ID: 1142736356

View in Genome Browser
Species Human (GRCh38)
Location 17:1902669-1902691
Sequence CACGCCCAGCTGATTTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142736353_1142736356 1 Left 1142736353 17:1902645-1902667 CCTCTTGAGTAGCTGGGACTACT 0: 20
1: 2442
2: 51799
3: 175770
4: 228865
Right 1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG No data
1142736349_1142736356 11 Left 1142736349 17:1902635-1902657 CCTGCCTCAGCCTCTTGAGTAGC 0: 3054
1: 87872
2: 186585
3: 212204
4: 141263
Right 1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG No data
1142736351_1142736356 7 Left 1142736351 17:1902639-1902661 CCTCAGCCTCTTGAGTAGCTGGG 0: 4121
1: 105308
2: 210256
3: 237003
4: 149705
Right 1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG No data
1142736348_1142736356 30 Left 1142736348 17:1902616-1902638 CCTGGGTTTAAGTGATTCTCCTG 0: 787
1: 37445
2: 106798
3: 158714
4: 202289
Right 1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142736356 Original CRISPR CACGCCCAGCTGATTTTTTG GGG Intergenic
No off target data available for this crispr