ID: 1142763902

View in Genome Browser
Species Human (GRCh38)
Location 17:2055611-2055633
Sequence CCGTTACCTGCGGTCCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142763902_1142763923 12 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763923 17:2055646-2055668 CGCGGGCCAGGAGGGGAACGGGG 0: 1
1: 0
2: 0
3: 19
4: 215
1142763902_1142763916 4 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763916 17:2055638-2055660 CGGGGCCCCGCGGGCCAGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 334
1142763902_1142763913 0 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763913 17:2055634-2055656 GCCGCGGGGCCCCGCGGGCCAGG 0: 1
1: 1
2: 12
3: 77
4: 631
1142763902_1142763925 17 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763925 17:2055651-2055673 GCCAGGAGGGGAACGGGGTCGGG 0: 1
1: 0
2: 3
3: 54
4: 496
1142763902_1142763912 -5 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763912 17:2055629-2055651 AACGGGCCGCGGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1142763902_1142763915 3 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763915 17:2055637-2055659 GCGGGGCCCCGCGGGCCAGGAGG 0: 1
1: 1
2: 6
3: 51
4: 470
1142763902_1142763911 -6 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763911 17:2055628-2055650 TAACGGGCCGCGGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1142763902_1142763924 16 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763924 17:2055650-2055672 GGCCAGGAGGGGAACGGGGTCGG 0: 1
1: 0
2: 4
3: 61
4: 633
1142763902_1142763928 21 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763928 17:2055655-2055677 GGAGGGGAACGGGGTCGGGCGGG 0: 1
1: 0
2: 2
3: 62
4: 662
1142763902_1142763920 10 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763920 17:2055644-2055666 CCCGCGGGCCAGGAGGGGAACGG 0: 1
1: 0
2: 1
3: 24
4: 250
1142763902_1142763922 11 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763922 17:2055645-2055667 CCGCGGGCCAGGAGGGGAACGGG 0: 1
1: 0
2: 2
3: 10
4: 212
1142763902_1142763927 20 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763927 17:2055654-2055676 AGGAGGGGAACGGGGTCGGGCGG 0: 1
1: 0
2: 0
3: 62
4: 636
1142763902_1142763917 5 Left 1142763902 17:2055611-2055633 CCCGCCGGGACCGCAGGTAACGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1142763917 17:2055639-2055661 GGGGCCCCGCGGGCCAGGAGGGG 0: 1
1: 0
2: 1
3: 50
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142763902 Original CRISPR CCGTTACCTGCGGTCCCGGC GGG (reversed) Intronic
903792752 1:25906053-25906075 CCCTTCCCTGCGGGCCCCGCCGG - Intronic
904918747 1:33989820-33989842 CAGTTACCTGCGGTCAGGGATGG + Intronic
912682991 1:111740469-111740491 CCGTCCCCGGCTGTCCCGGCCGG - Intronic
1070388921 10:75951889-75951911 ACGTTACCTGCGGTCCTGGAGGG + Intronic
1076734666 10:132453259-132453281 CCGGTTCCTGCGGGGCCGGCGGG - Intergenic
1093966408 12:25331666-25331688 CCCTTACCTGCAGTCCTGGAAGG - Intergenic
1096774815 12:53957353-53957375 CCGTTGCCTGCGGTGGCTGCAGG + Exonic
1100329285 12:93570183-93570205 CCCTTACCTGCGCGCCCGGAAGG - Intronic
1114255321 14:20996696-20996718 CCCATACCTGCCGTGCCGGCGGG - Exonic
1118849143 14:69571496-69571518 CAGTTATTTGCGGTCCAGGCTGG + Exonic
1121038782 14:90728168-90728190 CTGTTAGCTGCAGTCCCTGCTGG - Intronic
1121623930 14:95371188-95371210 CGGTTACTTGCGGGCCTGGCCGG + Intergenic
1122930746 14:104932117-104932139 CCCCTACCTGCGGTCCCTGCAGG + Exonic
1126733897 15:51712498-51712520 CCGCTACCTGCATTCCCTGCAGG - Intronic
1128224573 15:65993087-65993109 CACCTACCTGCGCTCCCGGCAGG + Intronic
1132423457 15:101693862-101693884 CCGTTCCCTGAGGTCAGGGCTGG + Intronic
1132891493 16:2207019-2207041 CCGGGACCTGCGGGCCGGGCCGG - Exonic
1135424558 16:22325871-22325893 CGGGTGCCTGCGGTCCCGCCCGG + Exonic
1142763902 17:2055611-2055633 CCGTTACCTGCGGTCCCGGCGGG - Intronic
1143923635 17:10350549-10350571 CAGTTACCTTCGGTGCCGTCTGG + Exonic
1144438349 17:15260970-15260992 CCGTTGCAGGCGGGCCCGGCTGG - Intronic
1157826777 18:50819574-50819596 CCCTTACCTGCGGCTCCTGCAGG + Exonic
1160465088 18:79069514-79069536 CGGTTACCTGCTGTGCCGGTCGG - Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161277865 19:3428853-3428875 CCGTTTCCTGCTGACCCAGCTGG - Intronic
929823654 2:45293012-45293034 CCGTTACCTGCCCTCCAGTCTGG + Intergenic
1173404095 20:42749882-42749904 CCGTTGACTGCTGTCCTGGCTGG - Intronic
1180891318 22:19291373-19291395 CCGTTACCGGCGGGGCCGGCTGG - Intronic
1181278049 22:21699140-21699162 CCCAGACCTGCGGTCCAGGCAGG - Exonic
1184663573 22:45976421-45976443 CCGCTACCCGCGAGCCCGGCCGG + Intronic
950175738 3:10873063-10873085 CCCTTAACTGAGGTCCCTGCAGG - Intronic
966306139 3:178537004-178537026 CTCTTACCTGTGGTGCCGGCTGG + Intronic
968820026 4:2843574-2843596 CCGTGTCCAGCGGACCCGGCAGG + Intergenic
968913967 4:3489191-3489213 CCGTTCCCTGGGGTCTCGGATGG - Intronic
980923873 4:139115255-139115277 CCCTCTCCTGCGGTCCCGGGGGG + Intronic
985525685 5:400328-400350 CCATTCCCTGCGGTCCCTGGGGG + Intronic
989563516 5:42877408-42877430 CCTTTACCTGAGGTCCCTACAGG - Intronic
1002046260 5:176543254-176543276 GCGTTACCTGGGGCCGCGGCGGG + Intronic
1005838283 6:29723938-29723960 TCGTGACCTGCGCCCCCGGCCGG - Intronic
1006677801 6:35776725-35776747 CCCTCTCCTGCGGTCGCGGCCGG - Intronic
1018091181 6:160348104-160348126 CCGTCACTCGCGGTCCCGGCCGG + Intergenic
1034509292 7:151520698-151520720 ACGGCACCTGCGTTCCCGGCCGG - Intergenic
1060825024 9:126683030-126683052 CCGTGACCTCCAGCCCCGGCTGG + Intronic
1196840228 X:119852852-119852874 CCGCTGCCTGTGGCCCCGGCGGG + Exonic