ID: 1142737084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:1907899-1907921 |
| Sequence | AAATGGCTCTCCAGGGAAAC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142737078_1142737084 | -2 | Left | 1142737078 | 17:1907878-1907900 | CCAGAGCTGCGAGACCGTGACAA | No data | ||
| Right | 1142737084 | 17:1907899-1907921 | AAATGGCTCTCCAGGGAAACGGG | No data | ||||
| 1142737077_1142737084 | 4 | Left | 1142737077 | 17:1907872-1907894 | CCGTAGCCAGAGCTGCGAGACCG | No data | ||
| Right | 1142737084 | 17:1907899-1907921 | AAATGGCTCTCCAGGGAAACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142737084 | Original CRISPR | AAATGGCTCTCCAGGGAAAC GGG | Intergenic | ||
| No off target data available for this crispr | |||||