ID: 1142753967

View in Genome Browser
Species Human (GRCh38)
Location 17:2004649-2004671
Sequence GGCCAGGGAGAAGTCCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142753967_1142753976 -2 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG 0: 1
1: 1
2: 7
3: 101
4: 683
1142753967_1142753980 26 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753980 17:2004698-2004720 GACAGAGCAAGGATAGTCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 216
1142753967_1142753970 -10 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753970 17:2004662-2004684 CTCCCTGGCCCTGGGCAGAGAGG 0: 1
1: 0
2: 5
3: 79
4: 683
1142753967_1142753974 -3 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753974 17:2004669-2004691 GCCCTGGGCAGAGAGGGCAGAGG 0: 1
1: 0
2: 8
3: 121
4: 892
1142753967_1142753978 4 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753978 17:2004676-2004698 GCAGAGAGGGCAGAGGGTTCAGG 0: 1
1: 0
2: 4
3: 81
4: 511
1142753967_1142753979 15 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753979 17:2004687-2004709 AGAGGGTTCAGGACAGAGCAAGG 0: 1
1: 1
2: 3
3: 39
4: 450
1142753967_1142753971 -9 Left 1142753967 17:2004649-2004671 CCTTAGGGGACTTCTCCCTGGCC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1142753971 17:2004663-2004685 TCCCTGGCCCTGGGCAGAGAGGG 0: 1
1: 0
2: 7
3: 86
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142753967 Original CRISPR GGCCAGGGAGAAGTCCCCTA AGG (reversed) Intronic
900357366 1:2271314-2271336 GGACAGGGAGCAGCCCCCTGCGG - Intronic
901638170 1:10679972-10679994 GTCCAGCCAGGAGTCCCCTAAGG - Intronic
902563552 1:17294875-17294897 AGTCAGGGAGATGTCCCCAAAGG + Intergenic
902960962 1:19962594-19962616 GGTCAGGGAGCAGACCCGTAAGG - Intergenic
903218985 1:21858432-21858454 GGACAGGATGAAGTCACCTAGGG - Intronic
907828630 1:58042593-58042615 GGGCAGGGTGAAATCCCCTTAGG + Intronic
913117531 1:115710963-115710985 GGCCTGGGACCGGTCCCCTAGGG - Intronic
914256308 1:145962825-145962847 GGTCGCGGAGGAGTCCCCTAAGG - Exonic
914463832 1:147908878-147908900 GCCCCGGGACAAGTCCCCCAGGG - Exonic
915107969 1:153546106-153546128 GGACAGGGAGTAGTCCCATGGGG + Intronic
921335816 1:214084859-214084881 GGCCAGGGAGAAAATCCCCATGG + Intergenic
923235625 1:232030432-232030454 GGCCAGGCAGAACTGCCCTGAGG - Intronic
924198389 1:241634604-241634626 GGCCAAGGAGAAATTCCCCAGGG - Exonic
1070733989 10:78851183-78851205 GTCCAGGGAGTATTCCCCCAGGG - Intergenic
1072607842 10:96999144-96999166 GGCCTGGGAGAAGCCCCATGAGG + Exonic
1072614776 10:97042287-97042309 AGCCAGGGAGAAATTCCCTGCGG + Intronic
1076724515 10:132407247-132407269 GGCCAGGGAGCAGTCCTTTCTGG + Intronic
1078533394 11:12154165-12154187 GGTCAGGGCTAAGTCCCCCAAGG - Intronic
1085476628 11:76793398-76793420 GGGCAGCGAGAGGTCCCCTCTGG + Intronic
1088357904 11:108962306-108962328 GATCAGAGAGGAGTCCCCTAAGG + Intergenic
1089170107 11:116505918-116505940 GGTCAGGGAGATGTGCCCTGTGG + Intergenic
1089202723 11:116734175-116734197 GGCCAGGGGGAACTCCACAAAGG + Intergenic
1092016945 12:5167445-5167467 GGACAGGGAGAAGTAGCCCATGG - Intergenic
1092023350 12:5221041-5221063 GGCCTGGCATAAGTCACCTAGGG + Intergenic
1095926506 12:47584591-47584613 GGCCACTGAGAAGCCCCCTCTGG - Intergenic
1100221518 12:92509177-92509199 GGCCAGGGAAAATTCCTCTTTGG - Intergenic
1101551472 12:105766466-105766488 GGCCAGGGAGAAGCTTCCTGTGG - Intergenic
1102046541 12:109833276-109833298 GGCCACGGAGATGTCCCCAGGGG + Intronic
1102083423 12:110116516-110116538 GGGAAGGGAGAAATACCCTAAGG - Intergenic
1102816335 12:115869365-115869387 GGGCAGGGAGCAGTTCCCTCCGG + Intergenic
1105007155 12:132728718-132728740 GGCCAGGGAGGAGTCGCCTCTGG + Intronic
1111529701 13:89520715-89520737 GGCCAGGGAACAGTCACCTGTGG - Intergenic
1114043541 14:18702097-18702119 GGCCAGGGAGCATTGCCTTATGG + Intergenic
1114047825 14:18892539-18892561 GGCCAGGGAGCATTGCCTTATGG + Intergenic
1114114696 14:19509104-19509126 GGCCAGGGAGCATTGCCTTATGG - Intergenic
1114116391 14:19626867-19626889 GGCCAGGGAGCATTGCCTTATGG - Intergenic
1114658644 14:24331071-24331093 GGCCAGCGAGTGTTCCCCTAAGG - Exonic
1115004215 14:28461706-28461728 GGCAAGAAAGAATTCCCCTACGG + Intergenic
1118371808 14:65144025-65144047 GGCCAGTGAGAAATTCCCTACGG + Intergenic
1118849721 14:69574194-69574216 GGGCTGGGAGAAGTCCCCAAAGG + Intronic
1119407490 14:74407655-74407677 GGCCAGGCGGAAGTCCCCTTTGG + Exonic
1119567623 14:75641972-75641994 GGGCAGGGAGAACTCCCACAGGG + Intronic
1121957983 14:98231415-98231437 GGCCAGGGAGATGTGCACTGGGG + Intergenic
1122370447 14:101226390-101226412 GGCCAGGGGGAAGCTGCCTAGGG + Intergenic
1124244132 15:28055757-28055779 GGCCGGGGAGATGTCCCTGAGGG - Intronic
1124462975 15:29909680-29909702 TTCCAGGGAGCAGTACCCTAAGG - Intronic
1127705596 15:61544542-61544564 GGCCAGGGAGAAATTTCCTTAGG + Intergenic
1128811967 15:70579553-70579575 CCCCGGGGAGAAGTCACCTATGG + Intergenic
1130684150 15:86022354-86022376 GGCCAGGGAAATGTCTCATAGGG + Intergenic
1132769524 16:1553518-1553540 GGACATGGACAAGTCCTCTATGG + Intronic
1134604574 16:15560275-15560297 GGCCAGGGCAAAGGCCCCCAGGG + Intronic
1134859631 16:17549726-17549748 GGCCAGGAAGGATTCTCCTATGG - Intergenic
1137273889 16:46920658-46920680 GTCAAGGGAGCAGTCCCCTTGGG + Intronic
1138195392 16:55048114-55048136 GGGTAGGGAGGAGTCCCCTCGGG + Intergenic
1139209561 16:65064063-65064085 GGCCAGGGAGGGGTCACCTTTGG + Intronic
1140048901 16:71462212-71462234 CGCCGGGGAGCAGTCCGCTACGG - Exonic
1142753967 17:2004649-2004671 GGCCAGGGAGAAGTCCCCTAAGG - Intronic
1143311271 17:5991551-5991573 GATCAGGGAGAAGTCCACTTGGG + Intronic
1144234174 17:13240952-13240974 GACCAATGAGAAGTTCCCTACGG - Intergenic
1146744455 17:35314965-35314987 GAGCAGGGAGAAGCTCCCTAAGG - Intergenic
1147546610 17:41406823-41406845 GGCCAGGGTCACGTCCCATATGG + Intergenic
1147730663 17:42599180-42599202 GGCCAAGGAGAAGAGCTCTAGGG - Intronic
1149313892 17:55421527-55421549 GGCCAGGGATCAGTTCCCTGGGG - Intronic
1150569533 17:66374075-66374097 AGCCAGGGAGGAGTCCGCAAGGG + Intronic
1151998458 17:77628739-77628761 GGCCAAGGAGAATTCTTCTAAGG - Intergenic
1152148678 17:78585127-78585149 GGCCAGGCAGGAGGACCCTATGG - Intergenic
1155064261 18:22255088-22255110 GGGCAGGGAGGAGCCCCCCAGGG - Intergenic
1157245916 18:46055199-46055221 CTCCATGGAGAAGTCCTCTATGG + Intronic
1161039207 19:2100968-2100990 GGCCAGGCAGAAGACCCATGTGG + Intronic
1161089394 19:2352561-2352583 CCCCAGGGAGAAGTCTCCTGGGG + Intronic
1161342837 19:3752431-3752453 GGCCAGGGAGGAGACCTCTCTGG + Intronic
1162573446 19:11485515-11485537 GGACAGGGAGGAGGCTCCTAGGG + Intronic
1166553062 19:43679612-43679634 AGCCAGGTAGGAGTCCTCTATGG + Intergenic
926047961 2:9724158-9724180 GGCCAAGGCCAAGTCACCTAGGG - Intergenic
926197158 2:10771036-10771058 GCCCAGGGAGAAGGAACCTAAGG + Intronic
927888457 2:26732886-26732908 GACCTGGGAGAAGTCCCCTAAGG + Exonic
928273741 2:29880309-29880331 GGCCAGGCAGATGTACCCCAGGG + Intronic
929949262 2:46393816-46393838 GGCCAGGGAGATGTCCTGAAAGG - Intergenic
933209732 2:79552580-79552602 GTCCAGGCAGAAGTCTACTATGG - Intronic
933743562 2:85553560-85553582 CACCTGGGAGAAGTCTCCTAAGG - Intronic
937689932 2:124743934-124743956 GGCCACGGATAAGTCACCTGTGG - Intronic
938425199 2:131181062-131181084 GGCCAGGGAGCATTGCCTTATGG + Intronic
938436268 2:131285318-131285340 GGCCTGAGAGCAGTCCCCCAGGG - Intronic
942827998 2:180203903-180203925 GCCCAGTGATAAGTCCTCTAAGG - Intergenic
946347997 2:219126765-219126787 GGCCAGGGAGAATTCCCTAGAGG + Intronic
947739166 2:232477099-232477121 GGCAAGGGAGGAGCCCTCTATGG - Intergenic
947744545 2:232500824-232500846 GGGCAGTGAGAAGACCCCCAGGG + Intergenic
947751619 2:232535570-232535592 GGCCAGGGAGGAGGCCACTCAGG + Exonic
948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG + Intronic
948600387 2:239104592-239104614 GGCCAGGGCCAAGTTCCCTCTGG + Intronic
1170305655 20:14934962-14934984 GGCCAAGGAAGAGTCCCCTCAGG - Intronic
1171180574 20:23087888-23087910 CACCAGTGAGAAGTCCCCTTGGG - Intergenic
1171340353 20:24422450-24422472 CACCAGTGAGAAGTCCCCTTGGG + Intergenic
1172628012 20:36359771-36359793 GGCCTGGGAGGCGTCCCCTCCGG - Intronic
1172973112 20:38887960-38887982 GGCAAGGGAGGAGTCCTCAAGGG - Intronic
1173690234 20:44955138-44955160 GGCTCTGGAGAAGTACCCTATGG - Exonic
1173863447 20:46298896-46298918 GGCCAGGGAGAAAGGCCCCAAGG - Intronic
1180197827 21:46208138-46208160 GCCAAGGGAGGAGTCCCCCAGGG + Intronic
1180466361 22:15615215-15615237 GGCCAGGGAGCATTGCCTTATGG + Intergenic
1181446963 22:22984437-22984459 AGCCAGGAAGAAGTTTCCTATGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1181669817 22:24420835-24420857 GGCCAGGGAGGAGCCCAGTAGGG + Intronic
1183271100 22:36863017-36863039 GGCCTGGGTGAGGTCCCCAAGGG + Intronic
1183471484 22:38009351-38009373 GGCCAGGAAGGAGGCCCCTGAGG + Intronic
1184763890 22:46561779-46561801 GGCCAGGCTGAAGTCCCCAGGGG - Intergenic
953737737 3:45510708-45510730 GGACAGGGAGAAGTCCTGGATGG + Intronic
953773513 3:45796678-45796700 GGACAGGGCGGAGTCCCCTGGGG + Intergenic
953981026 3:47413025-47413047 GTCCAGGGAGAAGGCCTCTGGGG - Exonic
954956189 3:54520184-54520206 GGCCAGGAAGAACTGCACTAGGG - Intronic
957496214 3:80994273-80994295 GTACAGGGAGGAGTCACCTAAGG + Intergenic
957701738 3:83724702-83724724 AGACAGGGAGAAGTCCCCAGTGG + Intergenic
960304147 3:116040660-116040682 GGCCATGGAGGAGTCTCCCAAGG + Intronic
962325406 3:134428124-134428146 GGCCAGGGAGGACTTCCCTGAGG + Intergenic
962356176 3:134696006-134696028 GGCAAGGGAGAAGTACACCAGGG - Intronic
963255387 3:143139702-143139724 GTCCTGGGAGAAGTCCAGTAGGG + Intergenic
964131888 3:153298356-153298378 GGGAAGGGAGAAGCCTCCTATGG + Intergenic
969337977 4:6522740-6522762 GGCCAAGGAGAAGGGCCCCAGGG - Intronic
969651142 4:8469029-8469051 AGCCAGGCAGAAGTCACCGACGG - Intronic
971309706 4:25514918-25514940 GGTCAGGGAGATGTCTCCCAGGG + Intergenic
974697708 4:65397183-65397205 AGCCAGGGAGAAGTACCCCAGGG - Intronic
975762545 4:77633409-77633431 AACCAGGGAGGAGTCACCTATGG - Intergenic
981497841 4:145413521-145413543 GTCTAGGGAAAAGTCCACTAAGG - Intergenic
991472119 5:66980183-66980205 GGCCAGAGATAAGTCCCCCAGGG + Intronic
991601766 5:68358230-68358252 GGCCAGTGCGAATTTCCCTATGG - Intergenic
999054888 5:148563870-148563892 GTCCTGGGACAAATCCCCTATGG + Intronic
999377972 5:151100216-151100238 GGGTAGGGAGAAGTGCCCTTTGG + Intergenic
1003137739 6:3446165-3446187 CGCCAGGGAGAAGTCACAAAGGG + Intronic
1003460599 6:6324541-6324563 GACCAGGCAGAAGTTCCCAAAGG + Intergenic
1005870598 6:29972006-29972028 GGCCAGGGAGGGGTCTCCTCTGG - Intergenic
1014284049 6:119476431-119476453 GGCAAGTGAGAAGTCCGCAAAGG - Intergenic
1017105649 6:150885100-150885122 GGCCAGGGTGAAGTTTCCTAAGG + Intronic
1018836294 6:167486745-167486767 GGCCAGCGAGGAGTCCACTGTGG - Intergenic
1019270283 7:143349-143371 GGCCACAGAGGAGTCCACTAAGG - Intergenic
1019284703 7:217654-217676 GGCCAGGCAGAGGTGCCCTGAGG + Intronic
1019476219 7:1245696-1245718 GGCCAGGGAGGAGCCCCAGAGGG + Intergenic
1022270231 7:28800211-28800233 GACCAGGGAGAAGTTTACTAAGG + Intronic
1023842844 7:44106682-44106704 GCCCAAGGAGAAGCCACCTAAGG + Exonic
1024548396 7:50540772-50540794 GGCCAGGGAGGAGATCCATAAGG + Intronic
1027729035 7:81846192-81846214 TGCCAGGGAGTAATCCCCTTGGG - Intergenic
1028084856 7:86624271-86624293 GGACAGGGAGTAATTCCCTATGG + Intergenic
1032073189 7:128822371-128822393 GGCTGGGGAGACCTCCCCTAAGG + Intergenic
1032258237 7:130313941-130313963 GGCCAGGGAGACACCCACTATGG + Intronic
1033537867 7:142328665-142328687 GACAAAGGAGAAGTCCCCAATGG + Intergenic
1033543737 7:142381140-142381162 GGCAAAGGAGAAGTCCCTGATGG + Intergenic
1033551382 7:142451327-142451349 GACCAAGGAGAAGTCCCCAATGG + Intergenic
1033841851 7:145385030-145385052 TGCCAGGGAGAAGTTCCTTTGGG + Intergenic
1037299388 8:17435091-17435113 GGCCAGTGAGAAACCCCCAAGGG - Intergenic
1037952866 8:23030054-23030076 GGCCTTGGGGAAGTCCCCCAAGG - Intronic
1040416244 8:47198358-47198380 GGCCAGGGTGAAGTCCCTTGGGG + Intergenic
1044582622 8:93837248-93837270 GGACAGAGAGCAGTGCCCTAAGG - Intergenic
1044611488 8:94096521-94096543 GAACAGGGAGAAGTCCTTTAGGG + Intergenic
1047775461 8:128066906-128066928 GGCCAGCAAGAAGTCCCCTGAGG - Intergenic
1051194853 9:14553016-14553038 AGCCAAGGAAAAGTGCCCTATGG - Intergenic
1052859540 9:33428499-33428521 GGCCAGGGAGAAATAGCCTCTGG + Intergenic
1054910262 9:70448793-70448815 GATCAGGGAAAAGTCCCATAAGG + Intergenic
1061388056 9:130301935-130301957 GGCCAGGGAGGGGTCCCATGGGG + Intronic
1061930859 9:133832409-133832431 GGCCAGAGGGAAGTCCCTTAGGG - Intronic
1186707499 X:12157361-12157383 GGAGAAGGAGAAGTCCCCAAAGG - Intronic
1191254373 X:58273453-58273475 AGCCGGGAAGAAGTCCCCCAGGG - Intergenic
1193061616 X:77213885-77213907 AGCCATGGAGTAGGCCCCTAGGG + Intergenic
1194291027 X:92072083-92072105 GGCCTGGAAGAAATCCCCCATGG - Intronic
1198376076 X:136041402-136041424 GGCCAGGGAGGAGCATCCTACGG + Intronic
1199350522 X:146795072-146795094 GTCCAGGCAGAAGTCTGCTACGG + Intergenic
1200608537 Y:5296658-5296680 GGCCTGGAAGAAATCCCCCATGG - Intronic
1201851465 Y:18486926-18486948 GGGCAGGGGGAAGCCCCCAAAGG + Intergenic