785 TTTTAATTGGACATTGAATCAGG - Intergenic
982775522 4:159437726-159437748 ATTAAAATGGACAAGGAATCGGG - Intergenic
984128401 4:175841279-175841301 TTAAAATTGGAAATGGATTCTGG + Intronic
985777641 5:1853063-1853085 TTTAAATGGGAAAGGAAATGGGG - Intergenic
986712486 5:10498142-10498164 TTTATTTTTGAGACGGAATCTGG - Intergenic
989040283 5:37220535-37220557 TTTTAATTTGAGATGGAGTCTGG + Intronic
989304526 5:39938051-39938073 CTTAGATTGGAGAGTGACTCTGG - Intergenic
989713338 5:44428174-44428196 TTCTAGTTGGAGAGGGAACCTGG - Intergenic
990188310 5:53231079-53231101 TTTAAATCAGAGAGGGAAAAGGG + Intergenic
990279238 5:54231945-54231967 TTGAGATTGGAGAGGGAGTATGG - Intronic
990988796 5:61664999-61665021 CTTAGATTGTAGAGGGAATACGG - Intronic
992411440 5:76509688-76509710 TTTAAAAAGGACAAGGAATCTGG - Intronic
992455159 5:76909735-76909757 TTTAAATTAGAGAGGGAGAAGGG - Intronic
993991443 5:94662781-94662803 GTTAAATTAGGGAGGGAATCGGG + Intronic
994007846 5:94861222-94861244 TTTAAATTGTAGTGAGAATTGGG - Intronic
995676083 5:114663883-114663905 TTTTTTTTGGAGATGGAATCTGG - Intergenic
996099272 5:119430605-119430627 TTTAAATCAGAGAGGGAAAGGGG + Intergenic
996464360 5:123782487-123782509 TTGAAATTGGAAAGGAAATCAGG + Intergenic
996570265 5:124926459-124926481 TTTTCTTTTGAGAGGGAATCTGG + Intergenic
998030185 5:138859959-138859981 TTTAAATTGAGAAGGGAGTCTGG - Intronic
998478571 5:142442339-142442361 TTTAAATGGAAGAGGTAATGGGG - Intergenic
999132388 5:149294351-149294373 TTTAAATTGGAGAGGTCGTATGG - Intronic
1001851892 5:174974982-174975004 TTAAAATCTGAGAGGGAATTTGG - Intergenic
1002827859 6:790101-790123 TTTTAATTGGAGAGGGAAAAGGG + Intergenic
1003179364 6:3779017-3779039 TTTAAATGGCAGAGGCCATCAGG - Intergenic
1004008147 6:11655805-11655827 TTTAACTAGGAGAGAGAATGCGG - Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004572388 6:16860098-16860120 TTTGCCTTGGAGTGGGAATCAGG + Intergenic
1005232570 6:23720647-23720669 GTTAAATTGAAGAGGTAAACGGG + Intergenic
1005273730 6:24194079-24194101 TTAAAATGGGAGAGGGGATTAGG + Intronic
1008041304 6:46802030-46802052 TTGAAATTGGAGAGCAAAGCTGG - Intronic
1009756182 6:67942955-67942977 TTTATTTTGGAGATGGAGTCTGG + Intergenic
1010233016 6:73552210-73552232 TTTATTTTTGAGACGGAATCTGG - Intergenic
1012110759 6:95229282-95229304 TTTAAATTGTAAAGGAAACCTGG + Intergenic
1012901095 6:105007460-105007482 TTTAAATTAGCAAAGGAATCTGG - Intronic
1014038014 6:116790511-116790533 TATAAATTATAGAGGGAACCAGG + Intergenic
1014069937 6:117169119-117169141 TTTGAAATGGAGAGGCAATCAGG + Intergenic
1014266612 6:119285151-119285173 TTTAAAGTAGAGACAGAATCTGG + Intronic
1015847868 6:137539827-137539849 TGTAAATTGGACAGGCAATTTGG + Intergenic
1016023190 6:139256969-139256991 GTTAAATTGGAAAGGGGATTTGG + Intronic
1016188454 6:141228752-141228774 TTTAAAGTGGAGAGGGCAAAGGG - Intergenic
1016711605 6:147179492-147179514 TTTAAAGAGATGAGGGAATCTGG - Intergenic
1017088855 6:150740500-150740522 TTTAAATTGGAGGGAAAATATGG - Intronic
1017358461 6:153537827-153537849 TATTAATTGGAGAGGGAAAAGGG - Intergenic
1018211130 6:161483040-161483062 TTTAAGTTTGAGAGTGAATTTGG + Intronic
1019792332 7:3024219-3024241 TATCAGTTGGGGAGGGAATCTGG - Intronic
1021024768 7:15651145-15651167 TTTAAAATTGAGAGGGAGTGGGG + Intronic
1022267089 7:28767605-28767627 TTTAACATGGAGTGGGAATGGGG + Intronic
1024155357 7:46617125-46617147 TTTAGATTGGAGAGGGGAGTAGG - Intergenic
1024417715 7:49126870-49126892 TTAACTTTGTAGAGGGAATCTGG - Intergenic
1024456389 7:49612859-49612881 TTTAAATAGCAGTGGTAATCAGG - Intergenic
1024799920 7:53064994-53065016 TTTAATTTTGAGATGGAGTCTGG + Intergenic
1027172372 7:75881812-75881834 TGTAAACTGCAGAGGGAGTCGGG - Exonic
1027455914 7:78391848-78391870 TTTATATTGCAGTGGGAATCAGG - Intronic
1028451186 7:90985082-90985104 TTTTAATTAGAGAGAGAAACTGG + Intronic
1028766599 7:94566626-94566648 TTTAACTTGGAGGGTGCATCAGG + Intergenic
1028832113 7:95339699-95339721 TTTAAATGAGAGAGGGAAATGGG + Intergenic
1028895803 7:96040220-96040242 TTTAATTTTGAGATGGAGTCTGG - Intronic
1031314704 7:120241341-120241363 TATAGACTGGAGAGGGAAACTGG + Intergenic
1031953219 7:127913762-127913784 GGTAAAGTGGAGAGTGAATCTGG - Intronic
1032056190 7:128686199-128686221 TTTTATTTTGAGACGGAATCTGG - Intronic
1033615728 7:143012429-143012451 TATAAATTGGAGTGGGAAATTGG + Intergenic
1034384729 7:150731012-150731034 ATTAAATTGGAGTGGCAATGAGG - Intronic
1035229559 7:157456330-157456352 TTCAAATTGGAAAGGAAAGCCGG - Intergenic
1036985304 8:13522222-13522244 TTTACAATGGAGAAGAAATCTGG + Intergenic
1037160106 8:15759307-15759329 CTTAAACTGGAGAGGAAGTCAGG - Intronic
1039538310 8:38340107-38340129 TTTAAATTGTAGAAGTAATTTGG - Intronic
1039622904 8:39016251-39016273 TTTAATTTGGAGACAGAAACAGG - Intronic
1041165537 8:55089075-55089097 TTTTAATTTGAGACGGAGTCTGG + Intergenic
1042549491 8:69981643-69981665 TTTAAAATGGATAGAGAACCAGG + Intergenic
1044456679 8:92398651-92398673 TTTAAATCAGAGAGGGAGACAGG + Intergenic
1044901313 8:96948106-96948128 GTTACTTTGGATAGGGAATCTGG + Intronic
1048462416 8:134632587-134632609 TTTAAATTGGAGGGGATATGAGG + Intronic
1049914532 9:304543-304565 TTTAATTTGGAGAGAGAAAGAGG - Intronic
1052211155 9:25905088-25905110 TTTATGCTGGAAAGGGAATCCGG + Intergenic
1053722285 9:40958873-40958895 CTTAAAATGGAGATGGAATGTGG - Intergenic
1054343683 9:63893125-63893147 CTTAAAATGGAGATGGAATGTGG + Intergenic
1055426422 9:76201373-76201395 TGTAAAATGGAGATAGAATCAGG - Intronic
1058574989 9:106391289-106391311 CTCAAAATGGAGAGGAAATCAGG + Intergenic
1059771002 9:117425624-117425646 TTTAAATTGGAGATGGGTTAGGG + Intergenic
1203452890 Un_GL000219v1:137107-137129 CTTAAAATGGAGATGGAATGTGG + Intergenic
1185757711 X:2665115-2665137 TTGAAATTGCAGAGGGGAGCAGG + Intergenic
1186447243 X:9642078-9642100 TTTAAATGTCAGAGGGAAGCAGG + Intronic
1186941297 X:14510477-14510499 TGAAAGGTGGAGAGGGAATCTGG + Intergenic
1188102493 X:26107038-26107060 TTTGAATTGGAGAAGGATTGAGG + Intergenic
1194053253 X:89099731-89099753 TTTTATTTTGAGAGGGAGTCTGG + Intergenic
1194834395 X:98663335-98663357 TTTAAAGTGGAAAGGGACACTGG + Intergenic
1197358213 X:125463910-125463932 TTTAAAGTTGGGAGGCAATCTGG + Intergenic
1197491829 X:127127401-127127423 TTTAAACTGGAGAGGGTAAATGG + Intergenic
1197604867 X:128573863-128573885 TTTAATTTGGAGAGGAATCCTGG - Intergenic
1198481612 X:137046490-137046512 ATTAAAAAGGAGAGGGAATGAGG + Intergenic
1199192757 X:144990605-144990627 TTGAAATTAGAAAGGGTATCTGG - Intergenic
1200861100 Y:7993710-7993732 TTCAAACTTGAGAAGGAATCTGG - Intergenic
1200880859 Y:8210172-8210194 TTTAAATCAGAGAGGGAAAGGGG + Intergenic
1201318989 Y:12676857-12676879 TTAAAATTGGAGAGGCTTTCAGG + Intergenic
1201516034 Y:14819470-14819492 TTTAAATTGGAGAGGGAGAAGGG + Intronic