ID: 1142752769

View in Genome Browser
Species Human (GRCh38)
Location 17:1998428-1998450
Sequence CTCGCGGGAGCCGCCGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142752756_1142752769 16 Left 1142752756 17:1998389-1998411 CCGCGCGGGGAGCCGCGGCCGCG 0: 1
1: 0
2: 2
3: 51
4: 293
Right 1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG 0: 1
1: 0
2: 2
3: 13
4: 196
1142752760_1142752769 -2 Left 1142752760 17:1998407-1998429 CCGCGCTGGGATCCGTTCCCTCT 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG 0: 1
1: 0
2: 2
3: 13
4: 196
1142752759_1142752769 4 Left 1142752759 17:1998401-1998423 CCGCGGCCGCGCTGGGATCCGTT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG 0: 1
1: 0
2: 2
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142752769 Original CRISPR CTCGCGGGAGCCGCCGGCCG GGG Intronic
900113908 1:1020622-1020644 CGCGCGGCAGCCGCAGTCCGTGG - Intronic
900165308 1:1242141-1242163 CTTGGGGGAGCAGCAGGCCGTGG - Intergenic
900189984 1:1349227-1349249 CGCGCGGGAGCCGGGGGCGGCGG - Intronic
900376455 1:2357044-2357066 CTCACAGCAGCCGCCGGCCATGG - Intronic
900397660 1:2459819-2459841 CACGCAGGACCGGCCGGCCGTGG + Intronic
900957473 1:5895641-5895663 CTCTCGGGTGCCGCTGCCCGGGG - Intronic
901551385 1:9997948-9997970 CTCGTGGGAGGCGGCGGTCGGGG - Intronic
902262304 1:15235842-15235864 CTCAAGTGAGCCGCCGGCCTCGG + Intergenic
904006649 1:27366528-27366550 CTGGCAGGACCCGCTGGCCGTGG - Exonic
904769061 1:32870898-32870920 CGCGCGGGAGTCGCTGTCCGCGG - Intronic
904822782 1:33256313-33256335 CTCGCGGGAGCCCCCGGGGCCGG + Intergenic
905202305 1:36323140-36323162 CTCCCGGGAGCCGCGGGCCCAGG + Intronic
905580782 1:39081651-39081673 CTCCCGGCAGCCGGCGGCCGCGG + Intronic
909547771 1:76867521-76867543 CGCGCGGGAGCCGCGGGACCCGG - Exonic
911208655 1:95117661-95117683 CGCGGGGGAGCCGCGGGGCGAGG - Intronic
914889705 1:151612084-151612106 CGCGCCCGATCCGCCGGCCGCGG - Exonic
915519900 1:156436112-156436134 CTTTTGGGAGCCTCCGGCCGCGG + Intergenic
919640633 1:200041103-200041125 CTCTCCGGAGCTGCCGGCTGAGG - Intronic
920066535 1:203273487-203273509 CTCCCGGCAGCGGCCGGCAGAGG + Intronic
920184534 1:204151894-204151916 CTCGCCGGACCCCCCCGCCGGGG - Exonic
921127505 1:212190386-212190408 CTGGCGGGAGGCGCGGGCCAGGG - Intergenic
921922349 1:220683912-220683934 CTCGGGTGATCCGCCCGCCGTGG - Intergenic
922306979 1:224352738-224352760 CCCGCGGGCCCCGCCGGCCCTGG - Intergenic
922581776 1:226703546-226703568 CGCGCGGAAGCCCGCGGCCGGGG + Intronic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
924732494 1:246724550-246724572 CTCCCGGGAGCGGCCCGCCACGG - Exonic
1066370377 10:34814724-34814746 CTCGCGGGCGCCCCCCGCCCCGG - Intronic
1068714821 10:60176526-60176548 CTCGGGTGATCCGCCGGCCTCGG - Intronic
1068861080 10:61848866-61848888 CTCGCGTGATCCGCCCGCCTTGG + Intergenic
1069090823 10:64197036-64197058 CTGGCGGGCGCCACCGGCCCGGG - Intergenic
1071309502 10:84328971-84328993 CCCTCGCGAGCCGCCGGACGCGG + Intronic
1073123128 10:101133902-101133924 CTCGCGGGAGCCCGGGGCCAGGG + Intronic
1078934300 11:15938452-15938474 CTAGCGGAAGCCCCTGGCCGAGG - Intergenic
1078986659 11:16605061-16605083 CCCGCGGGAGCGGCCGGGCTCGG + Intronic
1079005542 11:16789107-16789129 CTCCAGGGAGCGGCCGGCTGAGG + Exonic
1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG + Intergenic
1081672845 11:44951041-44951063 CTCCCGGGGGCCGCCTGCAGGGG + Intronic
1081699967 11:45146776-45146798 TCCGCGGGGGCCGCCAGCCGAGG + Intronic
1081831985 11:46121720-46121742 GTCCCGGGAGCCGCGGGCCGAGG - Intergenic
1082807305 11:57459328-57459350 CTCGCGGGAGCGGCAGCCCAGGG + Intergenic
1083657080 11:64234807-64234829 CCCGCCGGGGCCGCCCGCCGGGG - Exonic
1084642471 11:70434107-70434129 CACACGGGAGCTGGCGGCCGGGG - Intronic
1085719871 11:78903324-78903346 CTCCTGGGCGCCGCCGGCAGGGG + Exonic
1088252375 11:107872150-107872172 CTCACGTGATCCGCCGGCCTTGG - Intronic
1089293341 11:117451588-117451610 CTCGGGGGATCCGCCCGCCTTGG - Intronic
1089537376 11:119169007-119169029 GTTCCGGGAGCCGTCGGCCGCGG - Exonic
1089543611 11:119206130-119206152 CTCGGGGAAGCGGCCGGCCGCGG - Exonic
1090190292 11:124762386-124762408 CGCGCGGGGTCCGCCGCCCGGGG + Intergenic
1095581579 12:43806293-43806315 CTTCCTGGGGCCGCCGGCCGGGG - Intronic
1097251075 12:57632614-57632636 CTGGCGGGCGCCCCCGGCGGAGG + Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1103595527 12:122022479-122022501 CTCCCGGGAGCCGAGCGCCGCGG - Intronic
1104836832 12:131797272-131797294 GCCGCGGGGGCCGCGGGCCGGGG - Exonic
1106187846 13:27424734-27424756 CGCCCTGGATCCGCCGGCCGTGG + Exonic
1110436464 13:75482105-75482127 AGCGCTGGAGCCGGCGGCCGCGG - Exonic
1114558473 14:23575852-23575874 CTCGCGGGAGCCGTCGGGGCGGG + Exonic
1116152137 14:41154502-41154524 CCGGCCGGAGCCGCCGGCCCGGG - Intergenic
1119759563 14:77141206-77141228 TTCGCCGGAGCCCCAGGCCGAGG - Intronic
1122275230 14:100587490-100587512 CTCCCGGCAGCGCCCGGCCGGGG + Intergenic
1122579670 14:102763593-102763615 CCCTCGTGATCCGCCGGCCGTGG + Intergenic
1202843097 14_GL000009v2_random:142052-142074 CTCGGGTGAGCCACCGGCCTTGG + Intergenic
1123676042 15:22710961-22710983 CTCGGGTGACCCGCCGGCCTCGG + Intergenic
1123722228 15:23069569-23069591 CTCGGGTGATCCGCCGGCCTCGG + Intergenic
1124328243 15:28784875-28784897 CTCGGGTGATCCGCCGGCCTCGG + Intergenic
1124999281 15:34754366-34754388 CTCCCGGGGGCCGCCCGACGGGG + Intronic
1125752238 15:42036772-42036794 CTGGCGGGAGCCGGGAGCCGGGG + Intronic
1126738156 15:51751925-51751947 CGGGCGGGAGGCGCCCGCCGGGG + Intronic
1130002612 15:80060054-80060076 CGCGCGGGCGCCCGCGGCCGGGG + Intronic
1131367816 15:91854240-91854262 GCCGGGGGAGCTGCCGGCCGGGG + Intronic
1132854364 16:2038272-2038294 CGCGCGGCAGCCGCGGGGCGAGG + Exonic
1134849863 16:17470872-17470894 CGAGCGGCAGCCGGCGGCCGCGG - Exonic
1136428365 16:30183787-30183809 CGCGTGGGAGCCGCGGGCTGCGG + Intronic
1138178720 16:54928828-54928850 CCCGCGCGCGCCGCCCGCCGGGG - Intergenic
1140079994 16:71736826-71736848 CTCGTGGGATCCGCCTGCCTCGG + Intronic
1141839981 16:86568072-86568094 GTCGGGGGAGCCGGCGGGCGTGG - Exonic
1142166909 16:88596080-88596102 CTCTCGGGAGCCACCTGCCCGGG - Intronic
1142240327 16:88941771-88941793 CTCGCAGCAGTCGGCGGCCGCGG + Intronic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142812161 17:2400487-2400509 CCCGCGAGAGCCGCCGCCTGGGG - Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145084197 17:19922477-19922499 CTCAAGTGAGCCGCCTGCCGAGG + Intronic
1146012123 17:29204522-29204544 CTTCCTGGAGCCGCCGGCCGGGG - Intergenic
1148759755 17:49993630-49993652 GTCGCAGGAGTCGCAGGCCGAGG - Intronic
1148936235 17:51166410-51166432 CACCCGGGAGCCGGCGGCGGAGG - Intronic
1151237546 17:72732246-72732268 CTCGAGGGATCCGCCCGCCTCGG + Intronic
1151707668 17:75779303-75779325 CTCGCGGCAGCAGATGGCCGAGG + Intronic
1152252070 17:79217538-79217560 CTCGAGGGAGCTGCAGGCAGAGG + Intronic
1152362729 17:79839916-79839938 CGCGCGGGCCCCGCCGGCAGGGG + Intergenic
1152628130 17:81397586-81397608 GGCTCGGGAGGCGCCGGCCGGGG + Intronic
1153872597 18:9334665-9334687 CTGGCGGGAGCTGGCGGCTGTGG + Intergenic
1154325466 18:13387656-13387678 GTCGAGGAAGCCGCCGGGCGAGG - Exonic
1155258033 18:24015100-24015122 CTCCCGGGGGCCGCAGGTCGAGG - Intronic
1156275798 18:35581722-35581744 GCCGGGGGAGCCGCCGGCAGTGG + Intronic
1160237826 18:77099785-77099807 CTGGGGGGAGCCGCCAGCTGGGG + Intronic
1160453755 18:78981253-78981275 AGCCCGGGCGCCGCCGGCCGAGG - Intronic
1160768840 19:821563-821585 GCCGCGGGCGCCGCAGGCCGTGG + Exonic
1160830995 19:1104788-1104810 CTCGCGGCCGCCGCCTGCCCCGG - Intronic
1160864370 19:1250545-1250567 CCCGAGGGGGCGGCCGGCCGGGG - Intronic
1161301025 19:3543396-3543418 CTCGCGGAAGGGGCTGGCCGGGG - Exonic
1162396519 19:10420654-10420676 CCCGCGGGTGCGCCCGGCCGCGG - Exonic
1162773614 19:12965506-12965528 GTCCCGGGAGCCGCCGCCAGAGG + Intronic
1162954120 19:14089108-14089130 CTGGCGGGTGCCGCTGCCCGGGG + Exonic
1163663003 19:18589572-18589594 CTCGCGGGAGGTGCTGGCGGTGG + Exonic
1164992106 19:32692059-32692081 GTCGCGCCCGCCGCCGGCCGAGG + Exonic
1165720493 19:38075545-38075567 CTCGAGGGATCCGCCAGCCTCGG - Intronic
1166762669 19:45234675-45234697 CTGGCGGGGGCCGCCGGGCGCGG - Intronic
1166840361 19:45693329-45693351 CTCGCGGGTGACGGCGCCCGGGG + Intronic
1167417733 19:49385890-49385912 CTCGGGTGAGCCGCCTGCCTTGG - Intergenic
1168076322 19:53982535-53982557 CTGGCGGGGGCCGGCGGCGGCGG + Exonic
1168112315 19:54200374-54200396 CTCGAGAGAGCCTCCCGCCGTGG - Intergenic
924988292 2:289514-289536 CGCGAGGGACCCGCGGGCCGAGG - Intergenic
927357069 2:22186440-22186462 CCCGCGGGCCCCGCCGGCCCCGG + Intergenic
929452827 2:42048166-42048188 CGCGCGGGGCCGGCCGGCCGGGG + Exonic
934167748 2:89310317-89310339 CTCGGGTGATCCGCCTGCCGCGG - Intergenic
934199537 2:89872266-89872288 CTCGGGTGATCCGCCTGCCGCGG + Intergenic
936713607 2:115161418-115161440 ACCGCGGAAGCCGGCGGCCGTGG + Intronic
942278600 2:174340557-174340579 CTCCCGGGAGCGGCGGGCGGCGG + Intergenic
948647289 2:239413785-239413807 CTCGCGTGATCCGCCTGCCTCGG + Intergenic
948934052 2:241150715-241150737 CTCGGGGGAGCCCCGGCCCGGGG + Intronic
1169212276 20:3773335-3773357 CTCGAGTGAGCCGCCCGCCTCGG - Intergenic
1173221878 20:41137930-41137952 GTCGCTGGGGCGGCCGGCCGGGG - Intronic
1175141053 20:56860340-56860362 CTCTGGGCAGCCTCCGGCCGTGG - Intergenic
1175715661 20:61252938-61252960 CGCCCGGGAGCCGCGCGCCGCGG + Intronic
1175953406 20:62595899-62595921 CTCTCGGGAGCAGGCGGCCTCGG - Intergenic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1178442783 21:32612293-32612315 CCCGCGGGTCCTGCCGGCCGAGG + Exonic
1178746334 21:35254089-35254111 CTGGAGGGAGCTGCCGGCCACGG + Intronic
1180087840 21:45516023-45516045 CCCGCGGCAGCCCCCGGCCCAGG - Exonic
1183400447 22:37600680-37600702 CTCGAGTGAGCCGCCCGCCTTGG - Intergenic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
1184412115 22:44331544-44331566 CCCGCGGGAGCCGCCTGCTGGGG + Intergenic
1184673435 22:46027678-46027700 CTCGCGGGCCCAGCTGGCCGGGG - Intergenic
1184766865 22:46576843-46576865 CGCGCGGCCGCCGCCGGCCACGG - Intronic
1185062417 22:48613953-48613975 CTCGCAGGGGCCGCGAGCCGGGG - Intronic
1185110350 22:48897047-48897069 CTCCCGGGAGCCGCCGTGGGAGG - Intergenic
1185336338 22:50272270-50272292 CTGGAGGGAGCCGCCGGTGGAGG + Intergenic
1185349549 22:50327294-50327316 CTCGCGGGAGCCTCGGGGCCAGG + Intergenic
1185394077 22:50578055-50578077 CTGGCGGGGGGCGCGGGCCGGGG - Intronic
1185420540 22:50732042-50732064 CCCGCGGGACCAGCCGGCCTGGG + Intergenic
949987529 3:9552713-9552735 CTGGCGGGGGCCGCCGGCCCGGG + Exonic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
951017017 3:17742573-17742595 CTCGCGGAAGCGGCCGGGCCCGG + Intronic
951558612 3:23945208-23945230 GTCGCCGCAGCGGCCGGCCGAGG + Intronic
954277914 3:49554541-49554563 CGCCCGGGAGCCGCCGGCCCGGG + Exonic
955462126 3:59194912-59194934 CTCGGGTGATCCGCCGGCCTCGG - Intergenic
956080159 3:65549139-65549161 CTGGCTGGAGCCTCCGGGCGCGG + Intronic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
961182379 3:124887040-124887062 TCCGCGGGGGCCGGCGGCCGGGG + Exonic
961858278 3:129893763-129893785 TGCGCGTGCGCCGCCGGCCGGGG - Intergenic
962788955 3:138793370-138793392 CTCGCGGGATCCGCCCCCCTCGG - Intronic
965615128 3:170585617-170585639 CTCGCGGGAGCTGCCGGGCGGGG - Intronic
966919363 3:184602017-184602039 CTCCCCGAAGCCGCCAGCCGCGG - Intronic
967858541 3:194135198-194135220 CCCGCGGGCGCCGGGGGCCGAGG + Intergenic
967916733 3:194583941-194583963 CTCGCGGGAGGCGGTGGCTGCGG + Intergenic
968674769 4:1871504-1871526 CTCCGGAGAGCCGCCCGCCGAGG + Intronic
968835920 4:2964036-2964058 CTCGCAGAATCCGCCGGCGGCGG + Exonic
969394091 4:6909632-6909654 CTTCCGGGGGCCGCCCGCCGCGG - Intronic
969619019 4:8269728-8269750 GGCGCGGGACCCGCCGCCCGCGG + Intergenic
972793862 4:42397799-42397821 CCTGCGGGAGGCGCCGGCAGAGG - Intergenic
974299263 4:60042480-60042502 CCAGCTGGAGCCGCCGGCCCAGG - Intergenic
980053945 4:128062044-128062066 GCTGCGGGATCCGCCGGCCGAGG + Intronic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
984167596 4:176320574-176320596 CGCGCGGGAGGCGCCAGCCCAGG - Intronic
985895485 5:2748313-2748335 CTCCCGGGCGCCGCCGGCCGCGG + Intronic
986330545 5:6713733-6713755 AGCGCCGGAGCCGCCCGCCGCGG + Intergenic
992269824 5:75053161-75053183 CCCGCGGCAGCCGCCGCCTGCGG - Intergenic
994768647 5:103954075-103954097 CGGGCGGGCGCCGCCGGCCTGGG - Intergenic
995106390 5:108381543-108381565 CTCCGGGGCGCCGCCGGCTGAGG + Exonic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
1005554180 6:26956622-26956644 CGCGCGGGAGCCCGCGGCTGGGG + Intergenic
1006016401 6:31084658-31084680 CTCACGTGATCCGCCGGCCTCGG + Intergenic
1006834143 6:36986408-36986430 GTGGCGGCAGCCGCAGGCCGGGG + Intergenic
1011751233 6:90457238-90457260 CTCACGTGATCCGCCCGCCGTGG - Intergenic
1014230101 6:118893978-118894000 CGCGCGGAGGCCGCCGGCGGCGG - Intronic
1016010654 6:139135149-139135171 CGCGCGGGCGCCGCGGGCCCGGG - Exonic
1018848101 6:167569154-167569176 CTCTGGGAAGCCGCCGGCCACGG + Intergenic
1019422571 7:957918-957940 CTCTCGGGAGCCCCCTGCCCAGG - Intronic
1019765072 7:2844096-2844118 CTCGCGGGCCCCGCCGGCCTCGG + Exonic
1025082057 7:55992389-55992411 CTCGAGGGAGCCTCCTGCCCCGG - Intronic
1029348723 7:99997672-99997694 GTGGCGGGTGCCGGCGGCCGAGG - Intergenic
1032240133 7:130153706-130153728 CTCCAGGGAGGCGCCGGCCTCGG + Intergenic
1033220397 7:139523643-139523665 CGCGCGGGAGCCGGGAGCCGTGG - Intergenic
1034344655 7:150379076-150379098 AGCGCGCTAGCCGCCGGCCGCGG - Intronic
1034659860 7:152759783-152759805 CTCGCGGGAGACGCTGCGCGCGG + Exonic
1035404182 7:158587564-158587586 GCCCCGGGAGCTGCCGGCCGCGG + Exonic
1037825214 8:22156557-22156579 CTCCCTGGGGCCGGCGGCCGCGG + Exonic
1039543042 8:38386973-38386995 CGCGCCGAAGCCGCCGGGCGAGG + Intronic
1040065311 8:43140339-43140361 CGCCCGGGAGCCGCGGGCGGGGG - Intergenic
1041588357 8:59547196-59547218 CTGGCGGGCGCCGCCAGCCCTGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049230790 8:141480172-141480194 CTCGCTGCAGCCGCAGGCAGAGG - Intergenic
1049673080 8:143878285-143878307 CCCGCTGGAGCCGCACGCCGAGG - Intronic
1049682232 8:143924535-143924557 CTCGCGGAACCGGCCGGCCTCGG + Exonic
1049697433 8:143990866-143990888 CACCCGGGAGACGCCGGCAGCGG + Intronic
1053230027 9:36400648-36400670 CTCGCCAGATCCGCCGTCCGCGG + Intronic
1053393474 9:37752207-37752229 CTCTCGGGAGCCCACGGCGGGGG - Intronic
1057773250 9:97984730-97984752 CTGGCGGGAGCCGCGCGCCGCGG + Intronic
1060228026 9:121808046-121808068 CTCGCGGGCTCTGCGGGCCGTGG + Intergenic
1060825030 9:126683043-126683065 CTGTCGGGAGCCCCCAGCCGGGG - Intronic
1061128211 9:128689742-128689764 CGCGCGGGGGGCGCCGGGCGGGG + Intronic
1061613268 9:131762663-131762685 CTCCTGGGAGGCGCCGGGCGGGG - Intergenic
1061840849 9:133357780-133357802 CTCGCTGGTACCGCCGGCCCTGG - Exonic
1061968646 9:134031253-134031275 GTCGGGGGAGCGGCCGGCTGTGG - Exonic
1203780702 EBV:99260-99282 GGCGCGGGAGCCGGCGGCCTCGG - Intergenic
1185701905 X:2236953-2236975 CTCGAGTGAGCCGCCTGCCTCGG - Intronic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1189324531 X:40104884-40104906 CTCGGGCGAGCCGCCTGGCGCGG + Intronic
1189398953 X:40647357-40647379 CTCGCCGCAGCCCCCGGCCTGGG - Exonic
1196828490 X:119758804-119758826 CTCCCGGGAGGCGGCGGCTGCGG - Exonic
1199832902 X:151562738-151562760 CGCACAGGAGCCGACGGCCGGGG + Intergenic
1200058767 X:153474782-153474804 CTCGCGGGAGGTGGCGGGCGGGG + Intronic
1200138579 X:153886368-153886390 CTGGCGGGACCCGTCGGCTGGGG - Intronic