ID: 1142737084

View in Genome Browser
Species Human (GRCh38)
Location 17:1907899-1907921
Sequence AAATGGCTCTCCAGGGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142737078_1142737084 -2 Left 1142737078 17:1907878-1907900 CCAGAGCTGCGAGACCGTGACAA No data
Right 1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG No data
1142737077_1142737084 4 Left 1142737077 17:1907872-1907894 CCGTAGCCAGAGCTGCGAGACCG No data
Right 1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142737084 Original CRISPR AAATGGCTCTCCAGGGAAAC GGG Intergenic
No off target data available for this crispr