ID: 1142737077

View in Genome Browser
Species Human (GRCh38)
Location 17:1907872-1907894
Sequence CGGTCTCGCAGCTCTGGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142737077_1142737080 -4 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737080 17:1907891-1907913 ACCGTGACAAATGGCTCTCCAGG No data
1142737077_1142737082 -3 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737082 17:1907892-1907914 CCGTGACAAATGGCTCTCCAGGG No data
1142737077_1142737084 4 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG No data
1142737077_1142737087 23 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737087 17:1907918-1907940 CGGGGTGCAGCCTCCTCTCCTGG No data
1142737077_1142737085 5 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737085 17:1907900-1907922 AATGGCTCTCCAGGGAAACGGGG No data
1142737077_1142737083 3 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737083 17:1907898-1907920 CAAATGGCTCTCCAGGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142737077 Original CRISPR CGGTCTCGCAGCTCTGGCTA CGG (reversed) Intergenic
No off target data available for this crispr