ID: 1142737768

View in Genome Browser
Species Human (GRCh38)
Location 17:1912383-1912405
Sequence GGGTGAACAGCATTGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142737765_1142737768 0 Left 1142737765 17:1912360-1912382 CCTGAAGGCAACTTTGGGACAGT No data
Right 1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG No data
1142737761_1142737768 18 Left 1142737761 17:1912342-1912364 CCGTCATTTCTTAGAGCTCCTGA No data
Right 1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142737768 Original CRISPR GGGTGAACAGCATTGCAAGC AGG Intergenic
No off target data available for this crispr