ID: 1142744369

View in Genome Browser
Species Human (GRCh38)
Location 17:1948347-1948369
Sequence GTTCTGGGGCCCCCAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142744369_1142744378 12 Left 1142744369 17:1948347-1948369 CCCAGGTTTGGGGGCCCCAGAAC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1142744378 17:1948382-1948404 AGCGCAGACTCCAGGGCTGAAGG 0: 1
1: 0
2: 2
3: 19
4: 331
1142744369_1142744379 18 Left 1142744369 17:1948347-1948369 CCCAGGTTTGGGGGCCCCAGAAC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1142744379 17:1948388-1948410 GACTCCAGGGCTGAAGGCCGAGG 0: 1
1: 1
2: 2
3: 32
4: 228
1142744369_1142744376 4 Left 1142744369 17:1948347-1948369 CCCAGGTTTGGGGGCCCCAGAAC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1142744376 17:1948374-1948396 GTTGTGGCAGCGCAGACTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1142744369_1142744380 19 Left 1142744369 17:1948347-1948369 CCCAGGTTTGGGGGCCCCAGAAC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1142744380 17:1948389-1948411 ACTCCAGGGCTGAAGGCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 189
1142744369_1142744377 5 Left 1142744369 17:1948347-1948369 CCCAGGTTTGGGGGCCCCAGAAC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1142744377 17:1948375-1948397 TTGTGGCAGCGCAGACTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142744369 Original CRISPR GTTCTGGGGCCCCCAAACCT GGG (reversed) Intronic
900090111 1:916567-916589 GCTCTGGGGCTCCCACACCTGGG + Intergenic
900294864 1:1943744-1943766 GTTGTGGGGCCCCTAAGCTTGGG - Intronic
900514540 1:3074989-3075011 GCTCTGGGCCCACCAAAGCTTGG - Intronic
902662244 1:17913289-17913311 GTAATGGGGCCCCCAAAACATGG - Intergenic
904407950 1:30305885-30305907 GTTTTGGGGCACTCAAACCCTGG - Intergenic
905494837 1:38376767-38376789 ATTCTGGGGCCTCCAAACCATGG + Intergenic
905668788 1:39778095-39778117 GCTCTGGGGCCCCGAAACACAGG - Intronic
906847868 1:49213918-49213940 TTCCTGTGGCCCCCCAACCTGGG + Intronic
910565522 1:88638598-88638620 CTTCTGGGACCCACAAATCTTGG + Intergenic
912778941 1:112526081-112526103 ACTCTGGTGCCCCCAACCCTGGG - Exonic
917752523 1:178066613-178066635 GATATGGGGCCCCCAACCCCTGG - Intergenic
919768054 1:201140036-201140058 GTTCTGAGGACCCCAGCCCTGGG - Intronic
920417826 1:205810538-205810560 GTCCTGCGGCGCCCAAGCCTGGG - Exonic
922096557 1:222447865-222447887 ATTCTGTGGCCCCCAAATCATGG - Intergenic
923339074 1:232992601-232992623 GTTCTGGGGCCAGCTCACCTGGG + Intronic
1063116140 10:3073361-3073383 GTGCTGGGACCCCCAACCCCAGG + Intronic
1068961296 10:62869279-62869301 GCTCTGTAGCCCCCAAAGCTGGG + Intronic
1069593036 10:69653608-69653630 CCTTTGGGGACCCCAAACCTGGG + Intergenic
1073498547 10:103916065-103916087 GACCTGGGGCCCCCAACCCCTGG - Intronic
1074377783 10:112952713-112952735 GCCCTGGGGCCCCCAAAGTTGGG - Intronic
1075578233 10:123596478-123596500 GTTCTGGGGCCCTCAGACGAGGG - Intergenic
1078909602 11:15718635-15718657 GCTCTGGGCCCCCCAGAGCTGGG - Intergenic
1079272165 11:18999177-18999199 GTTCTGAGCCACCTAAACCTGGG + Intergenic
1083621393 11:64051128-64051150 GGTCAGGGGGCCTCAAACCTGGG - Intronic
1083743715 11:64723769-64723791 GTTCTGGGGGCTCCAAGCCAGGG - Intergenic
1084675747 11:70633012-70633034 GTCCTGGGATCCCCAGACCTGGG + Intronic
1085088476 11:73689497-73689519 GGTCAGGGGTCCCCAACCCTTGG - Intronic
1085248577 11:75125549-75125571 GGTCTTGGGCTACCAAACCTAGG - Intronic
1085381971 11:76128087-76128109 GCACTGGGGTCCCCAACCCTCGG + Intronic
1086326150 11:85702141-85702163 ATTCTTGGGCCCGTAAACCTTGG + Intronic
1088367906 11:109058319-109058341 TTCCAGGGGGCCCCAAACCTGGG + Intergenic
1090863937 11:130678612-130678634 GTTATGGGGTCACCAAATCTAGG - Intronic
1090974807 11:131671870-131671892 GGTTTGGGGGCTCCAAACCTTGG + Intronic
1092383678 12:8019067-8019089 GTTTTGGGGCCCACCACCCTTGG + Intergenic
1104310848 12:127653262-127653284 TTTGTGAGACCCCCAAACCTAGG - Intergenic
1104661190 12:130612490-130612512 GGGCTGGGGACCCCCAACCTGGG - Intronic
1105336276 13:19473074-19473096 GTTCTGAGGCACCTAAAGCTTGG + Intronic
1106985505 13:35343491-35343513 GTTCAGGGGTCCCCAATCCCTGG + Intronic
1108344525 13:49531644-49531666 GGTCAGGGGTCCCCAACCCTCGG - Intergenic
1108710642 13:53029036-53029058 ATTCTGGGGCCTCCTCACCTGGG - Exonic
1111597361 13:90428436-90428458 CTTTTGGGGACCCCAGACCTAGG + Intergenic
1112562787 13:100528888-100528910 GTTCTCGGTCCCCCACACCTAGG - Intronic
1112734877 13:102405052-102405074 GTTCTGGGGCCTCCAGATCATGG + Intergenic
1114072547 14:19126362-19126384 GTTCTGAGGCACCTAAAGCTGGG + Intergenic
1117602487 14:57390330-57390352 GTTGAGGCGCCCCCAAACCGAGG + Intergenic
1118015104 14:61652597-61652619 GTTGTGTAGCCCCCAAACTTTGG + Intronic
1119029744 14:71182769-71182791 GTCTTGGGGCCCACACACCTGGG + Intergenic
1121328092 14:93033535-93033557 GTCCTGGGGCCCTCACTCCTGGG - Intronic
1122318017 14:100837048-100837070 GTTCTGGGGCGCCTAAGGCTGGG + Intergenic
1122807013 14:104264872-104264894 GTTCTGGGCCTCCCCAGCCTTGG + Intergenic
1126230194 15:46314857-46314879 AGTGTGTGGCCCCCAAACCTTGG - Intergenic
1127196574 15:56592035-56592057 GTTCTGAGCCACCTAAACCTGGG - Intergenic
1130342673 15:83012431-83012453 GTTCCTTGGGCCCCAAACCTGGG - Intergenic
1132114615 15:99126319-99126341 GCTCTGGGGCCCTCTAGCCTGGG + Intronic
1132585647 16:704953-704975 CTTCTGAGGCCCTCCAACCTTGG + Intronic
1132763642 16:1523731-1523753 GTGCTCGGGCCCCCAGGCCTCGG - Intronic
1132892428 16:2210792-2210814 GTGCTGAGCGCCCCAAACCTGGG - Exonic
1133125792 16:3645246-3645268 TTTCTGTGGCCCCCTAGCCTTGG + Intronic
1135693477 16:24565395-24565417 GGTCAGGGGTCCCCAACCCTGGG + Intronic
1136355831 16:29744480-29744502 CTTCTGGGGGCCCCAGCCCTGGG - Exonic
1138490428 16:57373104-57373126 GTCCTGGGCCCCCTAATCCTGGG - Intronic
1138506173 16:57479388-57479410 GTCCTCGGGCCCCCATCCCTTGG + Intronic
1139740797 16:69033498-69033520 GCTCTGGGTCCCCCAGAGCTTGG - Intronic
1141634599 16:85307371-85307393 GTCCTGGGGCCCCCTGAGCTAGG - Intergenic
1142744369 17:1948347-1948369 GTTCTGGGGCCCCCAAACCTGGG - Intronic
1143106889 17:4534559-4534581 ATGCTGGGGCACCCAAACCCGGG - Intronic
1144079396 17:11748642-11748664 ATTCAGAGGCCCCCAACCCTGGG + Intronic
1145062004 17:19739452-19739474 GTCCTGGGGCCCACAGACCTGGG - Intronic
1145325011 17:21815558-21815580 GGTCTGTGGCCCCCACACCCAGG - Intergenic
1147317255 17:39626910-39626932 GGGCTGGGGACCCCAAAGCTGGG + Exonic
1148194681 17:45704819-45704841 GTCCTGGGACTCCCAAACTTGGG + Intergenic
1148231998 17:45941870-45941892 GTTCTTGGGGCCCAGAACCTAGG + Intronic
1148848735 17:50543956-50543978 CTTCTGCTGCACCCAAACCTGGG + Intronic
1151846330 17:76658467-76658489 GATCTGGGGCCTCCTCACCTTGG + Intergenic
1152032943 17:77854974-77854996 GTTCTGTGGCCCCAGAACCCTGG + Intergenic
1157533618 18:48442488-48442510 GTGCTGGTGCCCCAAAACCTAGG + Intergenic
1157753713 18:50199752-50199774 GGTCTGGCCCCCCCAAACCAGGG + Intergenic
1158468715 18:57714531-57714553 GTTCTGGGCCACCCAGAGCTAGG - Intronic
1164234711 19:23322215-23322237 TCTCTGGGGCTCTCAAACCTAGG + Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1167497441 19:49827880-49827902 GGGCTGGGGACCCCAAGCCTAGG - Intronic
927089826 2:19701852-19701874 GATCTGGAGCCCCCATGCCTGGG + Intergenic
927864552 2:26580313-26580335 GGCCTGGGGCCCCGAAACATAGG - Intergenic
928090966 2:28374872-28374894 GGTCGGGGGCACCCAAGCCTGGG + Intergenic
929453525 2:42051355-42051377 ATCCTGGGGCCCCCAGGCCTTGG + Intronic
930243296 2:48957987-48958009 GATCTGGGGGCCCCACACCATGG + Intergenic
931434506 2:62235151-62235173 TTTCTGGGGCTCCCATACCCTGG + Intergenic
931733755 2:65176282-65176304 CTTCTGGGGAGCCCAGACCTAGG - Intergenic
931837166 2:66111231-66111253 CCTCTGGGGCCCCCACACCCCGG + Intergenic
933074655 2:77907807-77907829 GATCAGGGGCCCCCAACCCCTGG + Intergenic
935182076 2:100700489-100700511 GGTCTGGGTACCCCACACCTAGG - Intergenic
935777978 2:106488646-106488668 GTTCTGGGGTCCCACAAGCTGGG + Intergenic
937014300 2:118589428-118589450 GATCAGGGGCCCCCAACCCTGGG - Intergenic
938652830 2:133401436-133401458 GTTCTGGGCCTCCCACACATAGG - Intronic
938954105 2:136282752-136282774 GGTCTGGGGCCACCAAACTGGGG - Intergenic
948794949 2:240397727-240397749 GGTCTGGAGCCTCCAGACCTGGG - Intergenic
948942889 2:241204807-241204829 TACCTGGGGCCCCCAAGCCTGGG + Intronic
1169309411 20:4522225-4522247 CTTCTTGGGAGCCCAAACCTAGG + Intergenic
1172175731 20:32970800-32970822 GATCTGGGGCCAGCAAGCCTGGG + Intergenic
1175171127 20:57082267-57082289 CTTCAGGGTCCCCCAAATCTGGG - Intergenic
1176135361 20:63520075-63520097 GCTCTGGGCTCCCCAAACATGGG + Intergenic
1176264870 20:64203846-64203868 GGGCTGGTGCCCCCATACCTGGG - Intronic
1176737273 21:10562013-10562035 GTTCTGAGGCACCTAAAGCTTGG - Intronic
1179889020 21:44326545-44326567 GGTCTGGGGTCCCCATCCCTCGG - Intronic
1179990708 21:44946986-44947008 GGGCTGGGGCCCCCAGACCAGGG - Intronic
1180563277 22:16639564-16639586 GTTCTGAGGCACCTAAAGCTTGG - Intergenic
1181619925 22:24084000-24084022 CTGCTGTGGACCCCAAACCTAGG + Intronic
1182083967 22:27548658-27548680 ATCCTGGGGCCCCCAGCCCTGGG + Intergenic
1183531851 22:38360580-38360602 GTTCTGAGGCACCTAAAGCTTGG + Intronic
1184525248 22:45018993-45019015 GTTTTGGGGATCCCAGACCTGGG - Intergenic
1184564132 22:45281577-45281599 GTTCTGGTACCACCAATCCTAGG - Intergenic
1184564407 22:45283587-45283609 GTTCTGGTACCACCAATCCTAGG + Intergenic
1184687235 22:46102197-46102219 GATCTGGTGGCCCCACACCTTGG - Intronic
1184751591 22:46489430-46489452 GGTTTGGGGCCCCCAAGCTTGGG - Intronic
950417115 3:12875095-12875117 GTTCTGGGGCCCCCACTACATGG - Intergenic
950972164 3:17200277-17200299 GTTCAGGGGTCCCCAAACCCCGG + Intronic
951847829 3:27103593-27103615 GTTCTGGGGGCCACACACCTAGG + Intergenic
953603131 3:44387411-44387433 GGTCTGGGCTCCCCAAACCAGGG + Intronic
957112117 3:75975943-75975965 GTTCTATGGCCCCAAATCCTTGG - Intronic
959372734 3:105548733-105548755 GCTCTGGGCTCCTCAAACCTAGG + Intronic
963489063 3:145975889-145975911 GTTCTGTGGCCCCCAAAAATGGG + Intergenic
967216469 3:187214890-187214912 GTCCTGGGGCTGCCCAACCTGGG + Intergenic
968579032 4:1381163-1381185 CCTCTGGAGCCCCCAAACCCAGG - Intronic
968903754 4:3442620-3442642 ATACTGGGGCCCCCAGATCTCGG - Intronic
969519642 4:7668495-7668517 GCTCTGGGCCCTCCAAACCCAGG + Intronic
973239521 4:47942569-47942591 GATCTGGGGTCCCCAACCCCCGG + Intronic
974237853 4:59205447-59205469 GTTCTGGCACCCCCAAGCCCAGG - Intergenic
974280578 4:59786396-59786418 GTTCTGGAGTCCCCTAATCTTGG + Intergenic
979878914 4:125929263-125929285 TTTCTGGGCCACCTAAACCTGGG - Intergenic
979929340 4:126611191-126611213 TTTCTGGGGAAACCAAACCTAGG + Intergenic
981504274 4:145482349-145482371 GTTCCCGGGCCCCCGAGCCTCGG + Intronic
982678541 4:158403223-158403245 GAGCAGGGGCCCCCAAACCTGGG + Intronic
983208017 4:164931515-164931537 GTACAGGGGTCCCCAAACCCTGG - Intergenic
986142124 5:5040706-5040728 GTTTTGCCTCCCCCAAACCTGGG - Intergenic
986260792 5:6144424-6144446 TTTCTGGGGCAGCCATACCTTGG + Intergenic
987018836 5:13848900-13848922 GAGCAGGGGTCCCCAAACCTCGG - Intronic
990192745 5:53278706-53278728 CTTCAGGAGCCACCAAACCTTGG - Intergenic
991180482 5:63746140-63746162 GTTCTGAGCCCCCTAAAGCTGGG + Intergenic
997042723 5:130277392-130277414 CCTCTGGGGACCCCAGACCTAGG - Intergenic
997408392 5:133670519-133670541 TTGCTGGGGCCCCCAACTCTGGG - Intergenic
997642548 5:135458839-135458861 GTCCAGGAGCCCCAAAACCTAGG - Intergenic
998850861 5:146349416-146349438 GTTTTGGGGGCTCCTAACCTGGG - Intergenic
999263938 5:150254333-150254355 GCTGTGTGGCCCCCCAACCTAGG - Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1000410365 5:160930816-160930838 ATTCTGGGGCCCACACACCTGGG - Intergenic
1002053159 5:176583465-176583487 GTTATGTGACCCACAAACCTGGG + Intronic
1005439417 6:25849723-25849745 TTTCTGGGATCCCCAAACTTAGG - Intronic
1006188651 6:32194605-32194627 GGTCAGGGGTCCCCAACCCTTGG - Intronic
1006440058 6:34048392-34048414 GTTCTGAGGCCAACACACCTCGG + Intronic
1006485544 6:34338058-34338080 GTTCTGGTGCCCTCAGGCCTAGG + Intronic
1006832795 6:36978649-36978671 GTTCAGGGGCACCCACTCCTGGG + Intronic
1013769649 6:113613564-113613586 GTTCTGTGGCCCCCACACAGAGG - Intergenic
1015464893 6:133537925-133537947 GTTCTGGGGCCACCTAATATAGG + Intergenic
1016629016 6:146205985-146206007 GTTCTGGGACCTTTAAACCTAGG + Intronic
1016919010 6:149272871-149272893 GTGCAGGGGTCCCCAACCCTGGG + Intronic
1017484174 6:154887899-154887921 GTTCTGGAGTCCCCAGAGCTGGG + Intronic
1017622014 6:156308964-156308986 GTAATGGGGGCCCCACACCTAGG - Intergenic
1019146484 6:169978589-169978611 GCTCTGGGGCCACCTTACCTGGG - Intergenic
1019712433 7:2523780-2523802 GTACTGGGGGCCCCTGACCTGGG + Intronic
1020443997 7:8249170-8249192 GTTCTGTGCCCCTCAAACCCTGG - Intronic
1022061224 7:26797335-26797357 GTTCTGAGCCCCCTAAAGCTGGG - Intronic
1022164825 7:27747982-27748004 GTTATAGGACCCCAAAACCTAGG + Intronic
1022627702 7:32054958-32054980 CTTCTAGGGCCCCCCAAACTGGG + Intronic
1023734993 7:43226871-43226893 GTTCTGGAGCCCCCACACGCAGG - Intronic
1027803522 7:82785434-82785456 GTACAGGGGTCCCCAACCCTAGG - Intronic
1028339145 7:89695824-89695846 GTTCTGAGTCACCTAAACCTAGG - Intergenic
1030090736 7:105855935-105855957 GTTCTGAGACCCCAAATCCTTGG - Intronic
1033533709 7:142292155-142292177 GTTGTTGGGACCCCAAGCCTGGG - Intergenic
1034263867 7:149772416-149772438 GTCCTCCGGCCCCCAAGCCTGGG + Intronic
1034518365 7:151599814-151599836 GGTCAGGGGTCCCCAATCCTGGG - Intronic
1036503778 8:9336875-9336897 GTTCTGGGGTGCCCTAAGCTTGG - Intergenic
1036769309 8:11567643-11567665 GGTCTGGGGTTCCCAGACCTGGG - Intergenic
1040878440 8:52177077-52177099 CTGCTGGGGACCCCACACCTGGG + Intronic
1044894568 8:96877804-96877826 GTTCTGGGGTCACTTAACCTAGG - Intronic
1052919305 9:33951069-33951091 GTTCTGTGGCCCTCCAGCCTGGG - Intronic
1054719064 9:68585441-68585463 TTTCAGGGGTCCCCAACCCTCGG + Intergenic
1055261254 9:74436617-74436639 GTTCTGAGGCTTCCAAAGCTGGG - Intergenic
1056293741 9:85170594-85170616 GTTCAGGAGCCACCCAACCTGGG - Intergenic
1057717313 9:97504715-97504737 GCTCTGGGGCCTCATAACCTTGG + Intronic
1057882004 9:98799553-98799575 GTTCTGGAGGCCCCAAAGCCAGG + Intergenic
1058159584 9:101553688-101553710 TTTCTGTGGCCCCCAACCCTGGG - Intronic
1058801272 9:108546665-108546687 GTTCTTGGACCTCAAAACCTTGG + Intergenic
1059799056 9:117731043-117731065 GGTCAGGGGCCCCCAATTCTGGG + Intergenic
1060519685 9:124287210-124287232 GACCTGGGGGCCCCAATCCTGGG - Intronic
1060803743 9:126562127-126562149 GCTCTGGAGCCCACACACCTGGG - Intergenic
1060812657 9:126618864-126618886 GGTCTCGGGTCGCCAAACCTGGG - Intronic
1061378369 9:130239533-130239555 GTCCTGGGGCCCCCACCCCCTGG - Intergenic
1061615205 9:131774709-131774731 GCCCTGGGGCCCCCAAACCCTGG - Intergenic
1062332025 9:136049081-136049103 GTCCTGGGCCCCACAAACCCAGG - Intronic
1062384293 9:136303008-136303030 CTGCTGGGGCCCCAACACCTGGG + Exonic
1186123471 X:6387381-6387403 ATCCTGGAGCCCCAAAACCTGGG + Intergenic
1199678464 X:150207418-150207440 AATCTGTAGCCCCCAAACCTTGG - Intergenic
1200175081 X:154108594-154108616 TCTCTGTGGCCCCCCAACCTCGG - Intergenic
1202595543 Y:26535316-26535338 GTTCTGAGGCACCTAAAGCTTGG - Intergenic