ID: 1142737078

View in Genome Browser
Species Human (GRCh38)
Location 17:1907878-1907900
Sequence TTGTCACGGTCTCGCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142737078_1142737087 17 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737087 17:1907918-1907940 CGGGGTGCAGCCTCCTCTCCTGG No data
1142737078_1142737088 25 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737088 17:1907926-1907948 AGCCTCCTCTCCTGGAAGTCAGG No data
1142737078_1142737084 -2 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG No data
1142737078_1142737082 -9 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737082 17:1907892-1907914 CCGTGACAAATGGCTCTCCAGGG No data
1142737078_1142737080 -10 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737080 17:1907891-1907913 ACCGTGACAAATGGCTCTCCAGG No data
1142737078_1142737083 -3 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737083 17:1907898-1907920 CAAATGGCTCTCCAGGGAAACGG No data
1142737078_1142737091 30 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737091 17:1907931-1907953 CCTCTCCTGGAAGTCAGGAAAGG No data
1142737078_1142737085 -1 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737085 17:1907900-1907922 AATGGCTCTCCAGGGAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142737078 Original CRISPR TTGTCACGGTCTCGCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr