ID: 1142736997

View in Genome Browser
Species Human (GRCh38)
Location 17:1907518-1907540
Sequence GCATGTGCACGTGTGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142736993_1142736997 30 Left 1142736993 17:1907465-1907487 CCGTGTCTGAGGCATGCGTGCAC No data
Right 1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142736997 Original CRISPR GCATGTGCACGTGTGTGCCC TGG Intergenic
No off target data available for this crispr