ID: 1142753279

View in Genome Browser
Species Human (GRCh38)
Location 17:2000897-2000919
Sequence TCCCACCATCCCTCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142753279_1142753286 27 Left 1142753279 17:2000897-2000919 CCCCTCTTGGAGGGATGGTGGGA 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1142753286 17:2000947-2000969 CAGGCCTTTGTGAGCTGTGGAGG 0: 1
1: 6
2: 113
3: 3708
4: 2296
1142753279_1142753285 24 Left 1142753279 17:2000897-2000919 CCCCTCTTGGAGGGATGGTGGGA 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1142753285 17:2000944-2000966 TCGCAGGCCTTTGTGAGCTGTGG 0: 1
1: 0
2: 0
3: 39
4: 546
1142753279_1142753284 8 Left 1142753279 17:2000897-2000919 CCCCTCTTGGAGGGATGGTGGGA 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1142753284 17:2000928-2000950 TGGAAACAGCTGTGGCTCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 176
1142753279_1142753287 28 Left 1142753279 17:2000897-2000919 CCCCTCTTGGAGGGATGGTGGGA 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1142753287 17:2000948-2000970 AGGCCTTTGTGAGCTGTGGAGGG 0: 1
1: 0
2: 10
3: 324
4: 4052
1142753279_1142753283 0 Left 1142753279 17:2000897-2000919 CCCCTCTTGGAGGGATGGTGGGA 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1142753283 17:2000920-2000942 ATACTGCATGGAAACAGCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142753279 Original CRISPR TCCCACCATCCCTCCAAGAG GGG (reversed) Intronic
900945963 1:5831571-5831593 TGACACCATCCCTCGGAGAGAGG + Intergenic
901261435 1:7874656-7874678 CCCCACCATCCCCCCAGCAGCGG + Intergenic
901684351 1:10935320-10935342 TCCCACCAACCCTCCCTGGGAGG + Intergenic
903335426 1:22621292-22621314 TCCCACCATCCAGCAAACAGTGG - Intergenic
904498532 1:30901155-30901177 TCCCACCAGCCCCTCAAGAGTGG + Intronic
907294634 1:53442435-53442457 TCCCACCAGGCCTCCAACACTGG - Intergenic
912529707 1:110311548-110311570 ACCCACCATCCCTCCTGGAGAGG + Intergenic
913583545 1:120250545-120250567 TACCACCATCCCTAGCAGAGAGG - Intergenic
913624631 1:120647775-120647797 TACCACCATCCCTAGCAGAGAGG + Intergenic
914158178 1:145105618-145105640 TCGCACCATTGCACCAAGAGTGG + Intronic
914255505 1:145958987-145959009 TCCCCCCATCTCTCCTACAGTGG + Intergenic
914447868 1:147765410-147765432 TTCCATCTCCCCTCCAAGAGTGG + Intronic
914565533 1:148862381-148862403 TACCACCATCCCTAGCAGAGAGG - Intronic
914607292 1:149267871-149267893 TACCACCATCCCTAGCAGAGAGG + Intergenic
915128549 1:153681714-153681736 TCCCAGCATCCTTCCACGACGGG + Exonic
915727181 1:158026026-158026048 TCCCACCACCCCACCAGGACTGG - Intronic
915868193 1:159528446-159528468 TCCCACCCTCCCTCTAGGAGGGG + Intergenic
917104431 1:171478206-171478228 CCCCACCATCCCTGCAAATGTGG + Intergenic
917271528 1:173280234-173280256 TCCCTCCAGCCCCTCAAGAGAGG + Intergenic
921238132 1:213151885-213151907 CCCCAACCTCCCTCCAAGACGGG + Intronic
1062800407 10:375025-375047 TCCTTCCATATCTCCAAGAGAGG - Intronic
1066628975 10:37439958-37439980 TCTCACCATCCCTCCCACAAAGG - Intergenic
1067698729 10:48553598-48553620 TCCCAACATCCCTCTAAGATAGG - Intronic
1069299555 10:66889421-66889443 TGCCAACATCCCTACCAGAGTGG - Intronic
1069594729 10:69663221-69663243 CCCCACCCTCCAGCCAAGAGAGG - Intergenic
1070164566 10:73887966-73887988 TCCCACCCGCCAGCCAAGAGAGG + Intergenic
1072271236 10:93779365-93779387 TCCCTCCTTCCTTCCAAGACAGG - Intronic
1072427863 10:95345203-95345225 CCCCAGCTTCCCTGCAAGAGAGG + Intronic
1073653526 10:105387377-105387399 TCCCGCCATACATCAAAGAGTGG - Intergenic
1075195994 10:120359539-120359561 TCCCACCAACCTTCAAACAGAGG + Intergenic
1075549630 10:123382670-123382692 TCCCACCAGGCCTCCAACACTGG + Intergenic
1076994806 11:292692-292714 GCCCACCATTCCTGCAAGTGTGG + Intronic
1077378884 11:2218751-2218773 TCTCACCCTCCCGCCATGAGTGG - Intergenic
1077616764 11:3681043-3681065 TCCCACCATCCGCCCCAGACAGG + Intronic
1079330338 11:19527835-19527857 TCCCACCAGCACTCCTACAGAGG + Intronic
1079740473 11:24052874-24052896 TCCTACCATCCTTCAGAGAGTGG + Intergenic
1082992510 11:59220262-59220284 TTCCACAATCCCTCAAAGTGTGG + Intergenic
1083186223 11:61019431-61019453 TCCTTCCATCTCTCCAAGGGAGG - Exonic
1083196294 11:61090619-61090641 TCCCAACATCCCTTCAAGGCAGG + Intergenic
1083776557 11:64896912-64896934 CCCCACAATCCCTCCATGTGTGG - Intronic
1086497990 11:87423610-87423632 TCTCACCTTCCCTCCAAGCTTGG + Intergenic
1087548410 11:99614403-99614425 TCCCACCATCCCTCCACTCGTGG - Intronic
1089300785 11:117497623-117497645 TCCCTCCTTCCCTCCAGCAGCGG + Intronic
1092525083 12:9304970-9304992 TGCCACCATCCCTGCCAGACAGG + Intergenic
1092542184 12:9426848-9426870 TGCCACCATCCCTGCCAGACAGG - Intergenic
1093910793 12:24744551-24744573 TCCCACCATTGCTTCAAGAATGG - Intergenic
1094384248 12:29876661-29876683 TCCCAACTTCACTGCAAGAGAGG + Intergenic
1095691949 12:45099828-45099850 TCCCACCATCCCTTAAGGATTGG + Intergenic
1100774961 12:97963695-97963717 TACCAGTATCTCTCCAAGAGTGG - Intergenic
1101130458 12:101685760-101685782 TCCCACCAGGCCCCCAAGTGTGG + Exonic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103443718 12:120980673-120980695 CCCCACCATCCCACCAAAGGGGG - Intronic
1103731188 12:123028865-123028887 TCACACCAGCCCTGCAGGAGGGG + Intronic
1104109472 12:125691079-125691101 TCCCTCCATCCTGCAAAGAGGGG - Intergenic
1104152616 12:126098140-126098162 TTCCACCCACCCTCCCAGAGTGG + Intergenic
1108082618 13:46752418-46752440 TCCCCCCATCTTCCCAAGAGTGG - Intronic
1109144714 13:58764853-58764875 TTTCACCATCCCTCCAAAATGGG + Intergenic
1111828337 13:93296594-93296616 TCCCACCTTCCCTACTACAGTGG + Intronic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1116386244 14:44334063-44334085 TCCCACCATTCCTACATCAGAGG + Intergenic
1119175312 14:72564244-72564266 TTCCACTGTACCTCCAAGAGAGG - Intronic
1120796941 14:88644573-88644595 TCACACCATCCCTCCCAGAGAGG + Intronic
1121016301 14:90551381-90551403 GCCCACCAGGCCTCTAAGAGTGG + Intronic
1121697312 14:95924350-95924372 TGCAACCATCCCTGCCAGAGAGG - Intergenic
1122604163 14:102937505-102937527 TCCCTCCCTCCCTCCAAGGATGG + Intronic
1123962964 15:25425763-25425785 CCCCACCATCCCTCAAATATTGG - Intronic
1125717193 15:41826056-41826078 TCCCATTCTCCCTCCAAGAGGGG + Exonic
1125731783 15:41896517-41896539 TCCCACCCTCACTTCAAGTGAGG - Exonic
1127059271 15:55165474-55165496 TCCCAACAGCCCTACCAGAGAGG + Intergenic
1128710333 15:69866828-69866850 TACCTCCATCCATCCAAGATAGG - Intergenic
1129369078 15:75076712-75076734 TCCCAACATTGCTCCAAGATTGG + Intronic
1130734887 15:86537540-86537562 GCCAGCCATCCCTCCATGAGTGG - Intronic
1131922342 15:97342386-97342408 TCCCACCTGCCAACCAAGAGTGG + Intergenic
1132390812 15:101436978-101437000 TCCCACAGTCCCTCAAGGAGTGG + Intronic
1133219170 16:4311568-4311590 GACCATCCTCCCTCCAAGAGGGG + Intergenic
1133581809 16:7151756-7151778 TCCTACCATCACCCCAAGATGGG - Intronic
1136135647 16:28255446-28255468 AACCACCATCCCTCTAGGAGGGG + Intergenic
1137479477 16:48839838-48839860 CCCCATCATCCCCTCAAGAGAGG - Intergenic
1137954931 16:52819679-52819701 TCCCACCTTCCCTCCAGGAGAGG - Intergenic
1138214586 16:55191940-55191962 TCCCTCCCACCCTCCAGGAGAGG - Intergenic
1140680093 16:77376345-77376367 TCCCACCCTTCCTCCAACACTGG + Intronic
1142753279 17:2000897-2000919 TCCCACCATCCCTCCAAGAGGGG - Intronic
1143519804 17:7438676-7438698 TCTAACCAGCCCCCCAAGAGAGG - Intronic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1144379657 17:14681840-14681862 TGCTGCCTTCCCTCCAAGAGGGG + Intergenic
1144623842 17:16834460-16834482 TCCCACCATGCCTGCAGGTGAGG + Intergenic
1144882587 17:18438256-18438278 TCCCACCATGCCTGCAGGCGGGG - Intergenic
1145149647 17:20506130-20506152 TCCCACCATGCCTGCAGGCGGGG + Intergenic
1147157534 17:38551811-38551833 TACGACCATCCTTCCTAGAGTGG - Intronic
1147578134 17:41614164-41614186 TCCCACCATGCCTGCAGGCGGGG + Intronic
1148430800 17:47641968-47641990 TCCCAGCAACCCTCCAAAATAGG - Intergenic
1149451796 17:56755475-56755497 TCCCAACATCCCTGCCAGAGAGG + Intergenic
1152226818 17:79096620-79096642 TCCCACCCTCCCTCCCGGCGGGG + Intronic
1152892907 17:82892525-82892547 TCCCTCCTTCCCACCAGGAGAGG - Intronic
1156519887 18:37713364-37713386 TCTCACCAAGCCTCCACGAGGGG + Intergenic
1159174500 18:64815370-64815392 GCACAACATCCCTCCATGAGAGG - Intergenic
1162121729 19:8474155-8474177 CCCCTCCATTCCTGCAAGAGAGG - Exonic
1163321948 19:16579960-16579982 GCTCACCATCCCTTCCAGAGTGG + Intronic
1164130934 19:22361281-22361303 TCCCCCCACCCCTCCCACAGTGG - Intergenic
1166531428 19:43545787-43545809 TCCCCCCATCCCTCCTGAAGTGG - Intronic
1166994964 19:46715950-46715972 CCCCACCATCCCTTTGAGAGAGG - Intronic
925458437 2:4039724-4039746 TCCCCCCACCCCTCCCACAGTGG + Intergenic
926355282 2:12035797-12035819 TCCCACCTTCCTACCAAGTGAGG + Intergenic
927513226 2:23657670-23657692 TCCCAACCTCCCTCCCAGAGAGG - Intronic
928167867 2:28983846-28983868 TACCACCATCCCACAAAGATGGG - Intronic
928406735 2:31020651-31020673 ACACACCTTCCCTCCCAGAGGGG - Intronic
931242509 2:60466136-60466158 TCCCACCTTCCCACAAAGGGAGG - Intronic
932023941 2:68115071-68115093 TCCCACCATCCCTCCACCCCAGG + Intergenic
937287538 2:120762726-120762748 TCCCACCATCCCACCATGAAAGG + Intronic
940629457 2:156219605-156219627 TCCCCCCATCCCTCAAATAATGG + Intergenic
941954044 2:171186389-171186411 CCCAAACATCCCTCCAAGGGAGG - Intronic
944939779 2:204610987-204611009 TCATACCATCCCTCCAGCAGCGG + Intronic
945115514 2:206404581-206404603 TCCCACCTTCCCACCATAAGAGG - Intergenic
948225776 2:236308321-236308343 TCCTGCCAGCCCTCCAAGGGGGG - Intergenic
1168896974 20:1330544-1330566 TCACACCATTCCTCCAGGTGGGG + Intronic
1170342317 20:15342977-15342999 TTACAACATCCCTCCAAGGGAGG - Intronic
1172233566 20:33353729-33353751 CCCCACCATCCTTCAAAGAAAGG + Intergenic
1173025606 20:39304963-39304985 TCCCAACAACACTCCAAGATGGG - Intergenic
1173847908 20:46199625-46199647 TCCCAACCCCACTCCAAGAGAGG + Intronic
1176885888 21:14255563-14255585 TCCCGCCATCCACCCAAGACAGG + Intergenic
1182678824 22:32062316-32062338 TCCCACCAACCTTCCAGGATAGG + Intronic
1184818605 22:46891676-46891698 TCCCACCATCACCCCAAGGCCGG - Intronic
949538453 3:5013567-5013589 TCCCTCCCTCCCTCCATAAGTGG + Intergenic
952901609 3:38115111-38115133 TCCCACCTTCCCTCCCAGCCTGG - Intronic
953904629 3:46862276-46862298 TCCCAGCAGCCCTGCAAGAGGGG + Intronic
954330836 3:49889496-49889518 TGCCGCCATCCCTCCAGGAATGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954394799 3:50287852-50287874 TGCCACCACCCCCCTAAGAGTGG + Exonic
954408040 3:50356271-50356293 TCCCACCTGCCCTCAAAGTGGGG - Intronic
955873222 3:63461824-63461846 TCCCAACATACCTGCAAGATGGG - Intronic
961012294 3:123444521-123444543 AAACACCATCCCACCAAGAGGGG + Intronic
961531724 3:127544231-127544253 GCCCAGCATCCCTCCAGGACTGG - Intergenic
961791210 3:129378178-129378200 CCCCAACATTCCTCCAAGATTGG + Intergenic
963188874 3:142447470-142447492 TTCCCCCATCCCACCCAGAGCGG - Intronic
965604481 3:170485016-170485038 TCCCGCCCTTCCTCCAGGAGTGG - Intronic
969314416 4:6372867-6372889 GCCCACCAGCCCTGCAAGAGAGG + Intronic
969520592 4:7675727-7675749 TCCATCCATCCGTCCAACAGTGG - Intronic
970202610 4:13625410-13625432 TCCCTCCTTCCCTCCAAAAAAGG + Intronic
971427024 4:26526058-26526080 TGCCAGCAACCCTCCAAGACAGG + Intergenic
973609833 4:52625224-52625246 TCCCACCAACCCTCCAAGATGGG + Intronic
974674756 4:65076004-65076026 TCCCACCAGCCCTCCCACTGAGG + Intergenic
975556602 4:75672404-75672426 TCCCCCCATCCCAACAAAAGCGG + Intronic
976737282 4:88323505-88323527 TCCCACAATCCTTCATAGAGAGG - Intergenic
976967590 4:91063804-91063826 TCTCAGCATCCTTACAAGAGTGG + Intronic
979683487 4:123486056-123486078 TCCCTCCATGCCACCAGGAGAGG + Intergenic
981759729 4:148181035-148181057 TCCCCCTTTCCCTCCTAGAGTGG - Intronic
985929818 5:3048197-3048219 TCCCACCATCCTTTCAACAGTGG - Intergenic
986664575 5:10089298-10089320 TCCCACCCACACTCAAAGAGAGG + Intergenic
986679579 5:10221111-10221133 TGGCACCATCCCTCCATGGGGGG - Intergenic
988877270 5:35460471-35460493 TCACACCAGCCCTGCAAGACAGG - Intergenic
994259135 5:97635970-97635992 TCCCATTATCCCAGCAAGAGGGG - Intergenic
1000852733 5:166360371-166360393 TTCTACAATCCTTCCAAGAGTGG - Intergenic
1001379361 5:171293448-171293470 CCCCTCCCTCTCTCCAAGAGGGG + Intronic
1002512229 5:179728678-179728700 TCCCTCCTCCCCTGCAAGAGTGG + Exonic
1005761063 6:28968827-28968849 TCCCTCCAACCCTCCACGAGAGG + Intergenic
1006143038 6:31942536-31942558 TCCCACCTTGCCTCCCAAAGTGG + Intronic
1006463478 6:34177376-34177398 GCCCACCATCACTCTACGAGAGG - Intergenic
1006489954 6:34378778-34378800 TCCCTCCCTCTCTCCAAGAAGGG + Intronic
1007656873 6:43455723-43455745 ACCCAGCTTCCTTCCAAGAGAGG + Intronic
1013279820 6:108625666-108625688 TCACAGCATCCTTCCAAGAGAGG - Intronic
1013760261 6:113510163-113510185 TCCCACCAGGCCTCCAACACTGG - Intergenic
1015085487 6:129285762-129285784 CCCCAAAATCCCTTCAAGAGAGG - Intronic
1017791881 6:157807092-157807114 TCCCTCCATCCTTCAAAGATAGG + Intronic
1017824917 6:158074526-158074548 TCCCACCTTCCTTGCAAGATGGG + Intronic
1019565934 7:1679077-1679099 TGCCAACATCCCTGCAAGACGGG - Intergenic
1020217788 7:6207942-6207964 TCCCCCCACCCCCCCAAGACAGG - Intronic
1026443190 7:70461355-70461377 TTAAACCATCCCTTCAAGAGAGG + Intronic
1027230274 7:76268150-76268172 CCCCACCCTTCCTCCAAGAGGGG + Intronic
1028607280 7:92668830-92668852 TCATACCATCCCTCCTAGGGTGG - Intronic
1030625589 7:111842540-111842562 TCCCAACATCTCTCCTAGAGTGG + Intronic
1032472527 7:132188932-132188954 CCCCACCAACCTTCCCAGAGAGG + Intronic
1035181554 7:157093030-157093052 CCCCACCAGTCCTCTAAGAGGGG + Intergenic
1036503991 8:9338395-9338417 TTCCACCATCAATCCAACAGAGG + Intergenic
1037759100 8:21730032-21730054 GCCCCCCCTCCCACCAAGAGAGG - Intronic
1038048355 8:23786388-23786410 TCCCACCTTCCCTCCAGAAAAGG - Intergenic
1038788604 8:30646351-30646373 TCCCCCCATCCCCCCAAAAAAGG + Intronic
1039255424 8:35713713-35713735 TCCAACCATCCTTCCAAGGTTGG - Intronic
1039910449 8:41822767-41822789 TGCTACCATCCCACCAACAGGGG + Intronic
1040856259 8:51951559-51951581 TCCTACAATGCCTTCAAGAGTGG - Intergenic
1042760566 8:72267747-72267769 GCACAACATCCCTCCATGAGAGG + Intergenic
1042874398 8:73427505-73427527 CCCCACCCTCCCTGCAAGAAAGG + Intronic
1044656874 8:94557652-94557674 TCCCTCCCCCCCTTCAAGAGAGG - Intergenic
1045676697 8:104615132-104615154 TGCCACCATCGCCCCAATAGAGG - Intronic
1048586661 8:135780390-135780412 TCCCAACCTCTCTCCTAGAGAGG - Intergenic
1049009823 8:139879822-139879844 TCCCAACATCCCTGCAAGGTGGG + Intronic
1055493158 9:76826622-76826644 TCCTAACTTGCCTCCAAGAGAGG - Exonic
1055809082 9:80130621-80130643 TCCCACCATTCCGCCAAGGCAGG + Intergenic
1057190813 9:93086565-93086587 TCCCAGCTTCACTCCCAGAGGGG + Intergenic
1057847358 9:98536031-98536053 TCTCACCATCCCTGTCAGAGTGG - Intronic
1059486390 9:114630301-114630323 TCCATCCATCCATCCAAGACAGG + Intronic
1060432257 9:123560749-123560771 TCCCACCTCTACTCCAAGAGGGG + Intronic
1060906865 9:127314563-127314585 TCCCTCCCTCCCTCCAAGGCAGG + Intronic
1061222595 9:129260824-129260846 TCCCACCACCCCTCCAATCAGGG - Intergenic
1186374717 X:8987482-8987504 TCCCACCAACCCTGCAGAAGAGG - Intergenic
1187526375 X:20058731-20058753 TCTCATCATCTCTCCAAAAGTGG - Intronic
1188299279 X:28487603-28487625 TCCCTCCATTCCTTCAAGAGAGG + Intergenic
1192196623 X:69033023-69033045 CCCCACCATCCCTCCAGCATGGG + Intergenic
1192232391 X:69274512-69274534 TCCCCACATCCCTCCACCAGGGG + Intergenic
1193910395 X:87298883-87298905 TCCCAACATACCACCAAGACTGG - Intergenic
1196263005 X:113607789-113607811 TCCCACCAGCCTTCCTAGTGGGG - Intergenic