ID: 1142761281

View in Genome Browser
Species Human (GRCh38)
Location 17:2043172-2043194
Sequence AGCAGTGAGTGGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142761281 Original CRISPR AGCAGTGAGTGGAGGGTCCT GGG (reversed) Exonic
900112612 1:1014901-1014923 AGCAGTAAGGGGTGAGTCCTTGG + Intergenic
900228757 1:1545299-1545321 AGCAGTGAGGGGAGAGGTCTGGG - Intronic
900954551 1:5878401-5878423 GGCTGTGAGTGGAGGGACCTGGG + Intronic
901053505 1:6437744-6437766 ATCAGTGAGTGGAGGTCCATGGG + Intronic
901376662 1:8844519-8844541 AGCAGTGGTTGGAGGGATCTGGG + Intergenic
901960857 1:12825543-12825565 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901967452 1:12880145-12880167 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901975251 1:12939276-12939298 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901982853 1:13050409-13050431 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901986168 1:13076929-13076951 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
901995642 1:13149838-13149860 AGGGGTGAGTGGAGGGTGGTGGG + Intergenic
901999236 1:13178509-13178531 AGGGGTGAGTGGAGGGTGGTGGG - Intergenic
902009924 1:13262488-13262510 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902017721 1:13321641-13321663 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902030782 1:13420635-13420657 AGGGGTGAGTGGAGGGTGGTAGG - Intronic
903061389 1:20671113-20671135 AGCAGTGAGTGGGAGGACCATGG - Intronic
903181079 1:21605096-21605118 AGCAGTGGGTGCAGTGTCCTGGG + Intronic
904093723 1:27961866-27961888 AGTTCTGGGTGGAGGGTCCTTGG + Intronic
904410817 1:30323827-30323849 AGCAGTGAGCTGAGGTTCCTGGG - Intergenic
906150581 1:43585211-43585233 AGCAGTGGGTGGAGGATGGTTGG + Intronic
910975413 1:92901316-92901338 AGCTGTGAGGCCAGGGTCCTAGG + Intronic
911098321 1:94073944-94073966 AGCAGTGGGTGGATGGTGGTGGG + Intronic
911544191 1:99196738-99196760 AGTAGTGAGTGGTGGGGCCTAGG - Intergenic
912033265 1:105276636-105276658 AACAGTGAGAGGAAGGTACTAGG + Intergenic
912852529 1:113139464-113139486 AGCAGTGTGTGCAGTGTCCAGGG - Intergenic
914239900 1:145846366-145846388 AACAGTGAGTGGGGGCTCCCTGG + Intronic
915325357 1:155079066-155079088 AGCAGTGAGTCGGGGACCCTGGG + Exonic
915565057 1:156708371-156708393 ATGAGAGAGTGGAGGGGCCTGGG + Intergenic
919703351 1:200653678-200653700 AGCAGTGAGGGGAGAGTGCTTGG - Intronic
919805803 1:201380458-201380480 AGCAGTGGGTGGGAGGTGCTCGG + Intronic
919972740 1:202591451-202591473 AGAGGTGAGTAGAGGGGCCTGGG - Exonic
920167170 1:204044195-204044217 AGCAGTGAGTGGAGGGTCTGGGG - Intergenic
920188505 1:204177499-204177521 GGGAGTGTGTGGAGGGTCCAAGG + Intergenic
922808629 1:228403520-228403542 AGCAGTGAGGAGAGAGGCCTGGG - Intronic
923273181 1:232375548-232375570 AGCAGGGAGTGGAGAGCCCAGGG - Intergenic
1063015871 10:2076515-2076537 AGCCCTGAGTGGAGGGTTTTGGG - Intergenic
1063437592 10:6047107-6047129 TGCAGGGATTTGAGGGTCCTTGG - Intronic
1064332558 10:14407480-14407502 GGCAGTGAGTGGGCAGTCCTGGG - Intronic
1067059804 10:43072439-43072461 AGCAGTCACTGGATGGTGCTAGG - Intergenic
1067224509 10:44366916-44366938 TGCTGTGAATGGAGGGGCCTGGG - Intergenic
1067508608 10:46876976-46876998 TGCAGTGCCTGAAGGGTCCTGGG + Intergenic
1068188628 10:53619969-53619991 GGCAGACAGAGGAGGGTCCTTGG - Intergenic
1069713585 10:70506664-70506686 AGGAGTGAGTGAAGGGCCCAGGG + Intronic
1070307139 10:75246327-75246349 AGCAGGGAGTGGTGGGGGCTGGG - Intergenic
1071564693 10:86665632-86665654 CCCAGTGTGTGGAGGGTCATCGG + Intronic
1072425261 10:95324666-95324688 GGCAGTGAGTGGAGGGTGGGTGG - Intronic
1072572655 10:96672299-96672321 AGCGCTGGGTGGAGGGTTCTGGG + Intronic
1073076018 10:100826386-100826408 AGCGGTGAGCGGAGGGCCCGTGG - Intronic
1074300126 10:112225969-112225991 AGCAGTCAGGGGAGGCTCCCAGG - Intergenic
1076139267 10:128066458-128066480 ACCAGTCATTGGAGGGGCCTGGG + Intronic
1076571630 10:131437208-131437230 GGCAGTGGGTGGAGGGTGATGGG - Intergenic
1076693685 10:132236869-132236891 AGCAGGGAGTGCAGGGACCCTGG - Intronic
1077460335 11:2705938-2705960 AGCAGTGGGTGCAGAGTCATTGG + Intronic
1078335403 11:10459211-10459233 ATCAGGGAGTGGCAGGTCCTTGG + Intronic
1081562020 11:44226453-44226475 AGGAGTGAATGAAGGCTCCTTGG + Intronic
1081995186 11:47359395-47359417 ATGAGTGAGTGGAGGGACCCTGG + Intronic
1083198730 11:61106514-61106536 AGCAGGGAATGAAGGGACCTGGG + Intronic
1083365096 11:62137676-62137698 AGTGCTGAGGGGAGGGTCCTGGG + Intronic
1083718028 11:64590438-64590460 CGCAGTGCGTGGTGGGTCCAGGG + Intergenic
1083783929 11:64933243-64933265 AGCAGTGAGTGTTGGGGGCTGGG + Exonic
1084184353 11:67463932-67463954 GGCAGTGGGTGGAGGGGGCTGGG + Exonic
1084636960 11:70398930-70398952 AGCTCTGAGGGGAGGGTCCCTGG + Intronic
1085388563 11:76170823-76170845 GGCAGTGAGCAGAGGGGCCTTGG - Intergenic
1086914502 11:92513245-92513267 AGGAGTGAGTGGAGTGACCCTGG + Intronic
1088909675 11:114181308-114181330 AGCAGTAAGGGGAGGTCCCTTGG - Intronic
1089854925 11:121535207-121535229 AGATGTGAGTGGAGGCTCCCTGG + Intronic
1095514162 12:42987391-42987413 GGCAGTAAGTGGAAGGGCCTCGG + Intergenic
1096070289 12:48771663-48771685 GGCAGAGAGTGGGGGGTACTTGG - Intronic
1096405305 12:51339813-51339835 GGCAGAGAGTGGCGGGACCTGGG + Intronic
1097971241 12:65635299-65635321 AGCAGTGAGTGAATCCTCCTGGG + Intergenic
1098982933 12:76978062-76978084 AGCATTGAATGGAGGTTACTAGG - Intergenic
1099173709 12:79396468-79396490 AGCAGTTAGTTGAAGGTCATAGG + Intronic
1101086647 12:101243014-101243036 AGCAGGGGGTGGAGGGGACTGGG + Intergenic
1101643218 12:106603549-106603571 AGCCGTGAGCAGAGGCTCCTGGG - Intronic
1101720788 12:107348899-107348921 AGCAGTGAGGGGGGGACCCTAGG + Intronic
1102772551 12:115491038-115491060 GGCAGAGAGTATAGGGTCCTTGG - Intergenic
1103712643 12:122924187-122924209 AGCAGGGAGTGTGGGGACCTGGG + Intronic
1104881790 12:132076813-132076835 ATCAGTGAATGAAGGGTCCTGGG - Intronic
1106028802 13:25979754-25979776 GACAGTGAGTGGTGGCTCCTGGG + Intronic
1106606525 13:31234349-31234371 AGCAGTGATAGAAGGGTACTTGG + Intronic
1107333066 13:39322499-39322521 AGAAGTGTGTGCACGGTCCTGGG - Intergenic
1112234017 13:97618926-97618948 ATCAGAGAGTGGAGGGTCGGAGG + Intergenic
1113775770 13:112943969-112943991 GGCCGTGAGGGGAGGGTCCCGGG + Intronic
1113775798 13:112944034-112944056 GGCCGTGAGGGGAGGGTCCCTGG + Intronic
1113775856 13:112944204-112944226 GGCCGTGAGAGGAGGGTCCTGGG + Intronic
1113775865 13:112944225-112944247 GGCTGTGAGGGGAGGGTCCCGGG + Intronic
1115243220 14:31269920-31269942 GGCAGTTAGGGGCGGGTCCTTGG + Intergenic
1116525557 14:45899998-45900020 ACCAGTGAGTGGTGAGTCATGGG + Intergenic
1116624542 14:47247789-47247811 ATCAGGGAGTGGGGGGTGCTAGG - Intronic
1118021407 14:61719268-61719290 AGGAGTGAGTTGAGGGGCATAGG + Intronic
1118761537 14:68883103-68883125 AGAAGTGAGTGGAAGGGCCATGG + Intronic
1119736277 14:76984793-76984815 AGCAGGGAGGGCAGAGTCCTGGG - Intergenic
1119736627 14:76986758-76986780 AGCAGGGAGGGCAGAGTCCTGGG - Intergenic
1120462870 14:84819503-84819525 AGGAGTGAGGGGAGGGAACTTGG + Intergenic
1121118650 14:91361573-91361595 AGCACTGAGTGGAGGGGGGTTGG - Intronic
1121522124 14:94593370-94593392 AGGACTGAGTGTAGGGTTCTTGG - Intronic
1121842201 14:97144092-97144114 AGCACAGAGCGGAGGGTGCTAGG + Intergenic
1121848862 14:97200729-97200751 AGCAGTGAGTTAAGAGACCTAGG + Intergenic
1122594363 14:102879012-102879034 CCCAGTGAGTGGAGGGTGATGGG + Intronic
1122915237 14:104855339-104855361 AGCAGGGAGTGGAGGGTGAAGGG + Intergenic
1128241971 15:66107460-66107482 AGCAGTGACTGGAGGGACGTGGG - Intronic
1128638322 15:69317408-69317430 AGCAGAGACTGGAGGGTACTAGG - Intronic
1128943183 15:71805178-71805200 AGCAGGGAGTGGAAGGTGCAGGG - Intronic
1129107601 15:73320309-73320331 AGAAGTGGGTGAAGGTTCCTGGG - Exonic
1131030775 15:89184534-89184556 AGCAGTGAGTGGGGAGGGCTGGG + Intronic
1132145282 15:99425744-99425766 GGAAGTGAGTGCTGGGTCCTGGG - Intergenic
1132248787 15:100317896-100317918 AGCCGTGAGTTGAGGGGCCAAGG + Intronic
1132497702 16:271506-271528 AGCTGGGAGTGGAGGGTGCCAGG - Intronic
1133231769 16:4370331-4370353 AGCAGGGAGTGGTGGGGACTGGG + Intronic
1136375955 16:29865046-29865068 AGCAGTGAGGAGTGGGTACTGGG - Intergenic
1136455241 16:30376524-30376546 AAGGGTGAGTGGAGTGTCCTGGG + Exonic
1137281718 16:46982563-46982585 AGCAGTCAGTGAACTGTCCTAGG - Intergenic
1141599834 16:85118912-85118934 AGCAGTGACTGCAGGGTCCCCGG + Intergenic
1142674984 17:1508089-1508111 TCCAGTGAGGGGAGGGTCCCAGG - Intronic
1142761281 17:2043172-2043194 AGCAGTGAGTGGAGGGTCCTGGG - Exonic
1143586336 17:7852417-7852439 AGCAGTGAGGGAAGGGGCTTGGG + Intronic
1143687940 17:8534303-8534325 AGCAAAGAGGGGAGGGACCTGGG - Intronic
1144730872 17:17525544-17525566 AGCAGTGAGAGCAGAGTGCTGGG - Intronic
1144879597 17:18424522-18424544 AGCAGTGCTTGCAGGGGCCTGGG + Intergenic
1145152643 17:20519865-20519887 AGCAGTGCTTGCAGGGGCCTGGG - Intergenic
1145251074 17:21297344-21297366 AGCAGGGAGTGGCGGGTGGTGGG + Intronic
1145414601 17:22704194-22704216 ACCGGTGAGGGGAGGGTGCTTGG + Intergenic
1146545393 17:33733922-33733944 ACAAGTGACTGGAGGGCCCTTGG + Intronic
1147323769 17:39660722-39660744 AGCAGTTAGTAAAGGGGCCTGGG + Intronic
1152003445 17:77662020-77662042 AGGAGTGAGAGGAGGGTCAGGGG + Intergenic
1152423711 17:80207804-80207826 ACCAGTAAGTGGAGGGTCAGTGG - Intronic
1152448862 17:80363797-80363819 AGCAGTGGGTGAGGGCTCCTGGG - Intronic
1152490057 17:80625145-80625167 AGTAGTGAGTAGATGGTCCACGG + Intronic
1154416593 18:14178749-14178771 AGCTGTGAGGGGAGGGTGTTAGG + Intergenic
1160018100 18:75159259-75159281 AGCTGTGAGTTGAAGGCCCTGGG + Intergenic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1161193561 19:2973311-2973333 AGCACTGATTGGAGGCTCCTAGG - Intergenic
1161477362 19:4494047-4494069 AGCAGTGACAGGTGGGTGCTGGG + Exonic
1161653203 19:5497813-5497835 AGCAGTGAGTTGAGCCACCTGGG - Intergenic
1161846062 19:6712635-6712657 AGCTGTGAGTGTAGGCTTCTGGG + Intronic
1162391625 19:10393501-10393523 AGCTGTGGCTGGAGGGTCCTGGG - Intronic
1162805706 19:13137086-13137108 GGCAGTCAGGGGAGGCTCCTTGG - Intronic
1163339907 19:16698959-16698981 AGGAGTGACTGGAAAGTCCTTGG + Intergenic
1163714966 19:18868249-18868271 TGCAGGGGGTGGAGGGTGCTGGG + Intergenic
1164458863 19:28430824-28430846 AGCAGGGAGTGGTGGGAACTGGG - Intergenic
1165174003 19:33913977-33913999 AGTTTTGAGTGGAGGGACCTGGG + Intergenic
1165321555 19:35088549-35088571 GGCAGTGGCTGAAGGGTCCTGGG - Intergenic
1166819627 19:45569642-45569664 GGCAGTGAGGGGAGTTTCCTGGG + Intronic
1167288920 19:48614173-48614195 AGGAGTGTGAGGAGGGTCCAGGG - Intronic
1167430124 19:49449380-49449402 AGCTGAGGGAGGAGGGTCCTGGG + Intronic
1167648420 19:50717862-50717884 AGAAGTGAGAGGAGGGTCTGGGG + Intronic
1168337759 19:55605862-55605884 AGCAGTGATTGGGGGTCCCTTGG - Intronic
925109241 2:1319564-1319586 AGCAGTGACCCGAGGGCCCTGGG + Intronic
925260616 2:2525272-2525294 GACTGTGAGTGGTGGGTCCTGGG - Intergenic
925764178 2:7214912-7214934 AGGATTCAGTGGAGGGACCTGGG - Intergenic
926197856 2:10774543-10774565 TGCAGGGAGTGTAGGGGCCTGGG - Intronic
931720377 2:65063014-65063036 AGCTGTGACAGGAGTGTCCTAGG + Intronic
933697724 2:85232447-85232469 AGCAGTGATATGAGTGTCCTGGG + Intronic
934897648 2:98132618-98132640 ATCAGAGAGTGGAAGGTCCTGGG + Intronic
935068930 2:99676545-99676567 AGCATTGATTGGAGGCTCCCTGG - Intronic
937306501 2:120874820-120874842 AGCTGGGGGTGGAGGGTACTCGG + Intronic
939028900 2:137046841-137046863 AGCAGTGAGTGGAGGTGGCTGGG + Intronic
947718523 2:232353565-232353587 GGCCATGAGTGGAGAGTCCTCGG + Intergenic
948200716 2:236128095-236128117 AGCTGAGAGAGGAGGGTCCTGGG - Exonic
948640873 2:239375367-239375389 ACAAGTGAGTGGACGGTCCGTGG - Intronic
948770278 2:240248243-240248265 AGCAGGGGGTGGATGGGCCTGGG - Intergenic
1170897288 20:20427139-20427161 AGCAGTGAGTAGATGGAACTGGG - Intronic
1170947025 20:20900604-20900626 GGCAGAGAATGGAGGGTCCCTGG - Intergenic
1172447213 20:34999499-34999521 AGGGGTGAGTGGAGTGACCTGGG + Intronic
1172992675 20:39047874-39047896 AGCAGTGAGTGGAAGGCTCGTGG + Intergenic
1174024888 20:47565844-47565866 AGAAGTTAGTGGATGGTCATGGG - Intronic
1175415072 20:58795715-58795737 ACCAGTGTGTGGAGTGTTCTGGG + Intergenic
1175778686 20:61668768-61668790 AGCGGTAAGTGGAGGGCCCAGGG - Intronic
1176365363 21:6029598-6029620 GGCAGAGAGTAGAGGATCCTCGG + Intergenic
1178501431 21:33128785-33128807 GGCAGTGAGTCGAGTGTCCTGGG + Intergenic
1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG + Intronic
1179758155 21:43508947-43508969 GGCAGAGAGTAGAGGATCCTCGG - Intergenic
1180791167 22:18576559-18576581 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1180981449 22:19879916-19879938 AGCAGTGAGGGGAAGGCCCTTGG - Intronic
1181230571 22:21418755-21418777 GGCAGGTAGTGGAGGGGCCTTGG + Intronic
1181248079 22:21516114-21516136 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1181612342 22:24025536-24025558 AGCCGTGAGTGGTGGGGCCGAGG + Intronic
1183352954 22:37343952-37343974 GGCAGTGGGTGGAGGGGCCGAGG + Intergenic
1183964197 22:41431637-41431659 TGCTGTCAGCGGAGGGTCCTGGG - Intergenic
1184373168 22:44095620-44095642 GGCAGTGAGCGCAGGGGCCTGGG - Intronic
1184607270 22:45581381-45581403 AGCAGTCAGGGGAGGCTTCTTGG - Intronic
1184611107 22:45603897-45603919 GGCATTGAGTGGAGGGTGCCAGG + Intergenic
1184654024 22:45932197-45932219 AGCTGGGAGGGGAGGGTCCCAGG + Intronic
1184744558 22:46448692-46448714 AGGAGTGAGTGGAAGGGCCCGGG + Intronic
1185009084 22:48303120-48303142 AGCAGACAGTGCAGTGTCCTGGG + Intergenic
1185083698 22:48724396-48724418 CTCTGTGAGTGGAGGGTCCCAGG - Intronic
950900160 3:16490388-16490410 AGCAGAGAAAGGAGGGTCCTAGG + Intronic
952846146 3:37689564-37689586 AGCAGTGAGAGGGAGCTCCTGGG + Intronic
952888659 3:38027008-38027030 TTCAGTGAGGGGAGGGCCCTGGG + Intronic
953571744 3:44076651-44076673 AGCAGAAAGGGGTGGGTCCTGGG + Intergenic
953688607 3:45098084-45098106 TGCAGTGTGTGGCGGGGCCTTGG - Intronic
954929601 3:54269619-54269641 TGCAAGGAGTGGAGGATCCTGGG + Intronic
956667831 3:71658682-71658704 ATCAGTGAGTGGTGGGTCTCAGG - Intergenic
956775799 3:72564543-72564565 AGCAGTGAAGGAAGGGTTCTCGG + Intergenic
961306522 3:125961488-125961510 AGCAGGGAGTGAGGGGGCCTGGG - Intergenic
962208793 3:133458860-133458882 ATAAGTGAGTGGAGATTCCTTGG - Intronic
962253532 3:133854446-133854468 AGGAGGGAGAGGAGGGTCATAGG - Intronic
963255385 3:143139687-143139709 AGCAGTGAGTGCAAAGTCCTGGG + Intergenic
963296364 3:143550877-143550899 AGAAGTCATTGAAGGGTCCTAGG - Intronic
965258165 3:166443979-166444001 AGCAGAGAGGGGCGGGTCCCTGG + Intergenic
966983896 3:185162404-185162426 ATCAAGGAGTGAAGGGTCCTGGG + Intergenic
967290248 3:187912848-187912870 AGCACAGAGTAGAGGATCCTTGG + Intergenic
968132291 3:196198685-196198707 AACAGTGAGTGTAAGGGCCTGGG + Intronic
968382964 4:110783-110805 AGAAGAGACTGCAGGGTCCTTGG + Intergenic
968528007 4:1074313-1074335 AGCAGTGAGTGGAGAGCCAGAGG - Intronic
969238524 4:5884909-5884931 TGCAGTGAGTAGAGCATCCTGGG - Intronic
971344591 4:25800156-25800178 AGCAGTTATTGATGGGTCCTTGG + Intronic
973119020 4:46494678-46494700 AGCATTGAGTTGAAGGGCCTAGG - Intergenic
973219904 4:47713566-47713588 AGCCCTGCGTGGAGGCTCCTGGG + Intronic
978347662 4:107788630-107788652 AGCAGAAAGGGGTGGGTCCTTGG - Intergenic
982126770 4:152190540-152190562 ACCAGTCAGTGGTGGGTCTTGGG + Intergenic
983069722 4:163254146-163254168 AGCAGAAAGGGGTGGGTCCTTGG - Intergenic
985681586 5:1258542-1258564 AGCAGAGCGCGGAGGGTCCCTGG + Intronic
986350451 5:6873470-6873492 ACCAGAGAGTGGAGGGTCGGAGG + Intergenic
987108761 5:14665054-14665076 AGTCGTCAGCGGAGGGTCCTGGG + Intronic
987302574 5:16609664-16609686 AGCGGTGAGTGGAAGGGCCCAGG + Intronic
990249475 5:53898416-53898438 AGCAGTGAAGCAAGGGTCCTGGG + Intronic
993219235 5:85069565-85069587 GGCAGAGAGGGGTGGGTCCTTGG + Intergenic
993278311 5:85891001-85891023 AGCCATCAGTGGAGAGTCCTCGG + Intergenic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
996882585 5:128316999-128317021 AGGAGTGAGTGGAGGGGACAGGG - Intronic
996968898 5:129339454-129339476 AGCAGGGAATGGGTGGTCCTGGG - Intergenic
997240117 5:132300826-132300848 AGCAGGGACTGGTGGGACCTGGG + Intronic
997724955 5:136112864-136112886 AGCTGTGAGTTAAGAGTCCTGGG - Intergenic
999137615 5:149332910-149332932 TGTAGTGAGTGGAGGGACATAGG - Intronic
999231625 5:150065352-150065374 AGCAGGGAAGGGAGGGTCCAGGG - Intronic
999430685 5:151522749-151522771 AGCAGCAAGTGTAAGGTCCTGGG + Intronic
1000037231 5:157458607-157458629 AGTAGACAGTGGAGGGTCGTAGG + Intronic
1001287148 5:170431904-170431926 AGAAGAGAGTGGAATGTCCTGGG - Intronic
1002334743 5:178469920-178469942 ACCAGTGAGAGGAGGTGCCTGGG - Intronic
1002883806 6:1275977-1275999 AGGAGAGAGTGGAAGGTCCAGGG + Intergenic
1003402087 6:5799085-5799107 AGCAGTGACTGGATGGTCATTGG - Intergenic
1003487974 6:6595879-6595901 AGCAGTGTGTGGAGGGCTGTGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007356007 6:41318244-41318266 AGGAGAGAGTGGAGGGTCCGTGG - Intergenic
1007636070 6:43300514-43300536 AGAAGTGAGTGGCTGGTGCTGGG + Intronic
1008454536 6:51694030-51694052 AGCATTGAGTGCTGAGTCCTAGG + Intronic
1010455422 6:76049187-76049209 ATCAGAGAGTGGAGGGTGGTTGG + Intronic
1012316921 6:97791865-97791887 AGCAGACAGGGGAGGGTCCCTGG - Intergenic
1019379629 7:714067-714089 AGGAGGGAGTGGAGGGGCCGCGG - Intronic
1020039590 7:4992000-4992022 AGTTCTGGGTGGAGGGTCCTTGG + Intronic
1021045771 7:15921493-15921515 GGCACTGAGTGGAGCCTCCTGGG - Intergenic
1022227681 7:28380569-28380591 AGAAGTGAGTGGAAGGTCTTTGG + Intronic
1023863966 7:44230067-44230089 AGCAGTGAGGGAGGGGACCTGGG - Intronic
1023943801 7:44787347-44787369 GGGAGTGACTGGAGAGTCCTTGG - Intergenic
1024674213 7:51623648-51623670 ACCAGTCAGTGGAAGGGCCTGGG + Intergenic
1027187827 7:75982319-75982341 AGCCGTGAGTGGAGGGAGCGTGG + Exonic
1029188378 7:98755263-98755285 AGCATTGAGGGAAGGGCCCTGGG + Intergenic
1030298330 7:107951173-107951195 ATCAGAGAGTGGAGGGAACTGGG - Intronic
1030367940 7:108667853-108667875 GGCAGAGAGTGGAGGAACCTGGG - Intergenic
1031009795 7:116514089-116514111 GGAAGTGATTGAAGGGTCCTAGG + Intergenic
1033247468 7:139729925-139729947 AGTAGTGAATGGAGGGACATTGG - Intronic
1034698094 7:153072936-153072958 AGGAGGGAGTGGAGGGTGCTGGG + Intergenic
1035731269 8:1854990-1855012 GGGAGGGAGTGGAGGGGCCTCGG + Intronic
1036598375 8:10236233-10236255 AGCATTGTATGGAAGGTCCTAGG + Intronic
1036699022 8:10999025-10999047 AGCATTGAGAGGAGGGTACTTGG - Intronic
1041214969 8:55591328-55591350 AGCAGGGGGAGGATGGTCCTGGG + Intergenic
1041378525 8:57226760-57226782 ACCGATGAGTGGAGGGTCCAGGG + Intergenic
1042770394 8:72374553-72374575 AGAAGTAAGTGGAGGATCCTGGG + Intergenic
1044515124 8:93128652-93128674 ATGAGTGAGTGGAGAGCCCTGGG - Intergenic
1045056468 8:98372416-98372438 AGGAGTGGGTGGAGGGGCCGGGG - Intergenic
1045211361 8:100103488-100103510 AGCATAGTGTGGAGGGGCCTGGG + Intronic
1047337987 8:123954516-123954538 ACCAGTGAGTGGAAGGCTCTAGG - Intronic
1048354958 8:133645863-133645885 AGCAGTCAGGGGAGGCTTCTTGG + Intergenic
1050086317 9:1969958-1969980 AGAAGTGGGTGGATGGCCCTTGG - Intergenic
1050264854 9:3879447-3879469 AGCTGTGAGTGGAGGTAACTGGG + Exonic
1052997649 9:34559724-34559746 AGCGGGGAGTGGAGGCTTCTCGG - Intronic
1056558212 9:87707134-87707156 AGCAGGGCGTGGAGGGGGCTGGG - Exonic
1056889750 9:90480242-90480264 AGGAGAGAGTAAAGGGTCCTAGG + Intergenic
1059777463 9:117489764-117489786 TGCAGGGATTGGAGAGTCCTAGG - Intergenic
1060399595 9:123340548-123340570 GGCAGGGAGTGGGGGGCCCTGGG - Intergenic
1060860883 9:126954012-126954034 GGCAGTGTGTGGAGGGCGCTGGG - Intronic
1061359312 9:130131204-130131226 AGCAGTGAGAAGAGAGACCTGGG - Intronic
1061598296 9:131647034-131647056 AGCAGTGAGCAGGGGGTCCTGGG - Intronic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1186705696 X:12137957-12137979 AGCATAGAGCGGAGGGTCCCAGG - Intergenic
1186798262 X:13067121-13067143 AGAAGTGGTTGGAGGGTCCAAGG + Intergenic
1187330774 X:18337249-18337271 TGCAGTGAGTGGCGCGTTCTTGG - Intronic
1190158026 X:48009294-48009316 AACAGTGAATGGAGGGCCCAAGG - Intronic
1190173797 X:48132178-48132200 AACAGTGAATGGAGGGCCCAAGG - Intronic
1190263404 X:48813862-48813884 AGCAGGAAGTGGAGAGACCTGGG - Intronic
1195256168 X:103093161-103093183 AGCATAGAGAGGAGTGTCCTAGG + Intergenic
1198741132 X:139844318-139844340 AGCAGAGAGTGGAGGGCTCTGGG + Intronic
1200884116 Y:8252137-8252159 TGCTGTGCGTGAAGGGTCCTTGG - Intergenic
1200958428 Y:8973452-8973474 TGCTGTGCGTGAAGGGTCCTTGG + Intergenic
1201063906 Y:10070736-10070758 TGCTGTGTGTGAAGGGTCCTTGG - Intergenic
1202021176 Y:20466553-20466575 AGCAATCAGTGGAAGTTCCTGGG + Intergenic
1202124677 Y:21557409-21557431 TGCTGTGAGTGAAGGGTCCATGG + Intergenic
1202154331 Y:21871971-21871993 TGCTGTGAGTGAAGGGTCCATGG - Intergenic