ID: 1142742050

View in Genome Browser
Species Human (GRCh38)
Location 17:1937015-1937037
Sequence GCGCGCGCTCCCTGTGGGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142742050_1142742055 -3 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742055 17:1937035-1937057 CGCGACAACCACAGTCCCAGGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1142742050_1142742059 12 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742059 17:1937050-1937072 CCCAGGGGTTGCCGTTGAGGCGG 0: 1
1: 0
2: 0
3: 14
4: 120
1142742050_1142742054 -4 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742054 17:1937034-1937056 GCGCGACAACCACAGTCCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1142742050_1142742063 24 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742063 17:1937062-1937084 CGTTGAGGCGGAGGAACTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 52
1142742050_1142742061 15 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742061 17:1937053-1937075 AGGGGTTGCCGTTGAGGCGGAGG 0: 1
1: 0
2: 1
3: 11
4: 139
1142742050_1142742064 25 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742064 17:1937063-1937085 GTTGAGGCGGAGGAACTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 98
1142742050_1142742053 -5 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742053 17:1937033-1937055 CGCGCGACAACCACAGTCCCAGG 0: 1
1: 0
2: 0
3: 1
4: 59
1142742050_1142742057 9 Left 1142742050 17:1937015-1937037 CCATTCCCACAGGGAGCGCGCGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1142742057 17:1937047-1937069 AGTCCCAGGGGTTGCCGTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142742050 Original CRISPR GCGCGCGCTCCCTGTGGGAA TGG (reversed) Exonic
905434279 1:37946324-37946346 GCGCACACACCCTGTGGGAGGGG + Exonic
908484350 1:64576019-64576041 GCGTGCGGTCCCCATGGGAACGG - Intronic
916916101 1:169408216-169408238 GCTCGAGCTTCTTGTGGGAAGGG + Intronic
917884053 1:179366105-179366127 GAGAGCGCTGCCTGTGGGGAAGG + Intronic
919924359 1:202184866-202184888 GCACGTTCTCCTTGTGGGAATGG + Intergenic
1068620481 10:59176585-59176607 GCGCGCGCTCCCGGCGGGGAGGG - Exonic
1069430878 10:68332700-68332722 GGGCGCGCTCCCGATGGAAATGG + Intronic
1070547825 10:77466234-77466256 GAGCAAGCTCCCTGTGGGCAGGG + Intronic
1071529279 10:86376915-86376937 GCGCGCGCGGCCTCTGGGGAGGG - Intergenic
1072617355 10:97058775-97058797 GGGCGAGCTCCCTGTAGGAGGGG - Intronic
1078508544 11:11968961-11968983 GAGGGCGCTCTCTGTGGGCAGGG - Intronic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1092014690 12:5149050-5149072 GTGAGCCCTCCCAGTGGGAAAGG - Intergenic
1092022046 12:5210862-5210884 GCGCCCACTGCCTGTGGGCATGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092583833 12:9876353-9876375 GCGCGAGTTCCCTGTGGGTGTGG - Intergenic
1097181652 12:57175202-57175224 AGGGGTGCTCCCTGTGGGAAGGG + Intronic
1101621561 12:106393830-106393852 GGGCTCCCTCCATGTGGGAAGGG - Intronic
1103600456 12:122051279-122051301 GCCCGAGCTGCCCGTGGGAAGGG + Intronic
1103758816 12:123233128-123233150 GCGCGCGCTCCCTCGGGTAACGG - Exonic
1104442699 12:128807437-128807459 TCGTTCCCTCCCTGTGGGAAAGG - Intronic
1104448671 12:128853004-128853026 GCTCCTGTTCCCTGTGGGAAAGG + Intergenic
1113926184 13:113942992-113943014 GCCAGCGCTCCCTGAGGGCAGGG - Intergenic
1117637075 14:57754986-57755008 GCCCGGGCTCCCTTTGAGAAGGG - Intronic
1122337831 14:101005535-101005557 GCGCCTGCTCCCTGGGAGAAGGG - Intergenic
1123545175 15:21332391-21332413 GCACCCCCTCCCCGTGGGAAGGG - Intergenic
1129227958 15:74180759-74180781 GTGCGCCCTCCCACTGGGAATGG - Intronic
1202953521 15_KI270727v1_random:59662-59684 GCACCCCCTCCCCGTGGGAAGGG - Intergenic
1137249221 16:46730331-46730353 GGGCGGGCACCCTGTGGGTATGG - Intronic
1141588332 16:85050028-85050050 GCGCGCCCTCCCTGGGTGACGGG - Intronic
1142233700 16:88911538-88911560 GCGCCCTCTCCCTGCAGGAACGG + Intronic
1142742050 17:1937015-1937037 GCGCGCGCTCCCTGTGGGAATGG - Exonic
1147028308 17:37609022-37609044 GCGCGCGCCCAGTGTGGGAGGGG - Intronic
1160548985 18:79681042-79681064 GCGTGAGCTCCCTCTGGGAAAGG + Intronic
1168288925 19:55347651-55347673 GCCGGGGCTCCCTGTGGGAGTGG - Exonic
925156193 2:1650339-1650361 GCGTGCGCTTGCTGTGGGGAGGG - Intronic
927772701 2:25878000-25878022 GGTTGCGATCCCTGTGGGAATGG - Intronic
933139780 2:78779042-78779064 GCGCGAGCTCCCGGTGGGCGCGG + Intergenic
935396905 2:102619361-102619383 GCGCGCGGTGCCTGCGCGAAGGG + Intergenic
940895794 2:159080985-159081007 CCTCGGGCTCCCTGTGGGAATGG + Intronic
942453881 2:176124684-176124706 CCGCGTGCTCCCTGAGGAAAGGG - Exonic
946144655 2:217720209-217720231 GCAGCCGCTCCCAGTGGGAATGG + Intronic
946578846 2:221104744-221104766 GCGGGCTCTCCCTGTTTGAATGG + Intergenic
1176431441 21:6578757-6578779 GCCCACGCTCTCTGTGGGAGGGG - Intergenic
1176449657 21:6851257-6851279 GCACCCCCTCCCCGTGGGAAGGG + Intergenic
1176827829 21:13716281-13716303 GCACCCCCTCCCCGTGGGAAGGG + Intergenic
1178961773 21:37072793-37072815 GCGTGGCCTCCCTGTGGGAGGGG + Exonic
1179706835 21:43186219-43186241 GCCCACGCTCTCTGTGGGAGGGG - Intergenic
1182997498 22:34827656-34827678 ACCAGAGCTCCCTGTGGGAAGGG - Intergenic
950664516 3:14487149-14487171 GCGGGGGCTCCCTGGGTGAAAGG + Exonic
953255964 3:41290715-41290737 TCATGTGCTCCCTGTGGGAAAGG + Intronic
962575638 3:136752583-136752605 GCGAGCGCTCCGTGTGGGGGCGG - Intergenic
967684860 3:192408095-192408117 ACGGGCGCTCCCTGTGCGAGAGG - Exonic
967948821 3:194824718-194824740 ACGGGCGATCCCTGTGGGCAGGG + Intergenic
969300022 4:6292219-6292241 GCGTGCGCTCCAGGTGGGCAGGG - Intronic
984171778 4:176368345-176368367 GCGCTATCTCCGTGTGGGAAGGG + Intergenic
1000318878 5:160118648-160118670 GCGCGCGCTCCGAGTGGGGCAGG - Intronic
1002087603 5:176785635-176785657 GCCGGGGCTCCCTGGGGGAAGGG - Intergenic
1002140268 5:177133650-177133672 GCGCGCGCTCGGTGGGGGAAGGG + Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002432126 5:179209733-179209755 GCTGGCGCTTCCTCTGGGAACGG - Intronic
1014752305 6:125269295-125269317 GCGGGAGCCCCCTGTGGGCAGGG - Intronic
1015503129 6:133953442-133953464 GCCCGCGCTCCCTGTGCCCAGGG - Intronic
1019102208 6:169640699-169640721 GGGCGTCCTCCCAGTGGGAAGGG + Intronic
1026252835 7:68685727-68685749 GGGCTTCCTCCCTGTGGGAAGGG + Intergenic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1034461393 7:151199777-151199799 GAGCATGCTCCCTGGGGGAAGGG - Intronic
1034979819 7:155468386-155468408 GCGCGCGCTGCCTGCGCGGAAGG + Intergenic
1038644864 8:29352677-29352699 GCGTGGCCTCCCTGTGGGGAGGG + Intergenic
1045111429 8:98941571-98941593 GCGCGCGGTCCGAGTGGGAGAGG + Intronic
1045653909 8:104367500-104367522 GAGCGCGCTCCGGGTGGGAGAGG + Intronic
1049655205 8:143794135-143794157 GCCCCCGCATCCTGTGGGAACGG - Intronic
1055321621 9:75088287-75088309 GCGCGCGCTCCCGATAGGGAAGG - Intergenic
1061975781 9:134067563-134067585 GCGCGCCCTCCCTCACGGAAGGG - Intronic
1062380247 9:136283647-136283669 GCCAGGGCTCCCTGTGGCAATGG - Intronic
1062452429 9:136621232-136621254 GTGCGCCCTCCCCGTGGGAGAGG - Intergenic
1203519528 Un_GL000213v1:33260-33282 GCACCCCCTCCCCGTGGGAAGGG - Intergenic
1185465179 X:350352-350374 ACGTGCGCTCCCTGAAGGAAGGG + Intronic
1200227737 X:154428480-154428502 GCTCACGCTCCGAGTGGGAAAGG - Intergenic