ID: 1142743507

View in Genome Browser
Species Human (GRCh38)
Location 17:1943470-1943492
Sequence CCGTGGGGCTCTCTGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 242}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142743500_1142743507 -9 Left 1142743500 17:1943456-1943478 CCCCCTGGGCAGGGCCGTGGGGC 0: 1
1: 0
2: 2
3: 55
4: 419
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743488_1142743507 13 Left 1142743488 17:1943434-1943456 CCCATGGCTGGTATCCCCGCAGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743501_1142743507 -10 Left 1142743501 17:1943457-1943479 CCCCTGGGCAGGGCCGTGGGGCT 0: 1
1: 0
2: 3
3: 45
4: 387
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743484_1142743507 29 Left 1142743484 17:1943418-1943440 CCTGAGCAGGGCTGGCCCCATGG 0: 1
1: 1
2: 3
3: 42
4: 423
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743489_1142743507 12 Left 1142743489 17:1943435-1943457 CCATGGCTGGTATCCCCGCAGCC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743495_1142743507 -2 Left 1142743495 17:1943449-1943471 CCCGCAGCCCCCTGGGCAGGGCC 0: 1
1: 0
2: 7
3: 96
4: 755
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743496_1142743507 -3 Left 1142743496 17:1943450-1943472 CCGCAGCCCCCTGGGCAGGGCCG 0: 1
1: 0
2: 5
3: 59
4: 587
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743487_1142743507 14 Left 1142743487 17:1943433-1943455 CCCCATGGCTGGTATCCCCGCAG 0: 1
1: 0
2: 2
3: 8
4: 164
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242
1142743494_1142743507 -1 Left 1142743494 17:1943448-1943470 CCCCGCAGCCCCCTGGGCAGGGC 0: 1
1: 1
2: 2
3: 44
4: 473
Right 1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG 0: 1
1: 0
2: 3
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142743507 Original CRISPR CCGTGGGGCTCTCTGGGTCT TGG Intronic
900127014 1:1073210-1073232 GTGTGGGGGTCTCTGGGTCTGGG + Intronic
900168372 1:1254175-1254197 CCGCGTGGCTCCCCGGGTCTCGG - Intronic
900387427 1:2416933-2416955 CCCTGGGGCTCTGGGGCTCTGGG + Intergenic
900540284 1:3199280-3199302 CGGTGGGGGTCTCAGGGCCTGGG + Intronic
900663893 1:3800629-3800651 CCATGGTGCTGTCTGGGTCTGGG + Intergenic
901261343 1:7874232-7874254 CCAAGGGGCTCTCTGTGGCTAGG - Intergenic
901264736 1:7902083-7902105 CTTTGGGGCTCTGTGGCTCTGGG + Intergenic
901530317 1:9848892-9848914 CCATGGGGCTCTCCAGGGCTCGG + Exonic
901636328 1:10671950-10671972 TTGTGGGGCTGTCTAGGTCTGGG - Intronic
901823689 1:11846984-11847006 CCATGGGGCACTCTGGGTGTTGG + Intronic
902098042 1:13962458-13962480 ATGTGGGGCTCTCTGGGGCCAGG + Intergenic
902284438 1:15397803-15397825 CCTTGGAGCTCTCAGGGCCTTGG + Exonic
903132748 1:21290274-21290296 CCGTGGGCCGGTCTCGGTCTCGG - Intronic
903648772 1:24910697-24910719 AGGTGGGGCTCCCTGGTTCTTGG - Intronic
904323719 1:29713258-29713280 CCCTGGAGCCCTCTGGGTCTTGG + Intergenic
905755869 1:40508727-40508749 CCGCGGGGCACTCTGGGACTGGG + Exonic
906390914 1:45415271-45415293 CCATGGGGCACTTTGGGTCTGGG + Intronic
908520578 1:64937270-64937292 CTGTGGAGCTCTCTGGGGGTTGG - Intronic
912838658 1:113019520-113019542 CAGTGGGGCTCTCTGTGTCTGGG - Intergenic
915064934 1:153217180-153217202 CCTGGGGCCTCTCTGGGTCAAGG - Intergenic
915623171 1:157098559-157098581 CTCTGGGGCACTCAGGGTCTAGG + Intronic
918184555 1:182115411-182115433 CTGTGGGTCTCTCTAGGACTGGG - Intergenic
920053794 1:203178773-203178795 CACTGGGGCTCTCTGCGGCTAGG + Intergenic
920386885 1:205575821-205575843 TCTTGGGTCTCTCTGGGCCTTGG + Intronic
924739519 1:246786734-246786756 CCTGGGGCCTCTCCGGGTCTAGG - Intergenic
1067059886 10:43072873-43072895 CTGTGGTCCTCTCTGGGCCTCGG - Intergenic
1067340358 10:45396614-45396636 CAGTGAAGCTATCTGGGTCTGGG - Intronic
1069809126 10:71145498-71145520 AGGTGGGGCTGTCTGGCTCTGGG - Intergenic
1070512165 10:77171339-77171361 CTGTGAGGCTCTTTGGGTCGTGG - Intronic
1070617616 10:77981103-77981125 CCATGGGACTCTCTGGGCTTTGG + Intronic
1070723823 10:78774675-78774697 CCTTTGGGCTTTCTGGGACTTGG - Intergenic
1073030254 10:100519945-100519967 CCGTGGGTCTGTCAGTGTCTCGG - Intronic
1075468787 10:122672414-122672436 TCCTGGTTCTCTCTGGGTCTCGG + Intergenic
1077018719 11:408013-408035 CCCTGGGCCTCACTAGGTCTAGG + Intronic
1077254633 11:1574674-1574696 CCTCGGGGGTCTCTGGGGCTCGG + Intergenic
1077271530 11:1684347-1684369 CTGTGGGCCTCTCGGTGTCTGGG - Intergenic
1077511666 11:2968083-2968105 CTGTGGGGCTGTCTGGCTCATGG - Intronic
1078320585 11:10331095-10331117 CTGTGGGGCTCCCTGGAGCTTGG + Intronic
1079997092 11:27305796-27305818 CTTTGGGGCTCTCTGGTTCCTGG + Intergenic
1080428307 11:32175889-32175911 CTCTGGGCCTCTCTGGGGCTGGG - Intergenic
1080663417 11:34315382-34315404 ACATGGGGCTCTGAGGGTCTGGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084460256 11:69293114-69293136 CCCTGAGGCCCTGTGGGTCTGGG + Intergenic
1084755903 11:71238452-71238474 CAGTTGGCCTCTCTGGGCCTTGG - Intronic
1087406278 11:97734812-97734834 CTGTGAGTCTCTCTGGTTCTGGG - Intergenic
1087442750 11:98207502-98207524 CTGTGGGGCTCCCTGAGCCTGGG - Intergenic
1088577749 11:111287967-111287989 GCGTGGGGCTCTCTGCTCCTGGG + Intergenic
1090425118 11:126602260-126602282 CCTGGGGGCTTTTTGGGTCTTGG + Intronic
1090451451 11:126809927-126809949 TCCTGGGGCTCTGGGGGTCTAGG + Intronic
1090855596 11:130607386-130607408 CCCTGGGGCTTCCTGGATCTGGG + Intergenic
1091633113 12:2177124-2177146 CAGAAGGGCTCTCTGGGTGTTGG - Intronic
1096496503 12:52042155-52042177 CTGGAGGGCTCTCTGGGCCTAGG + Intronic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097750653 12:63348784-63348806 CCCTGGGGCACCCTGGGCCTGGG + Intergenic
1102428830 12:112865611-112865633 CTGTAGGGGTCACTGGGTCTTGG + Intronic
1102793385 12:115667301-115667323 CCTTGGGCCTCTCTGGGCCAAGG - Intergenic
1103719402 12:122965432-122965454 CTGTGGGGGTCCCTGGCTCTGGG + Intronic
1103920438 12:124396637-124396659 GCGAGGGTCTCTCTGGGTCCAGG + Intronic
1104870112 12:131988939-131988961 CCGTGGGGTTCTGAGGGTCAAGG + Intronic
1104908350 12:132227664-132227686 CAGTGGGGCTCTCAGTGCCTGGG - Intronic
1104982758 12:132581604-132581626 CCAAGGGGCTCCCTGGGGCTCGG - Intronic
1107947935 13:45436589-45436611 CCGTGGAGCGCTTTGGGTCCAGG + Intergenic
1111485788 13:88896495-88896517 CCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1121521672 14:94590338-94590360 CCCTGGGGCTGTGTGGGTTTAGG - Intronic
1122271628 14:100570924-100570946 CCGCGGCGCTGCCTGGGTCTTGG + Intronic
1122794671 14:104200164-104200186 CCGTGGGGGTGTCTGGGCCTGGG + Intergenic
1122889246 14:104724872-104724894 CCTGGGGCCTGTCTGGGTCTGGG + Intronic
1122978505 14:105180943-105180965 CCTGGGGGCTCACTGGGTCTGGG + Intronic
1124646778 15:31442538-31442560 CGATGTGGCTCTCTGGGTCCTGG - Intergenic
1125318143 15:38454304-38454326 CCTTGGGCCTCTGTGGGCCTGGG + Intronic
1129183645 15:73892464-73892486 CTTTGGGGCTCTGTGGTTCTTGG + Intergenic
1130427011 15:83811589-83811611 CCCTGAAGCTCTCTGGGCCTTGG + Intronic
1132573149 16:652747-652769 CCCGGGGGCTCTCAGGGTCACGG + Intronic
1133449479 16:5891636-5891658 CCGAGGGAATCTCTGGGTCCTGG + Intergenic
1136541107 16:30928031-30928053 CTGTGGGGCTGTGTGGGCCTGGG + Intronic
1136684174 16:31984347-31984369 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1136784802 16:32927899-32927921 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1136884981 16:33925907-33925929 TCTGGGGGCTCTCAGGGTCTTGG - Intergenic
1138655323 16:58488013-58488035 CCGTGAGGCTGGCTGGGTCTGGG - Intronic
1139269234 16:65666474-65666496 CCATGGGGCTCTCTGAGCCCAGG - Intergenic
1140286270 16:73605763-73605785 ACCTGGGGCTTTCTCGGTCTAGG + Intergenic
1141618128 16:85221713-85221735 AAGTGGGCCTCTCTGGCTCTGGG - Intergenic
1141647505 16:85375527-85375549 GCTTGGGGGTCTCAGGGTCTTGG - Intergenic
1141716172 16:85728406-85728428 CCTTGGGGCTGCCTGGGGCTTGG - Intronic
1141812107 16:86382714-86382736 CCGGGGGGAGCTCTGGGCCTGGG - Intergenic
1142174609 16:88639373-88639395 CCGGAGAGCTCTCTGGGCCTTGG + Intronic
1203087463 16_KI270728v1_random:1191905-1191927 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1142690176 17:1601420-1601442 CCGTGTGCCTCTCTGGCTGTGGG - Intronic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1143512557 17:7404651-7404673 CCTCGGGGCTCTCGCGGTCTCGG - Intergenic
1144967832 17:19089146-19089168 CGGTGGCCCTCTCTGAGTCTTGG + Intergenic
1144980085 17:19162917-19162939 CGGTGGCCCTCTCTGAGTCTTGG - Intergenic
1144988137 17:19215315-19215337 CGGTGGCCCTCTCTGAGTCTTGG + Intergenic
1147145111 17:38480041-38480063 TCTAGGGGCTCTCAGGGTCTCGG + Intronic
1147636581 17:41967713-41967735 AGGTGGGGGTCTCTGTGTCTGGG - Intronic
1147651141 17:42062691-42062713 CCATGGGGGTCTTTGCGTCTGGG - Intronic
1148047603 17:44753625-44753647 CCGCTGGCCTCTCTGGGCCTTGG - Intergenic
1148245317 17:46026362-46026384 CCTTGGGGCTCCCTGTGTCAGGG + Exonic
1150443684 17:65211941-65211963 CTGTGTGGCTCTGTGGATCTTGG + Intronic
1152198008 17:78928777-78928799 GCTTGGGGCCCTCAGGGTCTTGG + Intergenic
1152602968 17:81274384-81274406 CGGTGGGTCTCCCTGGGCCTTGG - Intronic
1152635799 17:81430052-81430074 CGGTGGGCCTCTCTGGGGCTTGG + Intronic
1153378368 18:4407533-4407555 CCTAGGAGCTTTCTGGGTCTCGG + Intronic
1153414476 18:4831486-4831508 ACGTGGGGCTATCTGGCTCTTGG - Intergenic
1153892617 18:9532376-9532398 CAGAGGGGCTCTCTAGATCTTGG + Intronic
1154133868 18:11759616-11759638 CCGTCTGGCTCTCGGGGCCTTGG - Intronic
1154310286 18:13261994-13262016 CCGTGGGGCTCTGTGCGTGGGGG + Intronic
1154310319 18:13262204-13262226 CCGTGTGGCTCTGTGTGCCTGGG + Intronic
1156142731 18:34135733-34135755 CAGTGAGGCTGTCTGGGCCTGGG - Intronic
1157470840 18:47986881-47986903 CTATGGGGCTCTCTGGGTGCAGG - Intergenic
1159494348 18:69181280-69181302 ATGTATGGCTCTCTGGGTCTGGG - Intergenic
1160290062 18:77584168-77584190 CCATGGGGCTCCCTAGGTGTGGG - Intergenic
1160519932 18:79500875-79500897 CAGTAAAGCTCTCTGGGTCTGGG - Intronic
1161109645 19:2462175-2462197 GCGCGGGGCTTTCTGGGACTTGG - Intergenic
1162524946 19:11201652-11201674 CCCTGGGCCACCCTGGGTCTGGG + Intronic
1163526818 19:17826507-17826529 CAGTGGGGCTCTCTGAGTCCTGG - Exonic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1164769712 19:30799252-30799274 CCTTTGGGCTCTCTGTGCCTGGG + Intergenic
1164781589 19:30897353-30897375 CCCTGGGGCACTCTGGGGTTGGG + Intergenic
1165027389 19:32971790-32971812 GCGTGGGGCTCTGTGGGGCCGGG - Intronic
1165093805 19:33399989-33400011 GCTCGGGGCACTCTGGGTCTGGG + Intronic
1165742067 19:38210608-38210630 CCCTGGAGATGTCTGGGTCTGGG + Intergenic
1166919624 19:46220481-46220503 CTTTGGGGCTCTGTGGTTCTTGG - Intergenic
1167092363 19:47353373-47353395 ACGCGGGGCTCTCAGGGACTGGG + Exonic
1167414086 19:49361437-49361459 CTGTGGGTCTCTCCTGGTCTCGG - Exonic
1167489975 19:49786905-49786927 GGGTGGGGCTGTCTGGCTCTAGG + Intronic
926215884 2:10905113-10905135 GTGTGGGGCACTCTGGGCCTGGG + Intergenic
927743082 2:25590119-25590141 CCTTGGGGCTCTGTGGTTCCTGG - Intronic
927936450 2:27079196-27079218 CCGGGGGGCAATCTGGGCCTGGG - Exonic
929561518 2:42959320-42959342 CCTTTGGGCCCTCTGGATCTGGG + Intergenic
930618985 2:53624884-53624906 CAGTGGTGCTATCTGGGACTGGG + Intronic
933855242 2:86407281-86407303 CAGAGTGGCTCTCTGGGCCTGGG - Intergenic
934734510 2:96683035-96683057 CAGTGTGGCTCTCTGGGTGAAGG - Intergenic
935950171 2:108321755-108321777 GCGTGGGTCTCCCTGGGTCTGGG + Intergenic
936049243 2:109210711-109210733 CCGGGGTTCTCTCTGGGTGTAGG + Intronic
937905157 2:127049500-127049522 CAGTGGGTCTGCCTGGGTCTTGG - Intronic
938289199 2:130140518-130140540 AGGTGGGGGTCTCTGGGACTGGG + Intronic
938467327 2:131532420-131532442 AGGTGGGGGTCTCTGGGACTGGG - Intronic
946861547 2:224004270-224004292 CAGTGGGGCCCTCTGTGTCGGGG - Intronic
947740875 2:232484321-232484343 TTGTGGGGCTGTCTGGGTCCTGG - Intronic
948864307 2:240767670-240767692 CCCTGGGGCCCTCTGAGGCTGGG + Intronic
1169427851 20:5510261-5510283 CAGGGGGGCTCTCTGGGACAGGG - Intergenic
1172104307 20:32507044-32507066 CCCTGAGCCTCTCTGGGCCTCGG + Intronic
1175901284 20:62360861-62360883 CTCTGGGGCTCTCTCGGCCTCGG - Intronic
1178930237 21:36811909-36811931 CACTGTGTCTCTCTGGGTCTCGG + Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1179638605 21:42731895-42731917 CCCTGGGGCTCTCTGGGCCTGGG - Exonic
1179875693 21:44266233-44266255 CCTTGGGGCTTTCTGGGGCATGG - Intergenic
1179988746 21:44934892-44934914 CCGTGGAGCTCTTGGGGGCTGGG + Exonic
1180181690 21:46121076-46121098 CCCTGGGGGCCTCTGGGTCCAGG - Exonic
1180231468 21:46429192-46429214 CCTTTGTGCTCTCTGGGGCTGGG + Intronic
1180857708 22:19058854-19058876 CTGTGTGGCTCTCTGGGCCCTGG - Intronic
1180867588 22:19128274-19128296 CTGAGGGTCTCTCTGGTTCTTGG - Intergenic
1181116275 22:20634271-20634293 CTGTGAGGCTCCCTGGGTCTGGG + Intergenic
1181394633 22:22611938-22611960 CAGTGAGGCCCTCTGTGTCTGGG - Intergenic
1181550660 22:23637306-23637328 CTGTGAGGCTCCCAGGGTCTGGG - Intergenic
1181797622 22:25321374-25321396 CTGTGAGGCTCCCTAGGTCTGGG + Intergenic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1183162368 22:36123444-36123466 CCCGGGGTCTGTCTGGGTCTGGG - Intergenic
1183977976 22:41524097-41524119 GCCTGGGGCTCCCTGGGTCATGG + Intronic
1184583234 22:45430842-45430864 CCCTGGGGTTCTTTGGCTCTGGG + Intronic
1185055798 22:48577689-48577711 CCGTGGAGGTCACAGGGTCTCGG - Intronic
950029632 3:9843770-9843792 CCGTTGGCCTCTCTGAGCCTCGG - Intronic
952866459 3:37858464-37858486 CTCTGGGGCTCTCTGGGAATAGG - Intergenic
954672453 3:52298277-52298299 CCATGTGGGTCTATGGGTCTGGG + Intergenic
954865267 3:53723602-53723624 CCCTGGGGATCTCTGTGTTTCGG + Exonic
955360398 3:58269198-58269220 CCCTGGGGATGTATGGGTCTTGG - Intronic
956800320 3:72751941-72751963 ACATGGGGCTTTCTGGGTCCAGG - Intronic
960136778 3:114113645-114113667 CCATAGGGGTCTCTGGATCTGGG - Intergenic
961479988 3:127173425-127173447 CCGGGTGGATGTCTGGGTCTGGG - Intergenic
961773085 3:129264508-129264530 CCATGGGCCACTCTGGGGCTGGG - Intronic
962422957 3:135244118-135244140 CCCAGGTGCTCTCTGGGACTGGG - Intronic
965709853 3:171546202-171546224 CCCTTGGCCTCTCTGGGACTTGG - Intergenic
966912006 3:184564956-184564978 CCTTGTGGCTCTTTGTGTCTGGG + Intronic
967035378 3:185645362-185645384 CCCTGGGGTTCTCAGGGCCTCGG + Exonic
967851671 3:194087235-194087257 CCGAGTGCCTCTCTGGGCCTTGG - Intergenic
968581784 4:1398698-1398720 CTGTGGGGCTGGCTTGGTCTGGG + Intergenic
970344556 4:15140999-15141021 CCGTGTGGCTCTGGGGGCCTTGG - Intergenic
973931189 4:55794217-55794239 CCGCGGCGCGCTCTGCGTCTGGG + Intergenic
979712620 4:123797924-123797946 CAGTGGGGCTACCTGGTTCTGGG + Intergenic
979734242 4:124062914-124062936 CCATGGAGCGCTCTGAGTCTAGG + Intergenic
980849983 4:138369555-138369577 CAGTGGTTCTCTCTGGGTCATGG + Intergenic
982063720 4:151631482-151631504 CAGTGAGGCCATCTGGGTCTGGG - Intronic
983742462 4:171152499-171152521 CATTGGGGCTCACTGGGACTAGG - Intergenic
984411683 4:179405174-179405196 CCTTCTGGCCCTCTGGGTCTAGG - Intergenic
987503646 5:18744107-18744129 CCGTGGGGAGCCCTGGGTATGGG + Intergenic
989102803 5:37837068-37837090 CCGAGGGGCTCTTTCGTTCTCGG + Intronic
992094534 5:73349602-73349624 CCTTGAAGCTCTCTGGGTCTAGG - Intergenic
992758418 5:79930688-79930710 CCATGGGGTGCTCTGGATCTAGG - Intergenic
994956010 5:106533364-106533386 CCATGAAGCTCTCTGGTTCTGGG + Intergenic
998168815 5:139860100-139860122 CCTTGGGGCTCTTGGGGACTGGG - Intronic
999384574 5:151145168-151145190 CCCTGGGGCTCTGTGGGGCTGGG + Intronic
999446627 5:151645593-151645615 CCCTGGTGCTCTCTGGGTCTTGG + Intergenic
1000188795 5:158887977-158887999 CCATGGGGCTCTCTGTTTCCAGG + Intronic
1000631533 5:163596191-163596213 CAGTGTGGCTCTCTGGGGCAAGG + Intergenic
1002567263 5:180119082-180119104 CCCTCGTTCTCTCTGGGTCTGGG + Intronic
1002584064 5:180230429-180230451 CCGTGTCACACTCTGGGTCTAGG - Intergenic
1003569902 6:7248848-7248870 CCGCCGGGCTCTCTGGGTTAAGG - Exonic
1004952615 6:20691252-20691274 CAGTGGTGCCCTCTGGGCCTGGG + Intronic
1006074197 6:31519534-31519556 CCATGGAGCACTTTGGGTCTGGG - Intergenic
1006097262 6:31663965-31663987 CCGTGGGGCTGCCTGGGTGGGGG - Exonic
1007208657 6:40173310-40173332 ACGTGGGGCTCTCTGTACCTCGG - Intergenic
1007627653 6:43255369-43255391 CTGTGGGACTCTGTGGGTGTTGG + Intronic
1008044051 6:46833570-46833592 CTGTGGGCCTCTCTGGTTCAAGG - Intronic
1008187092 6:48407012-48407034 CAATGAGGCTCTCTGGGCCTGGG + Intergenic
1012609547 6:101199234-101199256 CCATGGGGATTTCTGGGGCTGGG + Intergenic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1015635394 6:135269617-135269639 CCATGGGCCTCTCTGGGCCTGGG - Intergenic
1015786202 6:136923035-136923057 CTGGGGAGCTCTCTGGGTCTCGG - Intronic
1017207419 6:151818382-151818404 TCCCAGGGCTCTCTGGGTCTTGG + Intronic
1020762910 7:12290114-12290136 CCTTGGGGCTCTATGGTTGTTGG + Intergenic
1023171016 7:37390476-37390498 CCCTGGGCCTCTGTGCGTCTGGG - Intronic
1025991979 7:66503721-66503743 CTGTGGCGCTCTGTGGGTCTGGG - Intergenic
1026204650 7:68246326-68246348 CCCTGGGGCTCTTTCAGTCTGGG - Intergenic
1027233309 7:76283966-76283988 CGGTGTGCCTCTCTGGGCCTCGG + Intronic
1028709698 7:93892915-93892937 CCATGGGGAGCTCTGGCTCTTGG - Intronic
1032263126 7:130352250-130352272 CAGTAGGGCTCTCTGTGTCTGGG - Intronic
1033028194 7:137798223-137798245 CAGTGGAGCCCTCTGGGTCTGGG - Intronic
1033308310 7:140240703-140240725 GCTTGGAGCTCTCTGGGTCTGGG - Intergenic
1034494250 7:151410415-151410437 CCGAGGGGCTCTCGGGGACTTGG + Intronic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1036116368 8:5964625-5964647 CTGAGGGGCCCTCTGTGTCTGGG + Intergenic
1037754078 8:21700305-21700327 CCCTGGGGCTCTGTGGACCTTGG - Intronic
1037974349 8:23199478-23199500 CCGTGGGGAGCCCTGGGTGTGGG - Intronic
1038029279 8:23622955-23622977 CCGCGCGGCTCCCTGGGGCTAGG - Intergenic
1039499034 8:38002432-38002454 CCTTCGGCCCCTCTGGGTCTAGG + Intergenic
1041568752 8:59311839-59311861 CCCTGGGGCTTGCTGGGTGTGGG + Intergenic
1042684307 8:71421103-71421125 TCATGGGGCTCTCTGAGCCTAGG + Intronic
1046016863 8:108615726-108615748 CCGTGGGGAGCTCTGGATGTGGG + Intronic
1046740049 8:117818360-117818382 CCATGGGGCACTTTGGGTCTTGG - Intronic
1048901028 8:139037958-139037980 CCGCAGGGCTCTCCAGGTCTTGG + Intergenic
1049223184 8:141437057-141437079 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223214 8:141437131-141437153 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223229 8:141437168-141437190 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223274 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG + Intergenic
1049381662 8:142319370-142319392 CCTTGTGTCTCCCTGGGTCTGGG - Intronic
1049604267 8:143521731-143521753 GCCTGGGGCTCTCAGAGTCTGGG + Intronic
1049647341 8:143741410-143741432 TCATGGGGCTCCCTGTGTCTTGG - Intergenic
1053653545 9:40193401-40193423 CTGTGGGCCTCTCTGGTTCGAGG + Intergenic
1053903946 9:42822692-42822714 CTGTGGGCCTCTCTGGTTCGAGG + Intergenic
1054531041 9:66182822-66182844 CTGTGGGCCTCTCTGGTTCGAGG - Intergenic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1057052664 9:91937431-91937453 GCGTCTGGATCTCTGGGTCTGGG - Intronic
1058755336 9:108077981-108078003 CCCTGGGTTTCTCTGGGCCTGGG + Intergenic
1060057482 9:120427201-120427223 CCCTGGGCCACTCTGTGTCTTGG + Intronic
1060300022 9:122369719-122369741 CCCTGGGGCTCTCAGGGTGCCGG - Intergenic
1060339297 9:122759382-122759404 CAGTGGGGCTCTGTGGGCATAGG - Intergenic
1060433703 9:123574337-123574359 CAGGGAGGCTCTCTGGGCCTAGG + Intronic
1061238320 9:129354614-129354636 ACATGGGGCTCCCTGAGTCTCGG - Intergenic
1062285799 9:135771990-135772012 CCCCAGGGCCCTCTGGGTCTTGG - Intronic
1062625352 9:137439923-137439945 CTGGGGGGCTCTCCTGGTCTGGG - Intronic
1062625385 9:137440014-137440036 CTGGGGGGCTCTCCTGGTCTGGG - Intronic
1062625492 9:137440325-137440347 CTGGGGGGCTCTCCTGGTCTGGG - Intronic
1062625539 9:137440454-137440476 CTGGGGGGCTCTCCTGGTCTGGG - Intronic
1062625573 9:137440545-137440567 CTGGGGGGCTCTCCTGGTCTGGG - Intronic
1062669304 9:137697352-137697374 CTGTGGGGGTCTCTGGTTCCAGG + Intronic
1062728751 9:138096621-138096643 CCGTGGTGCTCTGTGGTCCTTGG + Intronic
1187836292 X:23435409-23435431 CTGTGGGCCTGTCTGGGGCTAGG + Intergenic
1188284884 X:28315367-28315389 CCATGGGGCTATGAGGGTCTAGG - Intergenic
1188609001 X:32072459-32072481 CTGTGGGCCCCTCTGGGTTTTGG - Intronic
1188647966 X:32592802-32592824 CCTTGGGGCTCTGTGGTTCCTGG + Intronic
1189013865 X:37076035-37076057 CCCTAGGGCTGTCTGTGTCTGGG - Intergenic
1192201128 X:69067408-69067430 TAGTGAGGCTCTCTGGGCCTTGG - Intergenic
1192440563 X:71170650-71170672 CCGAAGGTCTCTCTGGCTCTAGG + Intronic
1194868241 X:99096149-99096171 CAGTGGGGCTATCAGGCTCTGGG + Intergenic
1197982637 X:132233654-132233676 CAGTGAGGCTATCTGGGCCTAGG + Intergenic
1199601024 X:149541159-149541181 CCGGTGGCCTCGCTGGGTCTCGG + Exonic
1202338991 Y:23840565-23840587 CTTTGGGGCTCAGTGGGTCTCGG + Intergenic
1202531775 Y:25829507-25829529 CTTTGGGGCTCAGTGGGTCTCGG - Intergenic