ID: 1142755042

View in Genome Browser
Species Human (GRCh38)
Location 17:2011468-2011490
Sequence CTGTGGGAGGGGAAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1378
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 1280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142755030_1142755042 24 Left 1142755030 17:2011421-2011443 CCACTGGGCTCTTCCTTCTGGGA 0: 1
1: 0
2: 4
3: 41
4: 339
Right 1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG 0: 1
1: 0
2: 4
3: 93
4: 1280
1142755035_1142755042 -2 Left 1142755035 17:2011447-2011469 CCAGGAATTGGAGGCACCTAGCT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG 0: 1
1: 0
2: 4
3: 93
4: 1280
1142755032_1142755042 11 Left 1142755032 17:2011434-2011456 CCTTCTGGGAAAGCCAGGAATTG 0: 1
1: 0
2: 1
3: 30
4: 179
Right 1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG 0: 1
1: 0
2: 4
3: 93
4: 1280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142755042 Original CRISPR CTGTGGGAGGGGAAGATGAA AGG Intronic
900281952 1:1875615-1875637 CTTTGGGAGGCCAAGATGAGAGG - Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
900771335 1:4547265-4547287 ATGTGGGAGGGGGAAATGAATGG - Intergenic
901128829 1:6949463-6949485 CTCTTGGAGTGGAAGAGGAAAGG - Intronic
901256674 1:7834699-7834721 CTTTGGGAGGCCAAGATGAGAGG - Intronic
901593864 1:10369383-10369405 CTTTGGGAGGCCAAGATGAGGGG + Intronic
901633237 1:10658074-10658096 CTGTGGGAGGCCAAGATGGGAGG - Intronic
901689722 1:10964872-10964894 CTTTGGGAGGCCAAGATGAGCGG - Intronic
901774077 1:11547284-11547306 AAGTGGGAGGAGAAGATGACAGG + Intergenic
901842823 1:11964585-11964607 CTGGTGGTGGGGAAGATGGAGGG - Intronic
902361315 1:15943948-15943970 TTGTGGGAGGGGCAGGTGAGGGG - Intronic
902601100 1:17540444-17540466 CTGTGGGAGGAGAGGATGCCGGG + Intronic
902654739 1:17859538-17859560 ATGGGGGAGGGGGAGAGGAAGGG + Intergenic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
902982853 1:20138240-20138262 CTGTGGGAGGCCAAGACGGAAGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903080540 1:20808125-20808147 CTTTGGGAGGCCAAGATGAGCGG - Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903331759 1:22600211-22600233 AGGTGGGAGGGAAAGAAGAAAGG + Intronic
903381382 1:22899256-22899278 CTTTGGGAGGCCAAGATGAGCGG + Intronic
903801429 1:25971390-25971412 CAGTGGGAGCTGAAGATGAAAGG + Intronic
903884226 1:26531624-26531646 CTGTGAGAGGGGAAGACCAGCGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904006958 1:27368070-27368092 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
904025490 1:27500613-27500635 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
904188712 1:28726451-28726473 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904635465 1:31877595-31877617 CTTTGGGAGGCTAAGATGGATGG - Intergenic
904660716 1:32082697-32082719 CTTTGGGAGGCCAAGATGAATGG - Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905254086 1:36668924-36668946 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
905391754 1:37640253-37640275 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
905508402 1:38498943-38498965 CTGGGAGAAGGGAAGAGGAAGGG + Intergenic
905557063 1:38894946-38894968 CTGTGGGAGGCCAAGGTGAGTGG - Intronic
905585958 1:39118548-39118570 CTGTGGGAGAGAAAGATAGATGG + Intronic
905856891 1:41320302-41320324 CAGGGGGTGGGGAAGAGGAAGGG + Intergenic
906222934 1:44096641-44096663 CTTTGGGAGGCCAAGATGAGCGG - Intergenic
906230962 1:44163691-44163713 CTTTGGGAGGCGAAGGTGAGGGG - Intergenic
906289979 1:44613509-44613531 CTTTGGGAGGCCAAGATGAGAGG + Intronic
906341416 1:44984247-44984269 CTTTGGGAGGCCAAGATGAGAGG + Intronic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
907060924 1:51423925-51423947 CTATGGGGGAGGAAGAGGAAGGG + Intronic
907549551 1:55292697-55292719 TGGTGGGAGGGGAAGAGAAAAGG - Intergenic
907578848 1:55553786-55553808 CTGAGGGAGGGGGAGAAAAAAGG - Intergenic
907805896 1:57819699-57819721 CTGTGGGAGCACAAGATAAATGG - Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908381064 1:63597157-63597179 ACTTGGGAGGGGAAGATGAAGGG + Intronic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908895208 1:68890878-68890900 CTCTGGGAGCCTAAGATGAAAGG + Intergenic
909026302 1:70486202-70486224 CTTTGGGAGGCCAAGACGAACGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
910062839 1:83114235-83114257 TTGAGGGAGGAGAAGAAGAAGGG - Intergenic
910442590 1:87267801-87267823 GTTGGGGAGGGGAAGGTGAATGG - Intergenic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
911574307 1:99556846-99556868 CAGTAGGAAGGGAAGAAGAATGG - Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
912316297 1:108670211-108670233 CTGTGCCAGGGGATGAGGAAAGG - Intergenic
912583867 1:110744120-110744142 CTGTCAGAGGGAAAGATGATTGG - Intergenic
912982094 1:114384146-114384168 CTTTGGGAGGCCAAGATGGATGG - Intergenic
913143059 1:115961256-115961278 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
913433892 1:118827028-118827050 ATGAGAGAGGGGAGGATGAATGG - Intergenic
913522978 1:119663762-119663784 CTTTGGGAGGCCAAGATGGAAGG - Intronic
913566374 1:120076764-120076786 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
913591747 1:120335678-120335700 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
913631757 1:120716785-120716807 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
913651610 1:120919467-120919489 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914140754 1:144945474-144945496 CTTTGGGAGGCCAAGATGGAAGG + Intronic
914169496 1:145209603-145209625 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914287135 1:146237480-146237502 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914321202 1:146562150-146562172 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
914417714 1:147499220-147499242 ATGACTGAGGGGAAGATGAATGG - Intergenic
914524610 1:148453565-148453587 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914548167 1:148688222-148688244 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914599061 1:149182268-149182290 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914618516 1:149383482-149383504 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
914641791 1:149613575-149613597 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
915136295 1:153733939-153733961 CTGAGGGAGGGGAAATGGAAAGG + Intronic
915268627 1:154735882-154735904 CTGTGGGAGGGGACACAGAAGGG + Intronic
915471092 1:156126290-156126312 AAGTGGGAGGGGAAGACAAAGGG - Intronic
915494648 1:156273167-156273189 TGGTGGAAGGGGAAGATAAATGG - Intronic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
915735114 1:158079562-158079584 CTTTGGGAGGCCAAGATGAGTGG - Intronic
915905387 1:159873169-159873191 CTGGGGGAGGGAAACAGGAATGG + Intronic
916275408 1:162988481-162988503 CTGTGGCGGGGGACGATGAGTGG - Intergenic
916880666 1:169016907-169016929 CAGTGAGAATGGAAGATGAAAGG - Intergenic
916892196 1:169122832-169122854 CTTTGGGAGGCCAAGATGGAAGG - Intronic
917097884 1:171417796-171417818 CTGTGGGAGGACAAGGTGAAAGG - Intergenic
917341986 1:173989430-173989452 CTGTGGGAGGCCAAGATGGATGG - Intronic
917830782 1:178883241-178883263 CTTTGGGAGGCCAAGATGGAAGG + Intronic
918002882 1:180514322-180514344 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
918015081 1:180625345-180625367 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
918077064 1:181178482-181178504 CAGTGGGAGGGGGTGGTGAAGGG + Intergenic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
918621470 1:186610537-186610559 CTTTGGGAGGCCAAGGTGAAGGG - Intergenic
919588308 1:199466906-199466928 CTTTGGGAGAGGAAAAAGAAAGG + Intergenic
919898704 1:202027271-202027293 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
919973050 1:202593086-202593108 AGGTGGGAGGGGCAGAGGAAAGG + Exonic
920013996 1:202891056-202891078 ATTTGGGAGGGAAAGATGTAGGG - Intergenic
920429857 1:205911525-205911547 CAGTGGGTTTGGAAGATGAAAGG + Intergenic
920452650 1:206071601-206071623 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
920484136 1:206352928-206352950 CTTTGGGAGGCCAAGATGGAAGG - Intronic
920596924 1:207281204-207281226 CTGTGGAGGGGGAAGATCATTGG + Intergenic
920801096 1:209188220-209188242 CTGTAGGATGACAAGATGAAGGG - Intergenic
920855609 1:209658887-209658909 CTGGAGGAGGAGAAGAGGAATGG - Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921107279 1:211995039-211995061 TGGGGTGAGGGGAAGATGAATGG + Intronic
921120970 1:212137000-212137022 CTTTGGGAGGCTAAGATGGAAGG + Intergenic
922488892 1:225999481-225999503 CTGGGGGAGGGGAACAGGAAAGG + Intergenic
922598296 1:226830637-226830659 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
922953920 1:229583145-229583167 CTTTGGGAGGGCAAGGTGAGTGG - Intergenic
922966088 1:229692128-229692150 CTTTGGGAGGTCAAGATAAAAGG - Intergenic
922994311 1:229943929-229943951 CTGTGAGAGAGGAAGAGCAATGG + Intergenic
923240162 1:232076833-232076855 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
923361845 1:233219368-233219390 CTGTGAGAGGATAAGATGCAGGG + Intronic
923617348 1:235548814-235548836 CTCTGTCAGTGGAAGATGAATGG - Exonic
923665689 1:235996684-235996706 CTTTGGGAGGTCAAGATGGATGG - Intronic
924250516 1:242128406-242128428 CTGAGGCTGGGGCAGATGAAAGG + Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924449786 1:244167079-244167101 CTTTGGGAGGCCAAGATGAGGGG - Intergenic
1062941433 10:1424340-1424362 CTGTGTGAGAGCAAGAAGAAAGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063677185 10:8151190-8151212 CTTTGGGAGGGCAAGGTGAGAGG - Intergenic
1064587305 10:16851940-16851962 TTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587358 10:16852127-16852149 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587430 10:16852399-16852421 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064850256 10:19701692-19701714 GTAGGGGAGGGGAAGAGGAAGGG - Intronic
1065104060 10:22362495-22362517 CTGTGGGAGGACAAGATGGGAGG + Intronic
1065237210 10:23665478-23665500 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1065397551 10:25255908-25255930 CAATGGGAGGGGATGATAAATGG + Intronic
1065738747 10:28777488-28777510 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1065877189 10:30007717-30007739 CTGGGGTCGGGGAAGAGGAAGGG - Intergenic
1066066266 10:31763234-31763256 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG + Intergenic
1066413911 10:35201315-35201337 CTTAAGGAGGGGAAGAGGAAGGG + Intronic
1066707860 10:38201010-38201032 CTTTGGGAGGCCAAGTTGAAAGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067078565 10:43201649-43201671 CTGGGGGAAGGGAGGTTGAATGG + Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067260621 10:44687134-44687156 GTGTAGGAAAGGAAGATGAAAGG + Intergenic
1067449002 10:46369857-46369879 CTTTGGGAGGCCAAGAGGAATGG - Intronic
1067588367 10:47490908-47490930 CTTTGGGAGGCCAAGAGGAATGG + Intronic
1067635492 10:47998999-47999021 CTTTGGGAGGCCAAGAGGAATGG + Intergenic
1067680022 10:48428365-48428387 GTGTAGGAGGGTGAGATGAAGGG - Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1067757756 10:49017876-49017898 CTTTGGGAGGGGAGGATATATGG - Exonic
1067878037 10:50021409-50021431 CTTTGGGAGGCCAAGAGGAACGG - Intergenic
1067992094 10:51225958-51225980 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1068434086 10:56968517-56968539 CTTTGGGAGGCGGAGATGAGTGG + Intergenic
1068688785 10:59895056-59895078 CTTTGGGAGGCCAAGGTGAAAGG + Intronic
1069166496 10:65166910-65166932 CTTTGGGAGGCCAAGATGCATGG + Intergenic
1069405253 10:68091971-68091993 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1069589786 10:69634595-69634617 CTTTGCAAGGGGAAAATGAAAGG - Intergenic
1069704208 10:70447440-70447462 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1070070533 10:73084894-73084916 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1070108783 10:73462265-73462287 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1070471672 10:76786538-76786560 CTGTGGAAGGTGAAAAAGAAGGG - Intergenic
1070686625 10:78489527-78489549 CTGTGGGCAGTGAAGATGGAAGG - Intergenic
1070890401 10:79938739-79938761 CTGTGTGATGGGGTGATGAAAGG + Intronic
1071148265 10:82600709-82600731 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1071337443 10:84612364-84612386 CGGTGGGAAGGGAAGAGGAGGGG + Intergenic
1071609631 10:87021069-87021091 CTTTGGGAGGCCAAGAGGAATGG - Intronic
1071832762 10:89388347-89388369 CTGTGGGAGGCCAAGATGGGCGG - Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072479297 10:95795133-95795155 CTGTGGGAGGGCATGATGATGGG + Intronic
1072841004 10:98773808-98773830 CTTTGGGAGGCTAAGGTGAAAGG + Intronic
1072862446 10:99020750-99020772 CTGTGGGTAGGGATCATGAAAGG - Intronic
1073253290 10:102134764-102134786 CTGATGGAGGTGAAGATGAATGG - Intronic
1073253456 10:102135989-102136011 CTGATGGAGGTGAAGATGAGTGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073592149 10:104767678-104767700 AAGTGGGAGGGGAAGGGGAAGGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074570470 10:114619591-114619613 CTGAGGGATGGGACGATGCATGG + Intronic
1074583749 10:114746237-114746259 CTGGGGTAGGGTAAGAGGAATGG - Intergenic
1074638252 10:115345635-115345657 CTGTTGGAGGGGACGATTGATGG + Intronic
1074885665 10:117691035-117691057 CTTTGGGAGGCCAAGGTGAACGG - Intergenic
1075108007 10:119555174-119555196 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1075252620 10:120894341-120894363 CTGTGGCAGATGAAGAGGAAAGG - Intronic
1075285792 10:121184653-121184675 TTGATGGAGGGGAAGATAAAGGG - Intergenic
1075349650 10:121712300-121712322 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1076112610 10:127872467-127872489 CTGTGGGATGGGATCAGGAATGG + Intergenic
1076318866 10:129564175-129564197 GTGGGGGAGTGGAAGAAGAAGGG - Intronic
1077091269 11:779405-779427 TTGGGGGAGGGGAAGAGGAATGG - Intronic
1077605379 11:3607070-3607092 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1077674053 11:4181950-4181972 GTGTGGGAGGGGCAGACGAGAGG + Intergenic
1078031458 11:7755723-7755745 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078318706 11:10313585-10313607 CTGTGGGAGGCCAAGATGGGTGG + Intronic
1078351413 11:10597598-10597620 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1078529988 11:12129954-12129976 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1078597983 11:12705054-12705076 CTCTGGGAAGGAAAGAAGAATGG + Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078703356 11:13712771-13712793 TTTTGGTAGGGGAAGAAGAAAGG + Intronic
1079134620 11:17769373-17769395 AGGAGGGAAGGGAAGATGAATGG + Intronic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079986910 11:27209408-27209430 CATTGGGAAGGGAAGATTAAAGG - Intergenic
1080089010 11:28321746-28321768 CTGGTGGAGGAGAAGATGATGGG + Intronic
1080112670 11:28586271-28586293 CTCTGGGAGGCTGAGATGAAAGG - Intergenic
1080569421 11:33542619-33542641 CTGGGGGAGGGGGAGACGGATGG - Exonic
1080793253 11:35539840-35539862 CTGTGGGAGGGGATCATGCAAGG - Intergenic
1081675237 11:44964786-44964808 ATGTGGGAGGGGGAGAGCAAGGG + Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1082015592 11:47484087-47484109 CTTTGGGAGGCCAAGATGACAGG + Intronic
1082072851 11:47952853-47952875 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1082199648 11:49349825-49349847 GAGGGGGAGGGGAAGAGGAAGGG - Intergenic
1082628116 11:55508997-55509019 ATGTAGGAAGGGAAGATGTAGGG + Intergenic
1082959876 11:58908142-58908164 TTGTGGGAGGCCAAGATGACTGG - Intronic
1083146811 11:60766135-60766157 CTGTGGGAGGCCAAGATGGGTGG + Intronic
1083317996 11:61828135-61828157 CTGAGGGAGGGGCGGAGGAAGGG + Exonic
1083468072 11:62862404-62862426 CTTTGGGAGGCGAAGGTGAGAGG + Intronic
1083844944 11:65326192-65326214 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1084345241 11:68542635-68542657 CTTTGGGAGGCCAAGATGGATGG - Intronic
1084484671 11:69440924-69440946 CTGTGGAAGGCGGAGAAGAAGGG + Intergenic
1084721448 11:70908338-70908360 CTGGGGGATGGGAGGATGCATGG - Intronic
1084917682 11:72441680-72441702 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
1085030444 11:73267878-73267900 CTCTGGGAGGGGCAAAGGAAGGG + Intronic
1085297736 11:75440356-75440378 CTATGGGAGAGGAGGGTGAAGGG - Intronic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1085780131 11:79400796-79400818 CTGTGGGAGGAGGAGAGCAAGGG - Intronic
1085801519 11:79594178-79594200 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1085803876 11:79616933-79616955 CTGGAGGAGGGGAAGAGAAAGGG + Intergenic
1086091626 11:83010205-83010227 CTTTGGGAGGGCAAGAAGGAAGG + Intronic
1086131591 11:83407458-83407480 CTGTGGCCGGGGGAGATGAAGGG + Intergenic
1086655172 11:89345574-89345596 ATGTGGGAGGGAAAGGTGCAGGG - Intronic
1086656019 11:89356405-89356427 GAGGGGGAGGGGAAGAGGAAGGG + Intronic
1087526494 11:99320358-99320380 CTGTTGGAAGGGACAATGAAAGG + Intronic
1087664957 11:101033689-101033711 CTGGGGGAGGAGAAAATAAAAGG + Exonic
1087681174 11:101219746-101219768 GTGGGGGAGGAGAAGATGAAGGG + Intergenic
1087936901 11:104044793-104044815 CTTTGGGAGGCCAAGGTGAACGG + Intronic
1088598732 11:111457722-111457744 CTGTGGGAGGGAAGGAGGAGGGG - Intronic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089475449 11:118757030-118757052 CTGAGGGAGGTCAAAATGAAAGG + Intronic
1089602985 11:119626565-119626587 CAGGGGAAGGGGGAGATGAAAGG + Intronic
1089816911 11:121184030-121184052 CTTTGGGAGGCGAAGATGGGAGG - Intronic
1090011676 11:123050831-123050853 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
1090159527 11:124478125-124478147 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1090364814 11:126197005-126197027 CTGGGGGACAGCAAGATGAAGGG + Intergenic
1090666875 11:128920234-128920256 CGGTGGGAGGGGAGTCTGAAGGG - Exonic
1090775522 11:129961616-129961638 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1091073550 11:132592312-132592334 CTGAGGGAGGGGCATATGGAGGG + Intronic
1091427453 12:403733-403755 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1091444965 12:539667-539689 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1091676881 12:2497909-2497931 TAGTGGGATGGCAAGATGAAGGG - Intronic
1091708277 12:2715681-2715703 CTGTGGTCTGGGAAGATGATTGG - Intergenic
1091713561 12:2760194-2760216 CAGTGGGAAGGAAAGATGAGAGG - Intergenic
1091729146 12:2866907-2866929 CTGTGGGAGGCCAAGGTGAGTGG + Intronic
1092109177 12:5946689-5946711 CTGCTGGAGGGAAAGAAGAAAGG - Intergenic
1092522130 12:9285986-9286008 CAGTGGGAGCTGAAGCTGAAAGG + Intergenic
1092545152 12:9445870-9445892 CAGTGGGAGCTGAAGCTGAAAGG - Intergenic
1092547754 12:9466669-9466691 CGGTGGGAAGGAAAGATGACAGG - Intergenic
1092649969 12:10624175-10624197 CTTTGGGAGGCGAAGGTGAGAGG + Intronic
1092690724 12:11107243-11107265 CTTTGGGAGGCCAAGATGAGGGG - Intronic
1092693419 12:11142034-11142056 CTTTGGGAGGCCAAGATGAGGGG - Intronic
1092728647 12:11508268-11508290 CAGTGGGAAGGAAAGATGAGAGG + Intergenic
1093045147 12:14434840-14434862 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1093645322 12:21579602-21579624 CTTTGGGAGGCCAAGATGGATGG - Intronic
1093866258 12:24230402-24230424 CTGGGGGAGGGGTAGAAAAACGG + Intergenic
1094110724 12:26859539-26859561 CTTTGGGAGGGCAAGACGAGAGG - Intergenic
1094195049 12:27740511-27740533 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1094257290 12:28446706-28446728 CTTTGGGAGGCCAAGATGGATGG - Intronic
1094308000 12:29042581-29042603 CTCTGGGAGGCCTAGATGAATGG + Intergenic
1094478945 12:30864821-30864843 GAGTGGGAAGGGGAGATGAAGGG - Intergenic
1094505228 12:31055692-31055714 CGGTGGGAAGGAAAGATGACAGG + Intergenic
1094507795 12:31076179-31076201 CAGTGGGAGCTGAAGCTGAAAGG + Intronic
1094682335 12:32677796-32677818 CTGTGGGAGGCCAAGATGGGCGG + Intergenic
1095153230 12:38820161-38820183 CTTTGGGAGGCGAAGATGGGGGG + Intronic
1095300407 12:40578073-40578095 AGGAGGAAGGGGAAGATGAAGGG - Intergenic
1095497142 12:42797132-42797154 CTTTGGGAGGCGAAGATGGGAGG - Intergenic
1095924980 12:47569478-47569500 CTTTGGGAGGCCAAGATGGACGG + Intergenic
1095967228 12:47877140-47877162 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1095973298 12:47920603-47920625 CTGTTGGAGGAGAAAATGCAGGG + Intronic
1095980734 12:47973274-47973296 CTGTGAGAGGGTGGGATGAATGG + Exonic
1096001546 12:48134515-48134537 CTGTGGCAGGTGAACATAAATGG + Intronic
1096329788 12:50700953-50700975 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1096349146 12:50880151-50880173 CTTTGGGAGGCCAAGGTGAAAGG + Intronic
1096465057 12:51843828-51843850 CTTTGGGAGGGCAAGATGGGAGG + Intergenic
1096772736 12:53946351-53946373 CAGTGGGAAGGGAAGAGGCAAGG - Exonic
1096783704 12:54005307-54005329 AGGTGGGAGGGGAAGATTAGGGG - Intronic
1096932820 12:55233675-55233697 TGCAGGGAGGGGAAGATGAATGG + Intergenic
1097000576 12:55873027-55873049 CTTTGGGAGGCGAAGATGGGCGG - Intergenic
1097046855 12:56193386-56193408 TTGTTGGAGTGGAAGAGGAAGGG - Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1097236340 12:57542572-57542594 CTTTGGGAGGCCAAGATGGATGG + Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097524957 12:60721114-60721136 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1097613967 12:61861496-61861518 CTTTGGGAAGCGGAGATGAAAGG - Intronic
1097649674 12:62281580-62281602 CTGTGGGAGGCCAAGATGGCTGG - Intronic
1097653424 12:62331919-62331941 CTTTGGGAGGCCAAGGTGAACGG + Intronic
1097869588 12:64589757-64589779 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1097930437 12:65178087-65178109 CTTTGGGAGGCGAAGGTGACAGG - Intronic
1097951346 12:65432365-65432387 TTGTGGCAAGGAAAGATGAATGG + Intronic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1099254125 12:80294841-80294863 CTTTGGGAGGCTAAAATGAATGG + Intronic
1099556477 12:84114564-84114586 CTTTGGGAGGCAAAGATGAGAGG + Intergenic
1099615126 12:84924249-84924271 CTTTGGGAGGTCAAGTTGAATGG - Intergenic
1100293069 12:93235786-93235808 CAGTGGGAAGGGAAGCTGGAAGG - Intergenic
1100547767 12:95619628-95619650 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1100591961 12:96037638-96037660 ATGTGAGAAGGGAAGATAAAGGG + Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101328937 12:103741696-103741718 CTTTGGGAGGCCAAGATGGATGG - Intronic
1101360298 12:104020163-104020185 CTTTGGGAGGCTAAGATGGATGG - Intronic
1101872907 12:108580413-108580435 CTCTGGGAGGCCAAGATGAGAGG - Intergenic
1102077316 12:110070003-110070025 CTTTGGGAGGCCAAGATGGATGG + Intronic
1102233490 12:111279577-111279599 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102317727 12:111903428-111903450 CTTTGGGAGGCCAAGTTGAAAGG + Intergenic
1102637329 12:114335757-114335779 CTGGGGGAGGGGAGGAAGTAGGG + Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102683019 12:114703239-114703261 GAGAGGGAGGGGACGATGAAGGG + Intergenic
1103115953 12:118332066-118332088 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103266289 12:119633334-119633356 CTTTGGGAGGCAAAGATGGAAGG + Intronic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103374987 12:120448570-120448592 CTTTGGGAGGCGAAGATGGGCGG - Intronic
1103387808 12:120547535-120547557 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1103470154 12:121173891-121173913 CCTTGGGAGGCCAAGATGAAAGG + Intronic
1103706838 12:122879481-122879503 CTGCGGGAGGGGCAGAGGAGAGG - Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1104211819 12:126696221-126696243 CTTTGAGAAGGGAAGGTGAAGGG - Intergenic
1104424925 12:128668283-128668305 ATGAGGGAAGGGGAGATGAAGGG + Intronic
1104471377 12:129032668-129032690 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1104646792 12:130503146-130503168 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1104661001 12:130611406-130611428 CTGCGGGAGTGGAAGACAAAAGG - Intronic
1104766486 12:131333455-131333477 CTGAGTGTCGGGAAGATGAATGG - Intergenic
1105519637 13:21120621-21120643 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1105550545 13:21391208-21391230 CTTTGGGAGGCCAAGATGGATGG - Intronic
1105784290 13:23733390-23733412 CTCTGGGAGAGGAACATGAGAGG + Intronic
1105790408 13:23792599-23792621 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1105812510 13:24007709-24007731 CTTTGGGAGGCCAAGATGGATGG - Intronic
1105821104 13:24081851-24081873 CTGTGGGCGTGGAAAGTGAAAGG - Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1105906516 13:24816141-24816163 CTTTGGGAGGGTAAGGTGAAAGG - Intronic
1106755627 13:32820599-32820621 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1107686327 13:42903406-42903428 CTGTTGGAGTGGAGGATGCAGGG + Intronic
1107810148 13:44192733-44192755 CTGAGATAGGTGAAGATGAAGGG + Intergenic
1108183753 13:47867943-47867965 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1108242360 13:48478981-48479003 CTATGGGAGGGCAAGGTGAGAGG + Intronic
1108383448 13:49876035-49876057 CTGTGGGAGGCTGAGATGAGTGG - Intergenic
1108512287 13:51167301-51167323 ATCTGGGAGGGGAAGAGGAAGGG + Intergenic
1108593244 13:51928953-51928975 CTTTGGGAGGCCAAGATGAGGGG + Intergenic
1108917823 13:55637470-55637492 CTTTGGGAGGCCAACATGAAAGG + Intergenic
1110222746 13:73090573-73090595 CTGTGGCAGGTAAAGATCAAAGG - Intergenic
1110223839 13:73099183-73099205 CTTTGGGAGGTCAAGATGAGTGG + Intergenic
1110595143 13:77312446-77312468 CTGGGGGAGGGGAGAATAAAAGG + Intronic
1110736587 13:78944010-78944032 CTTTGGGAGGCAAAGGTGAAAGG + Intergenic
1110903787 13:80860230-80860252 CTGTGGGAGGAGCAGGTGAGAGG - Intergenic
1110943731 13:81386536-81386558 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1111475052 13:88735136-88735158 CTTTGGGAGGGCAAGGTGAATGG + Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1111768934 13:92571793-92571815 CTTTGGGAGGCGAAGGTGAGTGG + Intronic
1111988466 13:95090185-95090207 CTGTGGTAGTGGAAGACAAAGGG + Intronic
1112020850 13:95369849-95369871 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1112219261 13:97471385-97471407 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
1112382798 13:98908760-98908782 ATGTGGGAATGGAGGATGAAGGG + Intronic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1112639196 13:101254137-101254159 CTCTGGGAGGTCAAGATGGATGG + Intronic
1112699486 13:101989328-101989350 ATGTGGGAGGTGAATATGAAAGG - Intronic
1112982554 13:105403756-105403778 CTGTGGGAAGGAAAGCTGGAAGG + Intergenic
1113054208 13:106250721-106250743 CTCTGGGAGGCGAAGGTGAGTGG + Intergenic
1113480162 13:110614948-110614970 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1113490548 13:110688338-110688360 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113880111 13:113620157-113620179 CTGTGGGTGGAGCAGATGGAGGG + Intronic
1113978961 13:114255873-114255895 CTCTGGGAGGCTAAGGTGAAAGG - Intronic
1114038288 14:18650228-18650250 AGGCGGGAGGAGAAGATGAAGGG - Intergenic
1114120333 14:19664814-19664836 AGGCGGGAGGAGAAGATGAAGGG + Intergenic
1114565743 14:23631643-23631665 TTGGGGGTGGGGAAGCTGAATGG - Intronic
1114625604 14:24127624-24127646 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1114686021 14:24532450-24532472 ATGTGGGAGAGAAAGAGGAAAGG - Intergenic
1114740117 14:25088234-25088256 CTGTGGGAGGCCAAGGTGGAAGG + Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1115034773 14:28843858-28843880 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1115245164 14:31287248-31287270 CAGTGGGAAGGGGAGATTAAAGG + Intergenic
1115390137 14:32844800-32844822 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1115421478 14:33199712-33199734 AAGAGGGAGGGGAAGAAGAAGGG - Intronic
1115564319 14:34612182-34612204 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1115591862 14:34873698-34873720 CTGGGCAAGGGGAAGAGGAAGGG - Intronic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117267916 14:54109878-54109900 CTTTGGGAGGCCAAGGTGAAGGG - Intergenic
1117701672 14:58420031-58420053 CTGTGGGAGGTGGAGATGGGAGG - Intronic
1117745773 14:58867891-58867913 CTTTGGGAGGTCAAGGTGAAAGG - Intergenic
1117769054 14:59113670-59113692 CTGTGGGAGTGGGAGTTGACAGG - Intergenic
1118266578 14:64300514-64300536 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1118309151 14:64680055-64680077 CTCTGGGAGGGGAAGAAGAAAGG - Intergenic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118867383 14:69714176-69714198 GAGGGGGAGGGCAAGATGAATGG - Exonic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119321946 14:73737378-73737400 CTTTGGGAGGACAAGATTAAAGG + Intronic
1119588447 14:75861199-75861221 CTGTGGGAGGAGATGAGTAAGGG + Intronic
1119723683 14:76908843-76908865 CAGTGGCAAGGGAACATGAATGG + Intergenic
1119772216 14:77227303-77227325 CAATGGGAGGGGAAGATGGGAGG + Intronic
1120065635 14:80038026-80038048 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1120663502 14:87278653-87278675 CTCTGGGCTGGGAAGATGTATGG + Intergenic
1120775378 14:88430134-88430156 CGGTGGAAGGGGTAGAAGAAAGG + Intronic
1120912430 14:89679658-89679680 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1121511314 14:94515185-94515207 CTGTGGGAGAGGCTGATGATTGG + Intronic
1121769595 14:96521720-96521742 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1121820025 14:96958738-96958760 CTGTGGGAGGGGACTTTGAGGGG - Intergenic
1121994861 14:98593733-98593755 CTGTGGGATGTGAAGCTGACTGG - Intergenic
1122266374 14:100548765-100548787 GTGTGGGAGGGGAGGACGAAGGG + Intronic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122458168 14:101872479-101872501 CTTTGGGAGGCCAAGATGAAAGG - Intronic
1122872602 14:104647136-104647158 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1202853767 14_GL000225v1_random:37383-37405 GCGTGGCAGGGGCAGATGAAAGG + Intergenic
1202860549 14_GL000225v1_random:79015-79037 ATGTGGCAGGGGCAGATGCAAGG - Intergenic
1202940797 14_KI270725v1_random:143581-143603 GCATGGGAGGGGAAGATGAGGGG + Intergenic
1123988869 15:25668497-25668519 GTGTGGGAGGGAAGGAAGAAAGG - Intergenic
1124002957 15:25774329-25774351 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1124343001 15:28901958-28901980 GTGGGGGAGGGGAAGAATAAAGG + Intronic
1124352100 15:28963417-28963439 AGGTGGGTGGGGAGGATGAAAGG - Intronic
1124451038 15:29791268-29791290 CTTTGGGAGGGCAAGGTGAGCGG - Intronic
1124498220 15:30201177-30201199 TTTTGTGAGGGGAAGATGAAAGG - Intergenic
1124634505 15:31356308-31356330 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1124745363 15:32337497-32337519 TTTTGTGAGGGGAAGATGAAAGG + Intergenic
1124788776 15:32707139-32707161 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1124889961 15:33723751-33723773 CTCTGTGAGGGGAAGATACATGG - Intronic
1125482058 15:40088025-40088047 CTGGGAGAGAGGAAGAAGAAAGG - Exonic
1125507542 15:40275734-40275756 CTGTGGAAGGGGCAGAGGATTGG - Intronic
1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG + Intronic
1126352529 15:47759375-47759397 CTGGGGGAAGGGAAGAGGATTGG + Intronic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1126624319 15:50671563-50671585 CCGTGGGAGGAGGAGATGAGAGG + Intronic
1126833493 15:52634843-52634865 CTTTGGGAGGCCAAGATGAGCGG - Intronic
1127096706 15:55518371-55518393 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1127162051 15:56198915-56198937 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1127184303 15:56462111-56462133 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1127242076 15:57127224-57127246 CTTTGGGAGGCCAAGATGAATGG - Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127327025 15:57905842-57905864 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1127485107 15:59411670-59411692 CTTTGGGAGGCCGAGATGAAAGG + Intronic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1127905324 15:63372093-63372115 CTGTGGGGGATGAAGATGACCGG - Intronic
1128130269 15:65222622-65222644 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1128459796 15:67858198-67858220 CTTTGGGAGGGCAAGGTGAGAGG + Intergenic
1128503936 15:68252215-68252237 CTTTGGGAGGGCAAGATGGGTGG - Intronic
1128608158 15:69053810-69053832 CTGAGGGAGGGTAAGAAGCAGGG + Intronic
1128989332 15:72245703-72245725 CTTTGAGAGAGGGAGATGAAAGG + Intronic
1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG + Intergenic
1129370222 15:75088741-75088763 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1130054620 15:80511801-80511823 AGGTGGGAGGGGAAGAAGAGAGG + Intronic
1130141744 15:81231614-81231636 CTGTGGGAGGCCAAGGTGAGTGG - Intronic
1130426474 15:83806122-83806144 CTGTGGGATGGAAAGATCAGTGG - Intronic
1130555659 15:84920824-84920846 GTGTGGAAGAAGAAGATGAATGG + Intronic
1130711013 15:86281138-86281160 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1131002144 15:88947616-88947638 CTCTGGGAGGCCAAGATGAGAGG + Intergenic
1131579217 15:93625599-93625621 CTGAGGGGGAGGAAGAGGAATGG + Intergenic
1131848785 15:96515938-96515960 TTAGGGGAGGGGAAGAGGAAAGG - Intergenic
1132489931 16:222392-222414 CTTTGGGAGGGCAAGATGGGAGG + Intronic
1132521224 16:390365-390387 CTGTGGGAGGCCAAGATGGGAGG + Intergenic
1133192939 16:4147652-4147674 CTGTGGAAGGGGCCCATGAATGG - Intergenic
1133324265 16:4934001-4934023 CTGTGGGATGGGAATAAGCACGG - Intronic
1133977500 16:10609965-10609987 CTTTGGGAGGCCAAGATGAGGGG + Intergenic
1134253078 16:12588412-12588434 CTCTGGGAGGGGAAGATTGGAGG - Intergenic
1134407870 16:13978085-13978107 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
1134528818 16:14966128-14966150 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1135098610 16:19586141-19586163 CTTTGGGAGGCCAAGATGAAAGG - Intronic
1135220193 16:20607912-20607934 CTGAGGGATGGGTAGAGGAATGG - Intergenic
1135348863 16:21712082-21712104 CTTTGGGAGGCCAAGATGAATGG + Intronic
1135457951 16:22615163-22615185 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1135678537 16:24437801-24437823 TGGTGGAAGGGGAAGAGGAATGG - Intergenic
1136015206 16:27393997-27394019 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1136101008 16:27995954-27995976 CTGTGGGAGGCCAAGATGGGAGG + Intronic
1136245976 16:28976026-28976048 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136610721 16:31363348-31363370 CTGTGGGAGGGGCTGATGCTGGG - Exonic
1137422614 16:48348735-48348757 CTTTGGGAGGTGGAGATGAGAGG - Intronic
1137439575 16:48486397-48486419 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1137705643 16:50533983-50534005 CTTTGGAAGGGAAAGATGATCGG + Intergenic
1137775640 16:51052271-51052293 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
1137828995 16:51525995-51526017 CTTTGGGAGGTCGAGATGAAAGG + Intergenic
1138478393 16:57285095-57285117 CTTTGGGAGGCTAAGGTGAAAGG + Intergenic
1138571107 16:57873800-57873822 CTTTGGGAGGCCAAGATGAAAGG + Intergenic
1138603827 16:58074453-58074475 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1138644040 16:58409952-58409974 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1138645704 16:58422954-58422976 GTGTGGGAGGCGATGGTGAAGGG - Intergenic
1138697139 16:58825038-58825060 CTGTGGGAGGCCAAGGTGAGAGG - Intergenic
1139022546 16:62768345-62768367 ATGTGGCAGAGGAAGATGATAGG + Intergenic
1139318896 16:66096989-66097011 CTTTGGGAGGCTAAGATGAGAGG + Intergenic
1139406763 16:66725233-66725255 CTTTGGGAGGCCAAGATGGAGGG + Intronic
1139724226 16:68883256-68883278 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1139848752 16:69938255-69938277 CTTTGGGAGGGTGAGATGGAAGG - Intronic
1139867546 16:70074849-70074871 CTTTGGGAGGCCAAGGTGAACGG - Intergenic
1139874247 16:70132730-70132752 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1140012424 16:71148998-71149020 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1140177050 16:72672617-72672639 CTTTGGGAGGGTAAGATGGGAGG + Intergenic
1140241186 16:73202510-73202532 CTATGGCAGGGGAAGATGTTCGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140655153 16:77132394-77132416 AAGGGGGAGGGGAAGAGGAAGGG - Intergenic
1140811978 16:78587274-78587296 CTGTGGGAGGCCAAGATGGGAGG - Intronic
1140878182 16:79172780-79172802 CTCTGGGAGGCCAAGATGAGAGG + Intronic
1141044897 16:80707217-80707239 CTTTGGGAGGCCAAGATGACAGG + Intronic
1141425000 16:83939169-83939191 CTGTGAGTCGGGAGGATGAAGGG + Intronic
1142411659 16:89920141-89920163 CTGTGGAAGGCGTAGATGAGGGG - Exonic
1142579664 17:933651-933673 TAGTGGGAGGCCAAGATGAAAGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143156460 17:4840375-4840397 CTGTGGGAGGGGAAAAAAAATGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143363101 17:6387385-6387407 CTGGGTGAGAAGAAGATGAATGG - Intergenic
1143413515 17:6727752-6727774 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1143500845 17:7337608-7337630 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1143552297 17:7637889-7637911 CTTTGGGAGGCTAAGGTGAATGG + Intergenic
1143596764 17:7919087-7919109 CTATGGGAGGCCAAGATGGAAGG + Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144140181 17:12340630-12340652 CTGTGGGAGGCGAAGATGGGAGG - Intergenic
1144214758 17:13045479-13045501 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1144564423 17:16348398-16348420 CTTTGGGAGGCCAAGATGGATGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145084142 17:19921590-19921612 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145229203 17:21159627-21159649 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1145991449 17:29081534-29081556 CTCTGGGAGAGGATGAGGAAGGG + Intronic
1146711740 17:35047993-35048015 CTGTGGAAGGCCAAGGTGAATGG - Intronic
1147016609 17:37497058-37497080 CAGTGGGAAGGGAAGAGAAATGG - Intronic
1147020804 17:37531122-37531144 CTGTGGGAGGTTGAGATGGAAGG + Intronic
1147189706 17:38731297-38731319 CTGTGGCCAGGGAAGATGAGGGG - Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147384970 17:40075660-40075682 ATGGGGGAGGGGAAGGTGATGGG - Intronic
1147566273 17:41538141-41538163 CTGAGGGAGGGGAAGGACAAGGG + Intergenic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148180981 17:45604640-45604662 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1148267927 17:46241279-46241301 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1148779316 17:50112629-50112651 CTGGGGGAGGAGCAGATGAAGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148872306 17:50665853-50665875 CTTTGGGAGGCTAAGATGAACGG - Intronic
1148880475 17:50722100-50722122 CTCTGGGAAGGGGAGTTGAAGGG - Intronic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG + Intronic
1149782739 17:59410860-59410882 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150060209 17:62061273-62061295 CTTTGGGAGGTTAAGATGGAAGG + Intronic
1150177477 17:63075760-63075782 CTTTGGGAGGGTGAGGTGAATGG - Intronic
1150219337 17:63487268-63487290 CTGAGGGAGGGGCAGCTGATCGG - Intronic
1150238342 17:63611301-63611323 CTTTGGGAGGCCAAGATGGACGG - Intergenic
1150332772 17:64307807-64307829 CTTTGGGAGGGCAAGATGGGAGG - Intergenic
1150337662 17:64342330-64342352 CGGTGGCAGGGGAAGAGGAGTGG - Intronic
1150451479 17:65272382-65272404 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1150726481 17:67655313-67655335 CTTTGGGAGGCCAAGATGAGCGG + Intronic
1150800318 17:68276695-68276717 CTCTGGGAGGCCAAGATGAAAGG - Intronic
1150903152 17:69305624-69305646 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151485715 17:74398183-74398205 CTGTGGGAGGCTAAGAGGAGAGG + Intergenic
1151581110 17:74979561-74979583 GTGAGGGCGGGGGAGATGAAGGG - Intergenic
1151753719 17:76058362-76058384 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1151753742 17:76058500-76058522 CTGTGGGAGGCTGAGGTGAAAGG - Intronic
1151949812 17:77345157-77345179 CTGGGGGAAGGGAGAATGAATGG + Intronic
1152048748 17:77956978-77957000 CTGAGGGAGGGGGATAAGAAAGG + Intergenic
1152561860 17:81082648-81082670 CTGTGGAGGGAGAAGAGGAAAGG - Intronic
1152609264 17:81307550-81307572 AAGGGGGAGGGGAAGAGGAAGGG - Intergenic
1152697097 17:81802964-81802986 CTCTGGGTGGGGAAGAAGACTGG + Intergenic
1152886445 17:82853646-82853668 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1152886746 17:82856079-82856101 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1152886768 17:82856361-82856383 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1152927866 17:83095815-83095837 CTGGCAGAGGAGAAGATGAAGGG - Intergenic
1203168396 17_GL000205v2_random:121495-121517 CTGTGGGAGGCCAAGGTGAGTGG - Intergenic
1153084152 18:1263686-1263708 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
1153171202 18:2318029-2318051 CTTTGGGAGGTCAAGATGAGAGG - Intergenic
1153223474 18:2881119-2881141 CAGGGGGAGGTGGAGATGAAAGG - Intronic
1153297349 18:3560175-3560197 CTTTGGGAGGGTGAGATGACCGG + Intronic
1153309235 18:3661823-3661845 CTTTGGGAGGCCAAGATGAGCGG - Intronic
1153450419 18:5221210-5221232 ATGGGGGAGGGGAAGGGGAAGGG - Intergenic
1153464202 18:5370895-5370917 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1153567306 18:6431228-6431250 CTCTGGGAGGCCAAGGTGAATGG - Intergenic
1153575070 18:6511957-6511979 CTGTGGGAGGTGGAGAAGCATGG - Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1154272772 18:12934114-12934136 CTGTGGCAGGGGGAGAGGAGAGG - Intergenic
1154284348 18:13037796-13037818 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1155215131 18:23636507-23636529 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1155299709 18:24418200-24418222 CTTTGGGAGGGCAAGATGGGTGG - Intergenic
1155306741 18:24485940-24485962 CTGTGAGAATGGAAGAGGAAGGG + Intergenic
1155410776 18:25542385-25542407 CTGTGTGCTGGGAAGATAAAGGG + Intergenic
1157270830 18:46274819-46274841 CAGTGGGAGGGGAAATGGAAAGG + Intergenic
1157529824 18:48410551-48410573 CAGTGCGAGGGGAGGAGGAAGGG + Intronic
1158646635 18:59254428-59254450 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1159031826 18:63239496-63239518 CTTTGGGAGGCCAAGATGAGCGG + Intronic
1159259960 18:66001811-66001833 CTGTTGGAGGGGATGAGGCATGG - Intergenic
1159937422 18:74380356-74380378 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1160447694 18:78940208-78940230 GTGTGGGAGGGGAAGAGCAGTGG - Intergenic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1161147420 19:2687301-2687323 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1161205435 19:3038662-3038684 CTTTGGGAGGCCAAGATGGAGGG + Intronic
1161304748 19:3560863-3560885 CTTTGGGAGGCCAAGGTGAAGGG + Intronic
1161376022 19:3939267-3939289 CTTTGGGAGGCCAAGATGGATGG + Intronic
1161422737 19:4184750-4184772 CCGGTGGAGGGGTAGATGAATGG + Intronic
1161519479 19:4715733-4715755 ATGTGGGAGGTGCAGGTGAAAGG + Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161821413 19:6533199-6533221 CTGGGCGAGGGGAAGAGGTAGGG - Intronic
1161822857 19:6541597-6541619 CTGTGGGTGGGGAAAACGAAAGG + Intergenic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1162044972 19:7993010-7993032 CTTTGGGAGGGTGAGATGGAAGG - Intronic
1162115662 19:8427870-8427892 CTTTGGGAGGCCAAGATGCATGG + Intronic
1162382572 19:10340158-10340180 CTTTGGGAGGTCAAGATGAGAGG - Intergenic
1162448735 19:10741470-10741492 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1162476397 19:10902550-10902572 CTTTGGGAGGGCAAGATGGGTGG - Intronic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1162585155 19:11553855-11553877 CTGTGGGGTGAGAAGATGCAGGG - Intronic
1162700683 19:12512659-12512681 CTGTGCCTAGGGAAGATGAAAGG + Intronic
1162761700 19:12892294-12892316 CTGTTGGGGGGGAAGAAGAAAGG - Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1162941748 19:14014516-14014538 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
1163213928 19:15862486-15862508 GAGGGGGAGGGGAAGAAGAAGGG + Intergenic
1163303914 19:16465256-16465278 CTGCAGGAGGGGCAGATGACTGG - Intronic
1163617260 19:18336701-18336723 CTGAGGGAGGGGAATAGGGAGGG + Intergenic
1163624291 19:18379967-18379989 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1163784015 19:19265289-19265311 CTTTGGGAGGCCAAGATGGATGG - Intronic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1164937840 19:32229072-32229094 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1165031723 19:33002478-33002500 CTGTTGCATGGGAAGAAGAAAGG - Intronic
1165197321 19:34114732-34114754 CTTTGGGAGGCGAAGGTGAAAGG + Intergenic
1165238051 19:34439584-34439606 CTGTGGGAGGGTGAGATGGGAGG + Intronic
1165263469 19:34640352-34640374 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1165811533 19:38614568-38614590 CAGTGGGAGGGGGAGATGGTGGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166573285 19:43813240-43813262 CTGTGGGAGGGCACCATGCAGGG - Intronic
1166818108 19:45559125-45559147 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1166990973 19:46692537-46692559 CTGTGGGAGGTGAGTAGGAAGGG - Intronic
1167035115 19:46990581-46990603 CAGAGGGTGGGGAAGAGGAAAGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167461775 19:49628702-49628724 CTTTGGGAGGTGGAGATGAGCGG + Intergenic
1167636649 19:50659547-50659569 GGGTGGGAGGGGAAGAGGAGGGG - Intronic
1167777364 19:51567788-51567810 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1167957651 19:53079840-53079862 CTGTGGGAGGCCAAGGTGAGAGG + Intronic
1168088672 19:54067185-54067207 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1168090723 19:54081462-54081484 ATATGGGAGGGGAAACTGAAAGG - Intergenic
1168357702 19:55712819-55712841 GAGTGGGAGGGGAAGAAGAGGGG + Intronic
1168665165 19:58199475-58199497 CTTTGGGAGGCCAAGGTGAATGG + Intronic
925231489 2:2237055-2237077 CTTTGGGAGGCTGAGATGAATGG - Intronic
925612813 2:5717376-5717398 CTTTGGGAGGCCAAGATGAATGG - Intergenic
925756639 2:7139270-7139292 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
925822880 2:7817832-7817854 CGGTGGGAGGGGAGGACAAAGGG + Intergenic
926126341 2:10274494-10274516 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
926239390 2:11073416-11073438 ATGCGGGAGGGGAAGAGGAAAGG - Intergenic
926641280 2:15240357-15240379 CTTTGGGAGGCCAAGATGGATGG + Intronic
926735554 2:16070767-16070789 TTGTGGGTGGGGAAGATGTTAGG - Intergenic
926895644 2:17684578-17684600 CTTTGGGAGGCCAAGATGAGAGG + Intronic
926956758 2:18310203-18310225 CTGTGGGAGGAAAGAATGAATGG - Intronic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927164631 2:20305367-20305389 ATGTGGGAGGCTGAGATGAAAGG + Intronic
927378496 2:22448557-22448579 TTGTAGGAAGGGATGATGAAGGG + Intergenic
927460753 2:23296416-23296438 TTGAGGGAGGGAAGGATGAAGGG - Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
927970422 2:27302546-27302568 CTTTGGGAGGCCAAGGTGAACGG + Intronic
928070626 2:28211630-28211652 CTTTGGGAGGCCAAGATGAGTGG - Intronic
928186693 2:29116185-29116207 ACCTGGGAGGGGAAGTTGAAAGG + Intronic
928566361 2:32555262-32555284 CTTTGGGAGGCCAAGATGAGAGG + Intronic
928573190 2:32628461-32628483 CTGTGTTAGGGAAAAATGAAGGG - Intronic
928649531 2:33389879-33389901 CTTTGGGAGGCCAAGATGGATGG - Intronic
928822037 2:35373018-35373040 CAGTGTGAGGGGAAGATGTGGGG + Intergenic
929415062 2:41738827-41738849 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
929503999 2:42513968-42513990 CTCTGGGAGGCCAAGGTGAATGG + Intronic
929694665 2:44104006-44104028 CTCAGGGAGGGGAAAATGAAAGG - Intergenic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
930171281 2:48254289-48254311 CTTTGAGAGGGAAAGAGGAATGG + Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
930270562 2:49251547-49251569 GGGAGGGAGGGGAAGAGGAAGGG - Intergenic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
931279039 2:60772198-60772220 CTTTGGGAGGCCAAGGTGAATGG + Intronic
931403823 2:61956650-61956672 CTTTGGGAGGCCAAGATGGACGG - Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931557470 2:63520646-63520668 CTCTGGGAGGCCAAGATGGATGG + Intronic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
931968159 2:67556468-67556490 GTGTGAGAGAGCAAGATGAATGG - Intergenic
932017886 2:68051412-68051434 CTCTGGGAGGTCAAGATGGAAGG + Intronic
932814032 2:74847432-74847454 CTTTGGGAGGCCAAGATGGAAGG + Intronic
933000346 2:76913780-76913802 CTTTGGGAGGCCAAGATGGATGG - Intronic
933382612 2:81568816-81568838 CTTTGGGAGGTTAAGGTGAAAGG + Intergenic
933551865 2:83787851-83787873 CTGGGGGAGGAGAAGAGAAATGG - Intergenic
933694102 2:85203481-85203503 CTTTGGGAGGCCAAGATGGAAGG + Intronic
933733710 2:85478341-85478363 CTGTGGGTGAGGAACTTGAACGG + Intergenic
933798972 2:85944593-85944615 CTGTGGGTGAGGAACTTGAATGG - Intergenic
934557846 2:95296875-95296897 CTGTGGAAGTGGAAAAGGAAGGG - Intergenic
934558621 2:95300716-95300738 CTGTGGCAGGGAAAGAAGCAAGG + Intronic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
934753854 2:96811480-96811502 CTGTGAGAAGGGATGATCAATGG - Exonic
935166151 2:100570717-100570739 CTTTGGGAGGCCAAGATGAGTGG - Intronic
935223492 2:101034554-101034576 CAGCGGGCGGGCAAGATGAAGGG + Intronic
935290353 2:101604928-101604950 CTATGGAAAGGCAAGATGAAGGG - Intergenic
935297351 2:101661882-101661904 CTTTGGGAGGCCAAGATGGACGG - Intergenic
935726857 2:106031036-106031058 GAGTGGGAGGGGAAGACGAGTGG - Intergenic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935831463 2:107005011-107005033 ATGAGGGAGGGGATGAGGAATGG + Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
935973274 2:108552819-108552841 CTTTGGGAGGCCAAGCTGAAAGG - Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
936852839 2:116921747-116921769 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
937027039 2:118707516-118707538 CTGAGGGAGGGGAGAATGAGAGG + Intergenic
937072288 2:119073393-119073415 CTGAGGGAGGGAAGGAAGAAAGG + Intergenic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937280353 2:120713356-120713378 CTGGGGGTGGGGCAGATCAAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
938108698 2:128550271-128550293 GAGGAGGAGGGGAAGATGAAGGG - Intergenic
938277556 2:130039714-130039736 ATACGGGAGGAGAAGATGAAGGG + Intergenic
938437830 2:131297666-131297688 ATACGGGAGGAGAAGATGAAGGG - Intronic
938443562 2:131357243-131357265 AGGCGGGAGGAGAAGATGAAGGG - Intergenic
938613336 2:132971798-132971820 CTGGGGGAGGAGAAGAAGTACGG + Intronic
938945622 2:136209411-136209433 ATTAGGGAGGAGAAGATGAAAGG + Intergenic
938957155 2:136309290-136309312 CTTTGGGAGGCCGAGATGAATGG - Intergenic
939480891 2:142745786-142745808 CTTTGAGAGGGCAAGGTGAAAGG + Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940111067 2:150154649-150154671 CTGAGGGAAGGGAAAAGGAAGGG - Intergenic
940133144 2:150406787-150406809 CTTTGGGAGGCCAAGATGGATGG + Intergenic
940299484 2:152162064-152162086 CTTTGGGAGGCCAAGATGAGTGG - Intronic
940660104 2:156534995-156535017 CAGTGGGGGAGGAAGATGACAGG + Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941288483 2:163644911-163644933 CTATGGCAGGGGAGGAGGAATGG + Intronic
941561500 2:167051100-167051122 GAGTGCTAGGGGAAGATGAAGGG - Intronic
941736502 2:168982519-168982541 GTCTGGTAGGGAAAGATGAAGGG - Intronic
941886620 2:170534681-170534703 CTTTGGGAGGCCAAGATGAGAGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942075404 2:172352690-172352712 CTGAGCCAGGGGAAGAAGAAAGG + Intergenic
942133468 2:172903123-172903145 CTGTGGGAGGCCAAGATGGGTGG + Intronic
942573649 2:177339313-177339335 CTTTGGGAGGCTAAGATGAGAGG + Intronic
943063505 2:183062648-183062670 CTTTGGGAGGCCAAGATAAAAGG + Intergenic
943098533 2:183458345-183458367 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
944414097 2:199466529-199466551 CAGTGGCAGGGAAAGATGGAAGG + Intronic
944611724 2:201416142-201416164 CTTTGGGAGGTCAAGGTGAAAGG + Intronic
944618531 2:201487111-201487133 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
944666873 2:201966138-201966160 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
944739638 2:202599245-202599267 CTTTGGGAGGCCAAGATGGATGG - Intergenic
944825336 2:203477742-203477764 CTTTAGGAGGGGGAAATGAATGG - Intronic
944986628 2:205184497-205184519 CTTTGGGAGGCGGAGATGAGTGG + Intronic
945002022 2:205361876-205361898 CTGGGGGTGGAGAAGATGAGTGG - Intronic
945056041 2:205869772-205869794 CTGGGGGATGGGAGGAGGAAAGG + Intergenic
945126369 2:206515527-206515549 CTGTAGGAGCAGAAGATTAAAGG - Intronic
945284531 2:208069151-208069173 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
945306380 2:208263359-208263381 CTTTGGGAGGCCAAGATGGAAGG - Intronic
945799277 2:214405550-214405572 CTTTGGGAGGCCAAGATGAGTGG + Intronic
946067453 2:217000440-217000462 CTTTGGGTGGGACAGATGAAGGG - Intergenic
946400688 2:219466916-219466938 CTGAGGGAGGGGAAACTGAGAGG - Intronic
946709369 2:222490686-222490708 CTGTGAGAGGCCAAGATGAAAGG - Intronic
946804339 2:223455639-223455661 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
947162679 2:227229803-227229825 CTGTGGGAGGCCAAGGTGAGTGG + Intronic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947519750 2:230836306-230836328 CTTTGGGAGGCCAAGAGGAATGG - Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
947565835 2:231192402-231192424 CTCCGGGCTGGGAAGATGAATGG + Intergenic
947661292 2:231870516-231870538 CTTTGGGAGGCCAAGATGGACGG - Intergenic
947776762 2:232718340-232718362 CTGTGGGAGGCTAAGGTGAGTGG - Intronic
948029638 2:234806653-234806675 CTGTGCTGGGGGAAGATGAGAGG + Intergenic
948331547 2:237170715-237170737 CTTTGGGAGGCTAAGGTGAACGG + Intergenic
948581056 2:238987332-238987354 TTGCGGGAGGGGAGGATGCAAGG - Intergenic
948744560 2:240078652-240078674 CTTTGGGAGGCTGAGATGAAAGG + Intergenic
948752835 2:240142403-240142425 CTGTGGGAGGTGGTGAAGAAGGG + Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1168902264 20:1375078-1375100 CTTTGGGAGGCCAAGATGGATGG - Intronic
1168930332 20:1618383-1618405 CTGAGGTAGGGGACAATGAATGG + Intronic
1169031143 20:2408028-2408050 CTATGGGAGGGAATGCTGAAGGG + Intronic
1169451252 20:5713559-5713581 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1169473083 20:5905111-5905133 CTTTGGGAGGTGAAGATGAGAGG + Intergenic
1170137753 20:13093982-13094004 CTGTGGGTGGGCAAAGTGAAAGG - Intronic
1170554862 20:17506766-17506788 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170844526 20:19951135-19951157 CTTTGGGAGGGCAAGGTGTATGG - Intronic
1170937990 20:20826140-20826162 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1171471150 20:25372446-25372468 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1172408721 20:34707163-34707185 CAGTGGGAGGTGATGATGAAGGG - Intronic
1172417616 20:34783865-34783887 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172569544 20:35958769-35958791 ATAGGGGAAGGGAAGATGAATGG - Intronic
1172682117 20:36724682-36724704 CTTTGGGAGGCGGAGATGGATGG + Intronic
1172730454 20:37082751-37082773 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1172958169 20:38777257-38777279 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1172963883 20:38819017-38819039 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1173062853 20:39678986-39679008 GTCTGGGAGGGGAGGATCAATGG - Intergenic
1173515405 20:43662223-43662245 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173576934 20:44118347-44118369 ATGTGGGATGGGATGATGCAGGG - Intronic
1173676963 20:44844252-44844274 CTGTGGGAGGCTAAGATGGGAGG + Intergenic
1173722330 20:45270235-45270257 CTCTGGGAGGCCAAGATGAGTGG + Intergenic
1173755119 20:45508928-45508950 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1174018573 20:47510187-47510209 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1174029640 20:47612068-47612090 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1174044547 20:47724242-47724264 CTGTGGGTGGGGAGAAGGAATGG + Intronic
1174108957 20:48184556-48184578 ATGTTGGAGAGGAAGATGACAGG - Intergenic
1174125234 20:48299559-48299581 TTGTGGGATGGGAAGAGGAGGGG - Intergenic
1174228781 20:49026827-49026849 CTTTGGGAGGCTAAGATGAGTGG - Intronic
1174281477 20:49442794-49442816 CTTTGGGAGGCCAAGATGGATGG - Intronic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1174608139 20:51776255-51776277 CTTTGGGAGGCCAAGATGACAGG + Intergenic
1175334518 20:58186352-58186374 CTTTGGGAGGCCAAGATGAAAGG + Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1176060488 20:63170361-63170383 CTGAGGGAGGGGAGGATGTGAGG - Intergenic
1176325767 21:5448822-5448844 CTGTGGGAGGCCAAGGTGAGTGG - Intergenic
1176362173 21:6006732-6006754 CTGTGGCCAGGGAAGATAAAAGG - Intergenic
1176376867 21:6091182-6091204 CTGCGGGAGGGGAAGATGCTGGG - Intergenic
1176403361 21:6337640-6337662 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
1176433796 21:6651464-6651486 CTGTGGGAGGCCAAGGTGAGTGG - Intergenic
1176582356 21:8543361-8543383 GCATGGGAGGGGAAGATGAGGGG - Intergenic
1176599505 21:8778894-8778916 CGGGGGGAGGGGCAGATGACAGG - Intergenic
1177039924 21:16095751-16095773 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1178249424 21:30987640-30987662 GGGTGGGAGGGGAAGTAGAAAGG + Intergenic
1178300633 21:31450013-31450035 CTGTGGGGAGGGAAGAGGCAAGG - Intronic
1178355109 21:31904846-31904868 CTTTGGGAGGCCAAGGTGAACGG + Intronic
1178488997 21:33036159-33036181 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1178632357 21:34273650-34273672 CTGTGGGAGAGGAATGTGATTGG - Intergenic
1178795477 21:35740082-35740104 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1178818350 21:35952076-35952098 CTTTGGGAGGCCAAGATGGATGG + Intronic
1179042361 21:37815436-37815458 CTTGGGGAGGGGGAGAAGAATGG + Intronic
1179080108 21:38162894-38162916 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1179215734 21:39365906-39365928 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1179367532 21:40772410-40772432 CTTTGGGAGGCCAAGATGAGTGG - Intronic
1179746608 21:43447062-43447084 CTGCGGGAGGGGAAGATGCTGGG + Intergenic
1179761345 21:43531813-43531835 CTGTGGCCAGGGAAGATAAAAGG + Intronic
1180057294 21:45365480-45365502 CCTTGGGAGGGGAAGAGGCAAGG + Intergenic
1180265191 22:10520409-10520431 GCATGGGAGGGGAAGATGAGGGG - Intergenic
1180566517 22:16671989-16672011 CTTTGGGAGGCCAAGATGGACGG - Intergenic
1180938568 22:19641931-19641953 AGGTGAGAGGGGAAGACGAAGGG + Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181152576 22:20895690-20895712 CTTTGGGAGGCCAAGATCAATGG + Intergenic
1181625436 22:24119495-24119517 CTGTGGGATGGGAAGAAGAGAGG + Exonic
1181663367 22:24370916-24370938 CTGGGGGAGGGAAAAAAGAAAGG + Intronic
1181779951 22:25185336-25185358 CAGTGGGCGGGGAAGAGGAGAGG - Intronic
1181973925 22:26714735-26714757 CTGCGAGAGGGGAAGATAACAGG - Intergenic
1182209191 22:28660036-28660058 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1182694003 22:32184431-32184453 CTGTGGGAGGGGGAGCTGTTAGG + Intergenic
1182724049 22:32428375-32428397 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1182865001 22:33596663-33596685 TTGTTGGAGGAGAAGAGGAAGGG + Intronic
1182897493 22:33870809-33870831 CTTTGGGAGGCCAAGGTGAACGG - Intronic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183558815 22:38553578-38553600 CTTTGGGAGGATGAGATGAATGG + Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183762324 22:39833048-39833070 CTGGGGGACAGGAAGAGGAAGGG - Intronic
1183959626 22:41403646-41403668 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
1184024347 22:41843749-41843771 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1184183059 22:42844086-42844108 CAGTGGGAGGGGAAGAAGAGGGG + Intronic
1184465708 22:44668257-44668279 GGGAGGGAGGGGAAGACGAATGG - Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184791089 22:46700480-46700502 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
1185207133 22:49546372-49546394 GTGTGGGAGGTGGAGAAGAAGGG - Intronic
949128335 3:472346-472368 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
949182049 3:1144330-1144352 CTTTGGGAGGCCAAGATGGACGG + Intronic
949372805 3:3353817-3353839 CTGTGGGAGGCCAAGATGAGAGG - Intergenic
949767769 3:7546298-7546320 CTGAGGGAGGGATAGATGGATGG - Intronic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
949991041 3:9579385-9579407 CTGTGGGAGGCCAAGACGGAAGG + Intergenic
950256372 3:11510078-11510100 CTGGGGGAGGGGCAGAAGATGGG - Intronic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
950468280 3:13168653-13168675 CTGTGTGAGGGCAGAATGAAAGG - Intergenic
950674448 3:14546129-14546151 CTGTGGGTGGGGTAGAGGGAGGG + Intergenic
950851350 3:16064757-16064779 ATGTGCAAGGGGAAGATTAATGG + Intergenic
950867170 3:16198495-16198517 CAGTGGAAGGGGAGAATGAATGG + Intronic
950948703 3:16977337-16977359 CTGTGGGAGGGGAACAATGAGGG - Intronic
951848348 3:27109477-27109499 CCGTGGTAAGGGAAGATAAATGG - Intergenic
953089152 3:39706390-39706412 CTCTGGGAGGCCAAGATGAGTGG - Intergenic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
953355467 3:42252800-42252822 CTGTGGGAGGCCAAGATGGGCGG - Intergenic
953489226 3:43334205-43334227 CTTTGGGAGGCCAAGATGGAAGG + Intronic
953552926 3:43918277-43918299 CTGGAGGAGGGGGAGAGGAAGGG + Intergenic
953633004 3:44635844-44635866 CAGTGGGAGGAGGAGATGGATGG + Intronic
953724169 3:45382920-45382942 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
953844371 3:46415619-46415641 CTCTGGGAGGCGAAGGTGAGAGG + Intergenic
954525697 3:51268869-51268891 CTGTGGGAGGGGAATCAAAAAGG - Intronic
954815216 3:53274950-53274972 CTTTGGGAGGCGAAGGTGAGAGG - Intergenic
955042137 3:55328019-55328041 CTTTGGGAGGCTAAGATGGAAGG - Intergenic
955192224 3:56772055-56772077 ATCTGGGAGAGCAAGATGAAGGG - Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955608745 3:60734606-60734628 CTTTGGGAGGCCAAGATGAGTGG - Intronic
955756876 3:62233694-62233716 CTGTGGGACAGGGAGATGACAGG - Intronic
956792033 3:72687364-72687386 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
957353324 3:79053279-79053301 GTGGGGGAGGAGTAGATGAAGGG - Intronic
957803660 3:85118990-85119012 CTTTGGGAGGCCAAGATGGATGG - Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958068146 3:88572097-88572119 CTTTGGGAGGCCAAGGTGAACGG + Intergenic
958194192 3:90221364-90221386 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
959372411 3:105544290-105544312 CTTTGATAGGGGAAGATGTAAGG - Intronic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
959801879 3:110504798-110504820 CTTTGGGAGGCGAAGGTGAGAGG + Intergenic
960101267 3:113745942-113745964 CAGCAGGCGGGGAAGATGAAAGG - Exonic
960725391 3:120664672-120664694 CTTTGGGAGGCCAAGATGAGAGG - Intronic
960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG + Intronic
961180581 3:124873415-124873437 GTGGGGGAGGGGAGGAAGAAGGG - Intronic
961530758 3:127538685-127538707 CTGTGGCATGGGACCATGAATGG - Intergenic
961790476 3:129372528-129372550 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
962479512 3:135786302-135786324 CTTTGGGAGGACAAGGTGAATGG + Intergenic
962700680 3:137996926-137996948 CAGTGGGAGGGCAGGAGGAAGGG - Intergenic
962737795 3:138341066-138341088 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
962817121 3:139011205-139011227 CTTTGGGAGGCCAAGATGGATGG - Intronic
963102377 3:141619708-141619730 CAGTGGGAGGGGTAGACGAGTGG - Intergenic
963102578 3:141621136-141621158 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963737735 3:149038754-149038776 CTTTGGGAGGCCAAGGTGAATGG - Intronic
963767551 3:149353324-149353346 CTGAGGGTGGGGAAAATAAAAGG - Intergenic
963833320 3:150031874-150031896 GTTTGGGAGGGGAACATGAGTGG - Intronic
963902889 3:150749253-150749275 CTCTGGGAGGCCGAGATGAAGGG + Intronic
965355660 3:167670076-167670098 CAGTGAGAGAGGAAGCTGAAAGG - Intergenic
965523837 3:169696247-169696269 CTGTGGGAGGGGATTATGAATGG - Intergenic
965599889 3:170444302-170444324 CTTGGGGAGGGGGAGATGAGTGG - Intronic
965727968 3:171739534-171739556 AAGTGGGAGGGAAAGTTGAAGGG - Intronic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966401120 3:179547696-179547718 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
967351635 3:188520280-188520302 AGGTGGGAGGGGAAGATGCGAGG - Intronic
967697172 3:192545445-192545467 CTGTGGGAGAGAAAGATCAGTGG - Intronic
967941816 3:194772232-194772254 GTGTTTGATGGGAAGATGAAAGG + Intergenic
968176652 3:196556289-196556311 CTTTGGGAGGTGGAGATGAGTGG - Intronic
968223185 3:196953755-196953777 CTTTGGGAGGCTGAGATGAAAGG + Intronic
968276235 3:197442417-197442439 CTGTGGGAGGTCGAGATGGAAGG + Intergenic
968674333 4:1869750-1869772 CTGTGGGAGGCCAAAGTGAAAGG - Intergenic
968729713 4:2263938-2263960 CTGTGGGGCGGGAACAGGAAGGG - Intergenic
968825463 4:2893170-2893192 CTTTGGGAGGCGAAGATGGGTGG - Intronic
969525146 4:7700481-7700503 CTGTCGGATGGGTAGATCAATGG + Intronic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
970587238 4:17526314-17526336 CTTTGGGAGGCCAAGGTGAATGG + Intronic
972589183 4:40468040-40468062 CTTTGGGAGGTCAAGATGAGTGG + Intronic
973816850 4:54627075-54627097 CTGTGGGAGGCTGAGATGGAGGG - Intergenic
973959683 4:56097282-56097304 CTGGGAGAGTGGAAGATGAATGG + Intergenic
974126353 4:57701159-57701181 ATGAGGGAGGGGAATATGGAGGG - Intergenic
974231604 4:59122806-59122828 CTTTGGGAGGCCAAGGTGAAGGG - Intergenic
974365811 4:60947301-60947323 CTTTGGGAGGTGAAGATGGGAGG - Intergenic
974903666 4:68032168-68032190 AGGTGGGAGGGAAAGAAGAAAGG - Intergenic
975144383 4:70951652-70951674 CTTTGGGAGGCCAAGATGAGGGG + Intronic
975177397 4:71303756-71303778 GGGAGGGAGGGGAAGAAGAAAGG - Intronic
975804560 4:78098516-78098538 CTTTGGGAGGCCAAGATGGATGG - Intronic
976301714 4:83521789-83521811 CTTTGGGAGGCCAAGATGGAAGG - Intronic
976361721 4:84186944-84186966 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
976628760 4:87216146-87216168 CTGGGGGTGGGGAAGAAGAGAGG + Intronic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
977344543 4:95800662-95800684 CTTTGGGAGGTGAAGGTGAGAGG - Intergenic
977350546 4:95880018-95880040 CAGTGGGAGAGGAATAAGAATGG - Intergenic
977749117 4:100587378-100587400 GGGTTGGAGGGGAAGAAGAAAGG + Intronic
977989013 4:103419280-103419302 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
978221068 4:106274886-106274908 CTGTGGGAGGCCAAGGTGAGAGG + Intronic
978421967 4:108542645-108542667 GGGGGAGAGGGGAAGATGAAAGG - Intergenic
978555365 4:109973663-109973685 AGGTGGGAGGGGAAGAGAAAGGG - Intronic
978810612 4:112845580-112845602 CTGGGGTTGGGGAAGTTGAATGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979375502 4:119941856-119941878 CTGAGGGTAGGAAAGATGAAGGG + Intergenic
979940056 4:126751208-126751230 ATGTTGGAGGGTGAGATGAAGGG - Intergenic
979960816 4:127019269-127019291 CTTTGGGAGGCTAAGATGGAAGG - Intergenic
980324105 4:131318801-131318823 CTGTGGGCGGAGAAGATGCTTGG + Intergenic
980455136 4:133029798-133029820 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
980921598 4:139091721-139091743 CTGTGGGAGGCCAAGATGGGAGG - Intronic
980985750 4:139692518-139692540 CTGTGGCAGAGGGAGATTAAGGG + Intronic
981596276 4:146426433-146426455 CTTTGGGAGGCCAAGGTGAAAGG + Intronic
982133976 4:152256565-152256587 CTCTGGGAGGGGCAGATCAGTGG - Intergenic
982183710 4:152775156-152775178 CTTTGGGAGGCCAAGGTGAACGG - Intronic
982203127 4:152977146-152977168 CTTTGGGAGGCTAAGATGAGTGG + Exonic
982219922 4:153115539-153115561 CTTTGGGAAGGGAACGTGAATGG + Intergenic
982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG + Intronic
983523084 4:168731052-168731074 CTGAAGGTGGGGAAGAGGAATGG - Intronic
983608596 4:169617979-169618001 CTTTGGGAGGCCAAGATGGACGG - Intronic
983942310 4:173548009-173548031 CTGTGTGAGTGGAACAGGAATGG - Intergenic
984518286 4:180769305-180769327 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
984884049 4:184434306-184434328 GTGTGGGCCGGGAAGATGGAGGG - Intronic
985840150 5:2299967-2299989 CTGCTGGAGTGGAAGAGGAAAGG - Intergenic
986060764 5:4187999-4188021 CTTTGGGAGAGGAGGAGGAAGGG + Intergenic
986406647 5:7432189-7432211 CGGTGGGAAGGGGAGCTGAAAGG - Intronic
986820995 5:11466785-11466807 GTGGGGGAGGGGAAGATAAAAGG - Intronic
986924053 5:12724043-12724065 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
987128741 5:14840862-14840884 CTATGGAAAGGGAAAATGAACGG + Intronic
987743844 5:21945179-21945201 CTGTGGGAGGCCAAGATGGGTGG + Intronic
987871026 5:23616939-23616961 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
988938536 5:36116915-36116937 CTTTGGGAGGCGAAGGCGAATGG - Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989127822 5:38074134-38074156 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
989220617 5:38957992-38958014 CTGTGGGAGGCCAAGGTGAGTGG + Intronic
989383295 5:40830361-40830383 CTTTGGGAGGCCAAGATGAGAGG + Exonic
989642545 5:43597179-43597201 CTTTGGGAGGCCAAGATGAGCGG - Intergenic
990917950 5:60931550-60931572 CTTTGGGAGGTGAAGGTGAGAGG - Intronic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
991442321 5:66663864-66663886 TTGTGGGAGGCTAAGATGGAAGG + Intronic
991764046 5:69955319-69955341 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
991783279 5:70162816-70162838 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
991843278 5:70830389-70830411 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
991875723 5:71163152-71163174 CTGTGGGAGGCCAAGATGGGTGG - Intergenic
991914628 5:71593629-71593651 CTTTGGGAGGCCAAGATGAGAGG - Intronic
992011291 5:72530346-72530368 CGATGGCAGGAGAAGATGAAGGG + Intergenic
992182943 5:74215580-74215602 CAGTGGAAGGGGCAGAGGAAAGG + Intergenic
992314706 5:75540540-75540562 CTTTGGGAGGCCAAGATGGAAGG - Intronic
992409616 5:76492542-76492564 CAGTGGGAGGGAAGGAAGAAAGG + Intronic
992431921 5:76718006-76718028 CTTTGGGAGGGAAAGAAGAAAGG + Intronic
992694773 5:79275402-79275424 CTGTGGGAGGCCAAGATGGGTGG - Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
992921320 5:81524792-81524814 CACAGGGAGGGGAAGAAGAATGG + Intronic
992927641 5:81606355-81606377 CTGTGGGAGGTCACAATGAATGG - Intronic
992931330 5:81649630-81649652 GGGAGGGAGGGGAACATGAATGG + Intronic
993699799 5:91105110-91105132 CTTTGGGAGGCCAAGATGAGTGG - Intronic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
994967818 5:106696874-106696896 CTTTGGGAGGCCAAGATGGATGG + Intergenic
995155312 5:108904429-108904451 CAGTGGGAAGAGCAGATGAAAGG + Intronic
995380526 5:111527378-111527400 CTGTGGTAGCAGCAGATGAATGG - Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
996619020 5:125477775-125477797 CCGTGGGAGGTGAAGCAGAAAGG + Intergenic
996679512 5:126215992-126216014 CTCTGGGAGGCGAAGGCGAATGG + Intergenic
996717282 5:126598121-126598143 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
997035758 5:130189517-130189539 CTGTTGGGGTGGAAGAGGAAAGG - Intergenic
997229094 5:132229764-132229786 GTGTGGAGGGGGAAGATGTAGGG - Intronic
997317885 5:132953080-132953102 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
997460250 5:134047096-134047118 CTTTGGGAGGGGCAGGAGAAAGG - Intergenic
997493168 5:134296702-134296724 CTTTGGGAGGCCAAGGTGAAAGG + Intronic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
997754896 5:136386951-136386973 CAGTGGGAGGAAAAGGTGAAGGG + Intronic
997826609 5:137112210-137112232 TGGTTGGAGGGGAAGAAGAAGGG - Intronic
997893280 5:137694084-137694106 CTGTGGGCAGGGATAATGAAGGG - Intronic
998016379 5:138735447-138735469 CTGTGGGAGGCCAAGATGGGTGG - Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998261670 5:140636360-140636382 CTTTGGGAGGCCAAGCTGAAAGG + Intergenic
998384584 5:141749387-141749409 CTGTGGGAGGACCAGAGGAATGG + Intergenic
998545018 5:143020189-143020211 CTTTGGGAGGCCAAGATGGAAGG - Intronic
998587427 5:143441931-143441953 CTTTGGGAGGGCAAGCTGAGGGG - Intergenic
999005731 5:147975424-147975446 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
999136676 5:149324982-149325004 GTGTGGGAGGGGACTATAAAAGG + Intronic
999185244 5:149702603-149702625 CTTTGGGAGGGCAAGGTGAGGGG - Intergenic
999318027 5:150596665-150596687 CTGTGGGAGGGGTAGATCACTGG - Intergenic
999642808 5:153688961-153688983 CTTTGGGAGGCGGAGGTGAATGG - Intronic
999822037 5:155237976-155237998 CTGTGTGGGAGGAAGTTGAAGGG + Intergenic
1000179299 5:158792361-158792383 CTGAGGGGTGGGAAGAAGAAAGG - Intronic
1000501283 5:162054129-162054151 CATTGGGAGGGCAAGATGAGAGG + Intergenic
1000630985 5:163590576-163590598 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1000711466 5:164585285-164585307 CTGAGGAAGGTGTAGATGAAAGG + Intergenic
1000736213 5:164903653-164903675 CAGTGGGAGGTTAATATGAATGG + Intergenic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1002110291 5:176904727-176904749 CTGTGTGAGTACAAGATGAAGGG + Intergenic
1002327719 5:178420611-178420633 CTCAGGGAGGGGAGGAGGAAAGG - Intronic
1002353148 5:178599482-178599504 CTTTGGGAGGCTAAGGTGAAAGG + Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002617685 5:180465846-180465868 TTCTGGGTGGGGAAGGTGAAAGG - Intergenic
1002755254 6:153143-153165 ATGGGAGAGGGGAAGTTGAAGGG + Intergenic
1002872190 6:1177105-1177127 GCGTGGGAGAGGTAGATGAAGGG + Intergenic
1002968454 6:1990825-1990847 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1003132102 6:3403517-3403539 CTGTGATAGGGTAAGATTAATGG - Intronic
1003548341 6:7080012-7080034 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1003701797 6:8474137-8474159 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1003913320 6:10762253-10762275 ATCGGGGAGGGGCAGATGAAGGG + Intronic
1003914723 6:10776029-10776051 CTTTGGGAGGCCAAGGTGAACGG - Intronic
1004136898 6:12976105-12976127 CTGGGGGAGGGGGTGATGGAAGG + Intronic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1004497370 6:16177188-16177210 CTTTGGGAGTGGGAGAAGAAAGG - Intergenic
1004545666 6:16596238-16596260 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1005121809 6:22398536-22398558 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1005378324 6:25207768-25207790 CTGTGGGAGGGGCAGCTGTGGGG + Intergenic
1005439915 6:25856480-25856502 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1005453380 6:25995301-25995323 CTTTGGGAGGCCAAGATGTACGG - Intergenic
1005807905 6:29492221-29492243 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1005957719 6:30676307-30676329 CTGGGGGAGAGGAAAATGATGGG - Intergenic
1005978513 6:30818138-30818160 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006181764 6:32157817-32157839 CTGTAGGATGGGAAGAAGAGAGG - Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006492876 6:34399642-34399664 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1006539545 6:34728489-34728511 CTTTGGGAGGCCAAGGTGAATGG - Intergenic
1006543750 6:34762058-34762080 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1006596762 6:35199177-35199199 CTGTGAGAGAGAAAGATAAATGG - Intergenic
1006755632 6:36412702-36412724 CTTTGGGAGGCCAAGATGAAAGG - Intronic
1006882175 6:37350090-37350112 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1007225381 6:40310005-40310027 CAGTGGGAGGGCAACATGCATGG - Intergenic
1007360720 6:41353343-41353365 CTGAGGGAAGGGAACAGGAAGGG + Intergenic
1007542732 6:42663913-42663935 CTTTGAGAGGCCAAGATGAAAGG + Intronic
1007823233 6:44577729-44577751 ATGTGGGGGGAAAAGATGAAGGG - Intergenic
1007825704 6:44599092-44599114 CTTAGGGAGGGGGAGCTGAAGGG - Intergenic
1008097913 6:47358922-47358944 CTTTGGGAGGTCAAGATGAGAGG + Intergenic
1008102631 6:47408638-47408660 CTTTGGGAGGCCAAGGTGAAAGG - Intergenic
1008605272 6:53133735-53133757 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1008747126 6:54685355-54685377 GAATGGGAGGTGAAGATGAAAGG - Intergenic
1008761825 6:54861309-54861331 CTTTGGGAAGCCAAGATGAATGG + Intronic
1009354658 6:62727782-62727804 CTGTAAGAGGGGAATATCAATGG + Intergenic
1009826694 6:68875220-68875242 CAGAGGGAGGGGGAGAGGAAGGG - Intronic
1010431064 6:75779140-75779162 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1010887417 6:81261874-81261896 GAGGGGGAGGGGAAGAGGAAGGG + Intergenic
1010929663 6:81785920-81785942 CTGGGGCAGGGGCAGATGTATGG + Intergenic
1011040681 6:83026911-83026933 CTTTGGGAGGCGGAGATGAGAGG - Intronic
1011071406 6:83388870-83388892 CTTTGGGAGGCCAAGATGGATGG + Intronic
1011626861 6:89290280-89290302 CTGTGGCAGGAAAAGAAGAAAGG - Intronic
1012424179 6:99096040-99096062 AGCTGGGAGAGGAAGATGAAAGG + Intergenic
1012472177 6:99584497-99584519 CTTTGGGAGGCGAAGGTGAGTGG - Intergenic
1012768174 6:103396245-103396267 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1013150789 6:107444272-107444294 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1013236572 6:108201946-108201968 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013530272 6:111012911-111012933 CTTTGGGAGGCCAAGATGAGTGG - Intronic
1014101348 6:117515263-117515285 CTGTGGGAGGCCAAGGTGAGCGG - Intronic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015504952 6:133974568-133974590 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1015921689 6:138272398-138272420 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1015998691 6:139020727-139020749 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1016558069 6:145361951-145361973 CTTTGGGAGGCGAAGATGGGTGG + Intergenic
1018001383 6:159581453-159581475 CTGTAGGAGGGGAACGGGAAAGG + Intergenic
1018115638 6:160581543-160581565 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1018304137 6:162436846-162436868 CTTTGGGAGGACAAGATGAGTGG + Intronic
1018320660 6:162604728-162604750 CTGTCAGAGGTGAAAATGAATGG - Intronic
1018379072 6:163241160-163241182 CTGAGAGAGGGGAAGAAAAAAGG + Intronic
1018524459 6:164692961-164692983 CAGTGAGAGGGGCAGCTGAACGG - Intergenic
1018731722 6:166656595-166656617 CTCTGGGATGCGAAGATGGATGG + Intronic
1018745942 6:166762206-166762228 CTGAGGGAGGGGAGGACGCAGGG - Intronic
1018830995 6:167443503-167443525 GAGTGGGTGGGGAAGATGAAGGG + Intergenic
1018968306 6:168506277-168506299 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1019042318 6:169117474-169117496 CAGTGGGAAGGGGAGCTGAAAGG - Intergenic
1019054313 6:169212101-169212123 ATGGTGGAGAGGAAGATGAAGGG + Intergenic
1019207465 6:170374684-170374706 CTGAGTGAAGGGAAGAAGAAAGG - Intronic
1019466548 7:1192698-1192720 CTGTGGGAGGCCAAGGTGAGAGG + Intergenic
1020162806 7:5785079-5785101 CTTTAGGAGGGCAAGATGGAAGG - Intergenic
1021064468 7:16156512-16156534 CTGTGGGAGAGGCAGAAGTATGG - Intronic
1021165407 7:17333606-17333628 CTGTGTGAGGTGAAAATGATAGG + Intronic
1021776981 7:24063884-24063906 GTGGGGGAGGGGAAGATGACAGG - Intergenic
1022327315 7:29344028-29344050 CTTGGGCAGAGGAAGATGAATGG - Intronic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1022503556 7:30897101-30897123 CTGGGGGAGGGAAAGAGGCAGGG - Intergenic
1023075503 7:36478297-36478319 CTTTTGGAGGCCAAGATGAAAGG - Intergenic
1023330939 7:39116139-39116161 CTTTGGGAGGCCAAGATGGAAGG + Intronic
1023374136 7:39539310-39539332 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
1023849806 7:44144410-44144432 CTATGGGAGCTGAAGATGTAGGG + Exonic
1023957725 7:44900993-44901015 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1024287122 7:47767805-47767827 GTGTTGGAGGGGATGATGAATGG - Intronic
1024570835 7:50721875-50721897 CTGTGGGAAGGGAAGGTGTCTGG + Intronic
1025775697 7:64558932-64558954 AAGTGGGAGGGGAAGAAAAAAGG + Intronic
1025868783 7:65411031-65411053 CTTTGGGAGGCAAAGATGAGAGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026118151 7:67513693-67513715 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1026476692 7:70742517-70742539 CTTTGGGAGGCGAAGGTGAGTGG + Intronic
1026647179 7:72181716-72181738 CTTTGGGAGGCCAAGATGGACGG - Intronic
1026662020 7:72310658-72310680 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1026705400 7:72687190-72687212 CTTTGGGAGGGTAAGATGGGTGG + Intronic
1026799888 7:73393428-73393450 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1026837836 7:73649963-73649985 GTGTGGGATGGAAAGAAGAAAGG + Intergenic
1026839190 7:73659552-73659574 CTTTGGGAGGCCAAGACGAATGG - Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027047708 7:75002167-75002189 CTTTGGGAGGTGGAGGTGAATGG - Intronic
1027056654 7:75054145-75054167 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1027208869 7:76127545-76127567 CTTTGGGAGGCCACGATGAATGG - Intergenic
1027210277 7:76141556-76141578 CTTTGGGAGGGGTAGAGGCAGGG + Intergenic
1027506956 7:79027968-79027990 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1027545691 7:79524783-79524805 ATGTGGGGGGGGAGGATAAAGGG + Intergenic
1028577371 7:92366951-92366973 CTAGGGAAGGGGAAGAAGAATGG + Intronic
1028920134 7:96301869-96301891 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1028986910 7:97016566-97016588 CTGTGGGAGGGGGTGCTTAAGGG + Intergenic
1029142565 7:98421895-98421917 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1029188613 7:98756317-98756339 CTGGGGGAGGGGGAGATACAAGG - Intergenic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029385288 7:100239481-100239503 CTTTGGGAGGTGGAGGTGAATGG + Intronic
1029425728 7:100493095-100493117 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1029466644 7:100729626-100729648 CTGTGGGAGGCCAAGGTGAGAGG + Intergenic
1029795849 7:102893812-102893834 ATGGGGGAGGGGGAGAAGAAGGG + Intronic
1030360380 7:108589349-108589371 CTCTGGGAGGTGGAGATGCAAGG - Intergenic
1030674397 7:112369472-112369494 TTCTGGGGTGGGAAGATGAAAGG + Intergenic
1030677070 7:112395110-112395132 CTTTGGGAGGCTGAGATGAAAGG - Intergenic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031737880 7:125389581-125389603 TTGTGGGAGGGTAAGGTGATTGG + Intergenic
1031863989 7:127017370-127017392 ATGTGGGATGGCAAGATCAAGGG - Intronic
1031884574 7:127232491-127232513 CTGTGGGAGGCCAAGGTGGATGG - Intronic
1031937776 7:127753475-127753497 TGGTGGCAGGGGAAGAGGAAAGG - Intronic
1031940627 7:127785150-127785172 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1032218812 7:129978424-129978446 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1032505515 7:132431503-132431525 CTGTGAGAGGGAAGGAGGAAGGG + Intronic
1032665934 7:134036342-134036364 CTTTGGGAGGCCAAGATGGATGG + Intronic
1033128158 7:138722813-138722835 CTGTGGGAGGCCAAGTTGAGAGG + Intronic
1033173365 7:139103342-139103364 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1033284844 7:140032418-140032440 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1033467901 7:141613160-141613182 GTGAGGCAGGAGAAGATGAAGGG + Intronic
1034145754 7:148869975-148869997 CTCTGGGAGGCCAAGGTGAAAGG + Intronic
1034316040 7:150134291-150134313 CAGGAGGAGAGGAAGATGAACGG + Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034406142 7:150903581-150903603 ATGTGGGATGGGAAGAAGCAGGG - Intergenic
1034790848 7:153966490-153966512 CAGGAGGAGAGGAAGATGAACGG - Intronic
1034944937 7:155255689-155255711 GAGGGGGAGGGGAAGAAGAAGGG + Intergenic
1035438062 7:158874144-158874166 CTTTGGGAGGTCAAGATAAATGG - Intronic
1035481767 7:159192592-159192614 CTGTGGGAGGGAAGGAAGCAGGG + Intergenic
1035766140 8:2107214-2107236 CTGTGGGTGGGGTAGATGACGGG - Intronic
1035937059 8:3852651-3852673 CTGAGGCAGGCCAAGATGAATGG + Intronic
1036046443 8:5146563-5146585 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1036047516 8:5160384-5160406 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1036142776 8:6223683-6223705 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1036658899 8:10695089-10695111 ATGGGGGAGGGGAAGGGGAATGG + Intronic
1036783124 8:11663878-11663900 CTTTGGGAGGTGGAGATGGAGGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037333370 8:17767056-17767078 GTGTGGGTGGGGAGAATGAATGG + Intronic
1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1038433119 8:27515695-27515717 CTGTGGAAGGGAAAGAGGAGAGG - Intronic
1038486350 8:27937761-27937783 CTGTGGGAGGGCAAGAGAGAAGG - Intronic
1038807174 8:30805110-30805132 CTGTGGGCAGTGAAGAAGAAAGG - Intronic
1038840123 8:31177070-31177092 GTGGGGGAGGGGCAGTTGAAAGG - Intergenic
1039269063 8:35860963-35860985 CTTTGGGAGGTCAAGATGAGAGG - Intergenic
1039298424 8:36182798-36182820 CTTTGGGAGGCTAAGATGAGTGG - Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039620430 8:38992220-38992242 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1039652473 8:39357401-39357423 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1040929899 8:52722427-52722449 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1040953918 8:52961131-52961153 CTGTTGGATGGGGTGATGAAGGG - Intergenic
1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG + Intergenic
1041150078 8:54922953-54922975 CTTTGGGAAGGGAAGCAGAAGGG + Intergenic
1041198201 8:55422873-55422895 ATGGGAGAGGGGAAGATAAATGG + Intronic
1041224298 8:55683494-55683516 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1041739686 8:61144972-61144994 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1041755136 8:61305314-61305336 GAGTGGGAAGGGAGGATGAAGGG - Intronic
1041837457 8:62232545-62232567 CTTTGGGAGGCCAAGATGAGAGG + Intergenic
1042009823 8:64230404-64230426 GTGTAGGAAGGGAAGAAGAAAGG + Intergenic
1042153767 8:65819151-65819173 CTTTGGGAGGCCAAGGTGAAAGG + Intronic
1043367217 8:79547281-79547303 CTGTGGGAGGCCAAGATGGGTGG + Intergenic
1043480350 8:80646234-80646256 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1044094778 8:88049778-88049800 CTTTGGGAGGCCAAGATGGATGG + Intronic
1044180085 8:89181263-89181285 CTTTGGGAGGCCAAAATGAAAGG + Intergenic
1044237284 8:89845579-89845601 CTGTGGGTCGGGAATTTGAAAGG - Intergenic
1044261630 8:90131468-90131490 CTGTGGGAGGCTAAGAGGATGGG + Intergenic
1044362775 8:91307940-91307962 CTTTGGAAGGCCAAGATGAAAGG - Intronic
1044744042 8:95355085-95355107 TTTTGGGAGGGGGTGATGAAGGG + Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045368819 8:101500752-101500774 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1045665342 8:104478341-104478363 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1045678013 8:104629592-104629614 CTTTGGGAGGCGGAGGTGAATGG + Intronic
1046072313 8:109271607-109271629 CTGGAGGAGGGCAAGAAGAATGG + Intronic
1046726595 8:117681556-117681578 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1046836079 8:118803077-118803099 CTGTAGGAGGGGAAGCAGATGGG + Intergenic
1046927429 8:119806709-119806731 CTTTGGGAGGCCAAGGTGAATGG - Intronic
1047134800 8:122064833-122064855 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1047237416 8:123054074-123054096 CTTTGGGAGGCCAAGATGAGTGG - Intronic
1047325073 8:123828250-123828272 CTGTGGGAGTGACAGACGAAGGG - Intergenic
1047437861 8:124849722-124849744 CTTTGGGAGGCAAAGATGAGAGG - Intergenic
1047503420 8:125460035-125460057 CTGTGCTAAGGGAAGATGATGGG - Intergenic
1047681183 8:127255916-127255938 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1047802634 8:128325821-128325843 CTGTGGTCAGGGAAGATGAATGG + Intergenic
1047907977 8:129493178-129493200 GTGTGGGAGGGGAGGACAAAGGG + Intergenic
1048372083 8:133787537-133787559 ATGAGTGAAGGGAAGATGAATGG + Intergenic
1048879763 8:138862533-138862555 CAGTGGGAGGGTAAGAAAAAAGG - Intronic
1049087440 8:140489498-140489520 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1049136784 8:140909166-140909188 CTGTTGGAAGGGAAGGGGAAGGG + Intronic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1050492241 9:6200291-6200313 TTCTGTGAGGGGAAGATGATGGG - Intergenic
1050572736 9:6958339-6958361 CTTTGGGAGGCCAAGATGAGTGG + Intronic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051745575 9:20291910-20291932 CTCTGGGTGGGGAAAATGGAGGG + Intergenic
1051850672 9:21503845-21503867 CGGTGGGAGGTGAAGCTGAAAGG + Intergenic
1052812262 9:33072088-33072110 CTGTGGGAGGCCAAGATGGGCGG + Intronic
1052872304 9:33519777-33519799 CTTTGGGAGGCCAAGATGGAGGG + Intergenic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053085256 9:35214182-35214204 CTTTGGGAGGTGGAGATGAGTGG + Intronic
1053132483 9:35624421-35624443 CAGTGGGAGTTAAAGATGAAAGG + Intronic
1053155739 9:35777560-35777582 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1053225483 9:36352054-36352076 CTTTGGGAGGGTAAGATGGGCGG + Intronic
1053596945 9:39572555-39572577 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1054569311 9:66792443-66792465 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1054895374 9:70304322-70304344 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1054987110 9:71274502-71274524 CTGTAGGAAGGGAAGATGACAGG - Intronic
1055305914 9:74928784-74928806 CTTTGGGAGGCCAAGGTGAAAGG + Intergenic
1055441095 9:76337415-76337437 CTTTGGGAGGCCAAGATGAGAGG - Intronic
1055487648 9:76772805-76772827 CTGTGGGAGGCCAAGATGGGAGG - Intronic
1055515705 9:77031136-77031158 GGGAGGGAGGGGAAGAGGAAAGG - Intergenic
1055562749 9:77537214-77537236 GGTTGGGAGGGGAGGATGAAGGG - Intronic
1055571617 9:77622969-77622991 CTTTGGGAGGCCAAGATGAGCGG + Intronic
1055704081 9:78978732-78978754 CTTTGGGAGGCCAAGATGAGAGG - Intergenic
1055834981 9:80429241-80429263 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056017183 9:82402157-82402179 CTTTGGGAGGCCAAGATGGATGG - Intergenic
1056110394 9:83389189-83389211 CTTTGGGAGGCCTAGATGAATGG - Intronic
1056346474 9:85701153-85701175 CTTTGGGAGGCCAAGATGAGTGG - Intronic
1056374851 9:85997725-85997747 CTTTGGGAGGCCAAGATGGAAGG - Intronic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057128621 9:92638180-92638202 CCGTTGGAAGGGAAGAAGAACGG + Exonic
1057135398 9:92683983-92684005 CTTTGGGAGGCCAAGATGAGTGG - Intergenic
1057156814 9:92849540-92849562 CTGTGGGAGGCTGAGATGAGAGG + Intronic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057865009 9:98673483-98673505 CTCTGAGAGGAGTAGATGAAGGG + Intronic
1057893585 9:98888464-98888486 CTGGCTGAGGGGAAGATGAGAGG - Intergenic
1058018133 9:100059440-100059462 CTTTGGGAGGCCAAGATGAGAGG + Intronic
1058035308 9:100245919-100245941 CTTTGGGAGGCCAAGATGGATGG + Intronic
1058043278 9:100328845-100328867 TTATGGGAGGGGAAGAGAAAGGG + Intronic
1058887048 9:109329623-109329645 CCGGGGGAGGGGGAGATGAAGGG - Intergenic
1058994614 9:110287571-110287593 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1059319693 9:113459504-113459526 CTGTGGGAGGCCAAGGTGTACGG + Intronic
1059463295 9:114449060-114449082 CTGTGGGATAGAAACATGAAGGG - Intronic
1059501200 9:114755752-114755774 GGGTGAGAGGGGAAGATGAAGGG - Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1060220323 9:121761077-121761099 CTTCGGGAGCGGAAGGTGAAAGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060368769 9:123048180-123048202 CTTTGGGAGGCCAAGATGGACGG - Intronic
1060486368 9:124049897-124049919 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1060674857 9:125504530-125504552 CTTTGGGAGGCCAAGATGGATGG + Intronic
1060694842 9:125699856-125699878 CTTTGGGAGGCCAAGATGAGTGG - Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061228857 9:129300458-129300480 GGGAGGGAGGGGAAGAAGAAAGG - Intergenic
1061255732 9:129453568-129453590 ATGGGGGACTGGAAGATGAAGGG + Intergenic
1061255802 9:129453763-129453785 ATGGGGGATGGGAAGATGGAGGG + Intergenic
1061491565 9:130947767-130947789 CTGGGGGAAAGGAAGATGACAGG - Intergenic
1061616009 9:131779512-131779534 CTGTGAGAGGCCAAGATGAGAGG - Intergenic
1062627817 9:137451086-137451108 GTGTGGCAGGGGAAGATCAAGGG - Intronic
1203437741 Un_GL000195v1:157206-157228 CTGTGGGAGGCCAAGGTGAGTGG + Intergenic
1203612373 Un_KI270749v1:21375-21397 GCATGGGAGGGGAAGATGAGGGG - Intergenic
1185532382 X:832295-832317 CTTTGGGAGGCCAAGATGGATGG + Intergenic
1185574923 X:1163691-1163713 CGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185836847 X:3352551-3352573 CTTTGGGAGGGCGAGATGGATGG - Intergenic
1185885239 X:3776585-3776607 CTGTGGGAGGCCAAGGTGAGCGG + Intergenic
1185891538 X:3826499-3826521 CTTTGGGAGGCCAAGGTGAATGG + Intronic
1185896648 X:3864911-3864933 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1185901766 X:3903338-3903360 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1185918831 X:4066460-4066482 CTGAGGGATTGTAAGATGAAAGG - Intergenic
1185971163 X:4666226-4666248 CTTTGGGAGGCTAAGATGGAAGG + Intergenic
1185999546 X:4993125-4993147 CTGTGGGATGCCAAGATGAAAGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186361513 X:8846780-8846802 CTTTGGGAGGCGAAGATGGGCGG + Intergenic
1186464132 X:9771302-9771324 CTCTGGGAGGCCAAGGTGAAAGG - Intronic
1187452825 X:19413682-19413704 GGGGGGGTGGGGAAGATGAAAGG + Intronic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187544341 X:20232889-20232911 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1188016513 X:25112853-25112875 CTGTGGGAGGCCAAGGTGGAAGG - Intergenic
1188561453 X:31473111-31473133 CTTTGGGAGGCCAAGGTGAACGG + Intronic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1188600447 X:31957085-31957107 CTGTGGGAGGCTAAGATGAGTGG + Intronic
1188603363 X:31996911-31996933 CTATGGGAAGGGAAGAGGAAAGG + Intronic
1188728256 X:33611582-33611604 CTTTGGGAGGCTAAGATGAAAGG + Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189226786 X:39419931-39419953 GTGGGGGAGGGGCAGAGGAATGG - Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189287775 X:39864378-39864400 CTTTGGGAGGCCAAGATGGAAGG + Intergenic
1189331223 X:40146089-40146111 GTGTGCTAGGGGAAGAGGAAGGG - Intronic
1189645157 X:43120217-43120239 GTGGGGGAGGGGTATATGAAGGG + Intergenic
1190227224 X:48555507-48555529 CTTTGGGAGGCCAAGGTGAAGGG + Intronic
1190443915 X:50503905-50503927 TTCTGGGAGGAGAAGATGGAAGG + Intergenic
1190562235 X:51696991-51697013 CCTGGGGAGGGGAAGAGGAAAGG - Intergenic
1190765088 X:53469395-53469417 CTTTGGGAGGCGAAGGTGAGTGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192301584 X:69909540-69909562 CTTTGGGAGGCCAAGGTGAACGG - Intronic
1192442995 X:71188797-71188819 CTGTGAGAGGTCAAGGTGAATGG + Intergenic
1192443832 X:71195262-71195284 CTGTGGGAGGCCAAGGTGAGTGG - Intergenic
1192582543 X:72296878-72296900 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1193432258 X:81422856-81422878 CTTTGGGAGGCTGAGATGAATGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195049750 X:101086362-101086384 CTGTGGGAGGCCAAGATGGGTGG - Intronic
1195595104 X:106679910-106679932 CTTTGGGAGGCCAAGATGAGTGG + Intergenic
1195764723 X:108283881-108283903 CTGTGGGGGAGGAAGATTGATGG + Intronic
1196383970 X:115127828-115127850 TTGTTGGAGGGTAAGGTGAATGG + Intronic
1197443985 X:126525908-126525930 CTTTGGGAGGCCAAGATGAATGG + Intergenic
1197737843 X:129865364-129865386 CTTTGGGAGGCCAAGATGAGCGG - Intergenic
1198080595 X:133235833-133235855 CTGTGGGAGGCCAAGGTGAGAGG - Intergenic
1198370992 X:135988862-135988884 CTTTGGGAGGCCAAGGTGAAAGG - Intronic
1198375371 X:136033604-136033626 ATGGGGAAAGGGAAGATGAAAGG - Intronic
1198613273 X:138425506-138425528 CGGTGGGAAGGGGAGCTGAAGGG - Intergenic
1198621044 X:138510286-138510308 CTTTGGGAGGCCAAGGTGAATGG + Intergenic
1198722624 X:139639533-139639555 CTCTGGGAGGGAAAGATGAGAGG - Intronic
1198768793 X:140106344-140106366 CTTTGGGAGGCCAAGATGGACGG - Intergenic
1199991104 X:152988221-152988243 CTTGGGGAGGGGGAGAGGAAGGG - Intergenic
1200238923 X:154483569-154483591 CTGGGGGAGGGCTGGATGAATGG - Intergenic
1200315755 X:155131887-155131909 GTGTGGGGAGGGAGGATGAATGG - Intronic
1201239724 Y:11947184-11947206 CTTTGGGAGGGCGAGATGGATGG + Intergenic
1201285626 Y:12376136-12376158 CTTTGGGAGGCCAAGATGGAAGG - Intergenic
1201637914 Y:16145897-16145919 CAGTGGGAAGGGGAGATTAAAGG - Intergenic
1201769628 Y:17607195-17607217 CTTTGGGAGGCAAAGATGAGAGG + Intergenic
1201831926 Y:18298790-18298812 CTTTGGGAGGCAAAGATGAGAGG - Intergenic
1201911018 Y:19133633-19133655 TTCTGGGAGGGGGAGATTAAAGG - Intergenic
1202065597 Y:20936181-20936203 CTTTGGGAGGCGGAGATGAATGG + Intergenic
1202132834 Y:21630080-21630102 CTTTGGGAGGGAAAGGTGTAAGG - Intergenic