ID: 1142764361

View in Genome Browser
Species Human (GRCh38)
Location 17:2057216-2057238
Sequence TCCGCGGCAGGCGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 1, 2: 12, 3: 106, 4: 662}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142764361_1142764369 -3 Left 1142764361 17:2057216-2057238 CCTCCGCCGCCGCCTGCCGCGGA 0: 1
1: 1
2: 12
3: 106
4: 662
Right 1142764369 17:2057236-2057258 GGAGCCGCCCTCGGGCCCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 193
1142764361_1142764371 3 Left 1142764361 17:2057216-2057238 CCTCCGCCGCCGCCTGCCGCGGA 0: 1
1: 1
2: 12
3: 106
4: 662
Right 1142764371 17:2057242-2057264 GCCCTCGGGCCCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142764361 Original CRISPR TCCGCGGCAGGCGGCGGCGG AGG (reversed) Exonic
900109194 1:998508-998530 ACCGCGGAAGGCGGAGGCTGCGG - Intergenic
900249302 1:1658936-1658958 TCCGGGACCGGCGGCGGCGGCGG - Exonic
900256750 1:1701550-1701572 TGCGGGGCAGGCAGCGGGGGGGG + Intronic
900435540 1:2629026-2629048 TCCGGCGGAGGCGGAGGCGGAGG + Intronic
900467023 1:2830863-2830885 GCAGCAGCAGGCGGCGGGGGCGG - Intergenic
901057624 1:6456015-6456037 GGCGCGGCGGGCGGGGGCGGCGG - Intronic
901063840 1:6485669-6485691 GCCCGGGCAGGCGGAGGCGGGGG - Intronic
901373246 1:8818013-8818035 AGCGCGGCGGGCGGCGGAGGAGG - Intergenic
901506573 1:9689437-9689459 GCCGGGGCCGGCGGCGGCGCGGG - Intronic
902823256 1:18956265-18956287 TGCCCGCCGGGCGGCGGCGGCGG - Exonic
902877859 1:19351825-19351847 TCCCTGGCAGGAGGCGGCTGAGG - Intronic
903072145 1:20731854-20731876 TCCGCTGCAGGGGACGGAGGAGG + Intronic
903115637 1:21176597-21176619 GCTGCTGCCGGCGGCGGCGGCGG - Intronic
903190143 1:21651827-21651849 GCCGGGCCGGGCGGCGGCGGCGG - Exonic
903226905 1:21898930-21898952 TCAGCGGGTGGCGGCGGGGGTGG + Intronic
903829121 1:26164415-26164437 CCCCTCGCAGGCGGCGGCGGCGG - Intergenic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
903925137 1:26826634-26826656 GCCGCGGCGGGCGGTGGCGGCGG + Intergenic
904199785 1:28812268-28812290 GGCGCGGCAGCCGGCGGCGTCGG + Exonic
904762700 1:32817303-32817325 TTCCCGGCACGCGGCGGCGACGG - Exonic
905332395 1:37214535-37214557 TCTCCGGCAGGCAGGGGCGGGGG - Intergenic
905414386 1:37794396-37794418 TCCGCGGTGCGGGGCGGCGGCGG - Exonic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
905449248 1:38046499-38046521 CCCACGGGAGGAGGCGGCGGCGG - Exonic
905584339 1:39105323-39105345 GCAGCGGCGGGCGGCGGCGGCGG - Intronic
905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG + Intronic
906073723 1:43036239-43036261 TGGGCGGCAGGCGGAGGCTGGGG + Intergenic
906204390 1:43979327-43979349 TCCATGGCCCGCGGCGGCGGCGG + Intronic
906292980 1:44631981-44632003 TCAGCTCCAAGCGGCGGCGGCGG - Intronic
906407141 1:45550971-45550993 TCCTCGGGAGGCGGCGAAGGCGG + Exonic
906614545 1:47225484-47225506 CGCGCGGCCGGGGGCGGCGGGGG + Exonic
907010632 1:50959896-50959918 TCGGCGCCCGGCGGCGGCGGCGG - Exonic
907278113 1:53328032-53328054 GCCGGGGCGGGCGGCAGCGGCGG - Intronic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
908131205 1:61077143-61077165 CCGGCGGCAGCCTGCGGCGGAGG - Intronic
908203277 1:61819600-61819622 GGGGCGGCAGGCGGCGGTGGGGG + Intronic
908447106 1:64209674-64209696 TGCGGGGCGGGCGGGGGCGGGGG - Intronic
909635411 1:77811896-77811918 TCCTCGGCAGGTGGCGGTGGTGG - Intronic
909957991 1:81802004-81802026 TGCTCGGCTGGAGGCGGCGGCGG + Intronic
910183043 1:84506163-84506185 TCAGCGGCGCGCGGCGGGGGCGG + Exonic
910277456 1:85464677-85464699 ACGGCGGCCGGCGGCGGGGGAGG + Intronic
911664734 1:100539691-100539713 GCCCGGGAAGGCGGCGGCGGCGG - Exonic
912305239 1:108560254-108560276 GCCGCGAGAGGCGGCGGCAGCGG + Exonic
912401591 1:109397889-109397911 TCGGCGGCATTCGGCGGCGATGG - Exonic
912486666 1:110034704-110034726 TGTGCGGCTGCCGGCGGCGGAGG - Exonic
912568838 1:110607308-110607330 ACCCCGGCAGCGGGCGGCGGCGG + Exonic
913186383 1:116373603-116373625 CCAGCGGGAGGCGGCGGAGGAGG + Intronic
914730393 1:150364665-150364687 TCCTCTGGCGGCGGCGGCGGCGG - Intronic
914730408 1:150364715-150364737 ATGGCGGCCGGCGGCGGCGGAGG + Exonic
914803170 1:150974785-150974807 GGCTCGGCGGGCGGCGGCGGCGG - Exonic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
915161346 1:153922765-153922787 GCCTCCTCAGGCGGCGGCGGAGG + Exonic
915313290 1:155015254-155015276 TCCGGGGCTTGCGGCTGCGGCGG - Exonic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
915463189 1:156081736-156081758 GGCGCCGCGGGCGGCGGCGGCGG + Exonic
915616898 1:157045945-157045967 GCCGCGGCGGCCGGGGGCGGGGG + Intergenic
915902369 1:159855952-159855974 TCCGGGGCTGGCGGCGCCCGCGG - Exonic
916091904 1:161314202-161314224 TCGGCTGCAGGAGGCGGAGGAGG + Intergenic
916666927 1:166975342-166975364 CCCGCGGCAGCGGGCGGCGGCGG + Intronic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
916922681 1:169485724-169485746 GTCTCGGCGGGCGGCGGCGGCGG - Exonic
918282960 1:183023577-183023599 TCCGGCGCGGGCGGTGGCGGCGG - Exonic
919678336 1:200409416-200409438 TCCGGGGCTGGCGGAGGGGGGGG + Exonic
920704872 1:208243688-208243710 TCAGCAGCCGGCGGCGGCCGAGG - Exonic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
921229199 1:213051366-213051388 TCCCGGGCGGGTGGCGGCGGCGG + Exonic
922124885 1:222712432-222712454 TCCTCGGCGGGTGGCGGTGGTGG - Exonic
922315085 1:224434698-224434720 GCGGCGGCGGGCGGCAGCGGAGG + Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923141459 1:231163735-231163757 GCCTCGGCGGGCGGCGGCGGCGG - Exonic
923191772 1:231626893-231626915 GCCGCCGCCGGCGGCGGCTGGGG - Exonic
923490369 1:234478743-234478765 TCCGCAGCTGGCGGCCGCGCTGG - Exonic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924415164 1:243850287-243850309 GGAGCGGGAGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064230811 10:13528536-13528558 TGCGGGGAAGGCGGCGGCGGGGG + Intronic
1064860055 10:19816650-19816672 TCTGGGGCAGGCAGCGGCGCTGG + Exonic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1064982011 10:21174345-21174367 TCCCCGGCCTGCAGCGGCGGTGG - Intergenic
1065019995 10:21495880-21495902 CCCGCTGCACGCGGCGGCGCGGG - Exonic
1065024203 10:21526066-21526088 CCCGGGGCTGGCGGCGGGGGCGG - Intergenic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065660284 10:27998933-27998955 GGAGCGGAAGGCGGCGGCGGCGG - Intronic
1065712863 10:28533638-28533660 TTCGGGCCGGGCGGCGGCGGGGG + Intronic
1065712868 10:28533648-28533670 GCGGCGGCGGGGGGCGGCGGCGG + Intronic
1065712871 10:28533651-28533673 GCGGCGGGGGGCGGCGGCGGGGG + Intronic
1066126352 10:32346695-32346717 TCTGCTGCCTGCGGCGGCGGCGG - Intronic
1066464552 10:35640906-35640928 TGCTCGCCGGGCGGCGGCGGCGG + Exonic
1067091302 10:43266905-43266927 CGCGCGGCCGGCGCCGGCGGCGG + Intronic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1068538613 10:58267840-58267862 GCCGGGGCCGGCGGCTGCGGCGG - Exonic
1068690155 10:59906294-59906316 GGCGGGGGAGGCGGCGGCGGTGG - Exonic
1069486625 10:68827808-68827830 TCCAGGGCTGGCTGCGGCGGGGG + Exonic
1069486712 10:68828144-68828166 TCCAGGGCTGGCTGCGGCGGGGG + Intronic
1070112033 10:73495822-73495844 GCCCCGGGAGGGGGCGGCGGGGG + Exonic
1070835673 10:79445600-79445622 TCGGGGGGAGGCGGCGGCAGCGG - Exonic
1071966594 10:90858110-90858132 GCGGCCGGAGGCGGCGGCGGCGG - Intergenic
1071966595 10:90858113-90858135 GCAGCGGCCGGAGGCGGCGGCGG - Intergenic
1072021858 10:91410400-91410422 GGAGCGCCAGGCGGCGGCGGCGG - Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1072915539 10:99535509-99535531 TACCCGGCGGGCGGCGGCGGCGG + Exonic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1073058282 10:100715765-100715787 GCCCTGACAGGCGGCGGCGGCGG + Intergenic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1074996339 10:118760370-118760392 ACCTGGGCTGGCGGCGGCGGAGG - Intergenic
1075697484 10:124447622-124447644 GCGGCGGGGGGCGGCGGCGGCGG - Exonic
1075754711 10:124801718-124801740 TCTGCGGCGGGCAGCGGCCGAGG - Intergenic
1076020206 10:127066211-127066233 ACCGCAGCTGGGGGCGGCGGGGG - Intronic
1076372523 10:129964498-129964520 TGCGTGGCGGGGGGCGGCGGCGG - Intergenic
1076554276 10:131311788-131311810 TCCGGGGGCGGCGGCGGCGCGGG - Intergenic
1077173490 11:1178658-1178680 TGCGTGGCAGGCGGCGAAGGTGG - Intronic
1077201473 11:1309561-1309583 TCCGTCGCAGGCTCCGGCGGGGG - Exonic
1078057408 11:8019255-8019277 TCCGCGGGCGGCGGCGGCGCTGG - Intronic
1079450448 11:20596735-20596757 TCCGCGGAGGGCGGGGGCGGAGG + Intergenic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080503807 11:32893262-32893284 GCTGCTGCTGGCGGCGGCGGCGG - Exonic
1081807901 11:45900159-45900181 TCTGCGGGCGGCGGCGGCGCGGG + Exonic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1081908090 11:46681938-46681960 TCCAAGGCAGGGGGTGGCGGGGG - Intronic
1081925748 11:46826818-46826840 TACCCGGCAGGCGGCGGCGGCGG + Intronic
1082076605 11:47980427-47980449 GCAGCGGCGGGCGGCGGCGAGGG + Intergenic
1082843931 11:57712070-57712092 CCCGCAGGAGGCGGTGGCGGGGG + Exonic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083428419 11:62601459-62601481 TGTGCGGCCGGAGGCGGCGGCGG - Exonic
1083448564 11:62727231-62727253 GCGGAGGCGGGCGGCGGCGGCGG - Exonic
1083945164 11:65919365-65919387 TCCGCGGGAAACGGCGGGGGCGG + Exonic
1083965756 11:66042763-66042785 TGCGCGGCAGGCCGCAGCAGTGG + Exonic
1084146139 11:67266392-67266414 TGCGCGGCAGGCGGGGCCGGAGG + Exonic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084275633 11:68049746-68049768 TCCGCAGGCGGCGGCGGTGGCGG - Exonic
1084275635 11:68049749-68049771 TCCTCCGCAGGCGGCGGCGGTGG - Exonic
1084284162 11:68120939-68120961 TCTGCGGGCGGCTGCGGCGGCGG + Exonic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085165817 11:74398455-74398477 GGCGGGGCGGGCGGCGGCGGCGG - Exonic
1085408392 11:76277498-76277520 TCCCAGGCAGGCGGGGGCCGCGG - Intergenic
1086322339 11:85664289-85664311 TCCCCAGGAGGAGGCGGCGGTGG - Exonic
1086887743 11:92224599-92224621 CGCGCGGGAGGGGGCGGCGGAGG - Intergenic
1089165806 11:116475595-116475617 ACCACGGCAGGGGGCGGGGGAGG + Intergenic
1089208916 11:116787905-116787927 TCAGGGGCAGGCGGCGGGGCCGG + Exonic
1089243061 11:117098245-117098267 TCCGCGGGAGGCCGGGGCTGGGG + Exonic
1089273357 11:117316126-117316148 CCCCCGGCGGGCGGCGGCGCGGG + Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1090017710 11:123100936-123100958 TCGGGGGCAGGCGGTGGGGGAGG - Intronic
1090194046 11:124800078-124800100 GCCCCGGCAGGCGGCGGCGGCGG + Exonic
1090635806 11:128689871-128689893 TACGTGGGAGGCCGCGGCGGCGG - Intronic
1090788394 11:130069681-130069703 TCCGCGGCCGGGGGCGGGGCCGG + Intergenic
1090788519 11:130070159-130070181 TCCGCGGCAGGGCGGGCCGGCGG + Intronic
1090788742 11:130070930-130070952 GCCGCGGGAGGGGGCGGGGGCGG + Intronic
1091434048 12:459978-460000 TCCGGGGCTGGCGGGGGCGCGGG + Intergenic
1091600779 12:1916561-1916583 TCCGGGGCAGGCAGAGGAGGAGG + Intronic
1091740747 12:2959228-2959250 GCCGGGGCGGGCGGCGGGGGAGG - Intergenic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1094653427 12:32399387-32399409 TCCCCGGCCGGAGGAGGCGGCGG + Intergenic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1096461139 12:51821854-51821876 AGCGCGGCCGGGGGCGGCGGGGG + Intergenic
1096461151 12:51821920-51821942 TACGCGGCCGGCTACGGCGGGGG - Intergenic
1096695321 12:53344993-53345015 CCCGGGGGAGGGGGCGGCGGCGG + Intronic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1097046263 12:56189558-56189580 GCGGCGGGAGGCGGCGGCCGCGG - Intronic
1097107672 12:56634957-56634979 CGGGCCGCAGGCGGCGGCGGCGG + Intronic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097107697 12:56635032-56635054 CCCTGGGCCGGCGGCGGCGGAGG + Intronic
1097264418 12:57737512-57737534 TCCCCCGGCGGCGGCGGCGGTGG + Exonic
1098320570 12:69239602-69239624 CCTGCAGGAGGCGGCGGCGGCGG + Exonic
1098550369 12:71755133-71755155 GCTGCGGCCGGCGGCGGCGGCGG + Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1100632284 12:96400587-96400609 ACCCCTGCCGGCGGCGGCGGAGG + Intergenic
1101592695 12:106138566-106138588 TCCCCGAGAGGCGGTGGCGGGGG - Exonic
1101605911 12:106247703-106247725 TGCGGCGCGGGCGGCGGCGGCGG + Exonic
1102136864 12:110582940-110582962 CCCAGGGCCGGCGGCGGCGGCGG - Exonic
1102644625 12:114396143-114396165 GCCGCGGCCGGGGGCGGGGGAGG + Intronic
1103400639 12:120640895-120640917 GCTGCTGAAGGCGGCGGCGGCGG + Exonic
1103893770 12:124259745-124259767 GCCGTGGCAGGCGGCCGGGGAGG - Intronic
1103907922 12:124336824-124336846 GCCGAGGCAGGTGGCGCCGGCGG + Exonic
1104983385 12:132583612-132583634 TGCGCCGAGGGCGGCGGCGGCGG - Exonic
1105900109 13:24746164-24746186 ACCGCGACGGGCGGCTGCGGTGG - Intergenic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1106720080 13:32427778-32427800 GCCGCGGCAGGCACCCGCGGCGG + Intronic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1108227470 13:48303982-48304004 TCCTCAGGAGGGGGCGGCGGCGG - Exonic
1109284853 13:60397592-60397614 TCCCCTGGAGGCGGCGGCGGCGG + Intronic
1110630151 13:77698100-77698122 GGCGCGGCGGGCGGCGGCGGCGG - Intronic
1110705932 13:78602166-78602188 CCCGGGGGAGGCGGCGGTGGCGG - Exonic
1110705971 13:78602250-78602272 GGCGCGGCGGCCGGCGGCGGCGG - Exonic
1111396250 13:87672489-87672511 GCGGCGGGAGGGGGCGGCGGAGG - Intergenic
1112091664 13:96090357-96090379 CCCGCGGCCGGCCGGGGCGGCGG + Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113378129 13:109782938-109782960 CCCGGGGCCGGCGGCGGTGGCGG + Exonic
1113655914 13:112067734-112067756 GCCGGGGCGGGCGGCGGCGGGGG + Exonic
1114194011 14:20461328-20461350 TGAGCGGGAGGCGGCGGTGGCGG - Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115474485 14:33800384-33800406 TCCCCGCAGGGCGGCGGCGGTGG + Exonic
1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG + Intronic
1117602571 14:57390638-57390660 TGCGAAGGAGGCGGCGGCGGTGG + Exonic
1117803105 14:59464974-59464996 AGCGCGGGAGGCGGGGGCGGCGG - Exonic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118776987 14:68979333-68979355 GCCGAGGCGGGCGGGGGCGGGGG + Intronic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1119410283 14:74426092-74426114 GGCGGGGCGGGCGGCGGCGGCGG - Exonic
1120993274 14:90397081-90397103 GGCGGCGCAGGCGGCGGCGGCGG + Exonic
1122143374 14:99675232-99675254 GGGGCGGCGGGCGGCGGCGGGGG + Exonic
1122436826 14:101706335-101706357 GCCGCTGCAGGCAGCGCCGGAGG + Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122445040 14:101761841-101761863 GCGGGGGCAGGCGGCGGCAGGGG + Exonic
1122690324 14:103529203-103529225 TCCGCGACGCGCGGCGGCGGCGG - Exonic
1123053683 14:105559648-105559670 TCCGCGGCAGGCGCTGGGGAGGG + Intergenic
1123078258 14:105680047-105680069 TCCGCGGCAGGCGCTGGGGAGGG + Intergenic
1125329055 15:38564696-38564718 GAGCCGGCAGGCGGCGGCGGTGG - Exonic
1125535984 15:40441397-40441419 TCCCGGGCTGGCGGGGGCGGTGG - Intronic
1125608067 15:40953397-40953419 ACCGCGGCAGCTGGCCGCGGTGG + Exonic
1125677585 15:41511211-41511233 GCCGCGGCCGGCGGCTTCGGGGG - Exonic
1125852771 15:42920547-42920569 CCCGCCGCAGTCGGCGGTGGGGG - Intronic
1125916578 15:43493131-43493153 TTCGCGGCCGGTGGCGGCGGTGG - Exonic
1126113197 15:45187488-45187510 TCATCAGCAGGCGGCGCCGGGGG + Intronic
1126837067 15:52678721-52678743 TCCGCGGCCGGCTCCGGGGGAGG + Intronic
1127144110 15:56007288-56007310 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144118 15:56007306-56007328 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144126 15:56007324-56007346 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144134 15:56007342-56007364 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144142 15:56007360-56007382 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127267988 15:57376543-57376565 GACGCGGGAGGAGGCGGCGGCGG + Exonic
1127515509 15:59689362-59689384 GGCGCGGCAGCCGGCGGTGGAGG + Exonic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1128972247 15:72117988-72118010 ACTGCGAGAGGCGGCGGCGGAGG - Exonic
1129082355 15:73052310-73052332 ACCGCGGACGGCGGGGGCGGGGG - Intronic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1130076592 15:80695281-80695303 CCGGCGGCAGGAGGAGGCGGAGG - Exonic
1130335283 15:82952701-82952723 CCCGCGCCTGGCGGCGGTGGCGG - Exonic
1131825963 15:96322716-96322738 TCAGCGGCCGGCGGCGAGGGCGG - Intergenic
1131827204 15:96331273-96331295 CCCGGGGCAGGCGGCGGCGGCGG + Exonic
1132548993 16:546663-546685 TTTGAGGCAGGCGGCGGTGGGGG - Intronic
1132552773 16:560241-560263 TGCGCGCCAGGGGGCGGCGGGGG + Intergenic
1132584679 16:700957-700979 TCCGGAGGAGGCGGCGGGGGCGG + Intronic
1132591140 16:726985-727007 TCCGGGCCGGGCGGGGGCGGGGG + Intronic
1132656568 16:1044046-1044068 CCCTGGGCCGGCGGCGGCGGGGG + Intergenic
1132877961 16:2148666-2148688 TCCCCTGGCGGCGGCGGCGGCGG - Exonic
1133032922 16:3020305-3020327 GCCCCGGAAGGCGGGGGCGGGGG + Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133197828 16:4183717-4183739 TCCGCGGCGTGAAGCGGCGGAGG + Intergenic
1133634655 16:7653842-7653864 CCCTCGGTAGGCGGCCGCGGCGG - Exonic
1133649567 16:7798879-7798901 TCCTCGGCAGGCTGAGGCAGGGG - Intergenic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1133916081 16:10111328-10111350 GCAGCGGCAGGCGGCCGCGCGGG + Intronic
1134696985 16:16232533-16232555 GCGGCGGCTGGCGGCGGCGGTGG + Exonic
1135712490 16:24729659-24729681 TCTGGGGCCTGCGGCGGCGGCGG + Intergenic
1135898348 16:26431135-26431157 TACTCGGCAGGCGGAGGCAGGGG - Intergenic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136269869 16:29142004-29142026 TCCGTGGCATGAGGGGGCGGTGG + Intergenic
1136540226 16:30924386-30924408 TCGGCGGCCATCGGCGGCGGGGG - Intronic
1136683655 16:31981958-31981980 GCCCGGGCTGGCGGCGGCGGGGG + Intergenic
1136784282 16:32925518-32925540 GCCCGGGCCGGCGGCGGCGGGGG + Intergenic
1136885502 16:33928288-33928310 GCCCGGGCCGGCGGCGGCGGGGG - Intergenic
1137655256 16:50153549-50153571 TGCGCCTGAGGCGGCGGCGGCGG + Intronic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1138619190 16:58198016-58198038 CCCCCAGGAGGCGGCGGCGGCGG + Intergenic
1139615421 16:68085635-68085657 TCCTCCTCAGGCGGCGGCGGCGG - Intronic
1139631842 16:68236011-68236033 CCCGGGGGAGGGGGCGGCGGCGG + Exonic
1140223107 16:73058184-73058206 TCGCCGGCGGCCGGCGGCGGCGG + Intronic
1140223248 16:73058688-73058710 CGCGCTGCTGGCGGCGGCGGCGG + Intronic
1140223310 16:73058910-73058932 TGCAAAGCAGGCGGCGGCGGCGG + Intronic
1140442620 16:74999256-74999278 CCCGCGGGAGGAGGCGGAGGAGG - Exonic
1141054642 16:80804087-80804109 GCGGCGGCGGGCGGCGGCGGCGG - Intronic
1141683025 16:85555109-85555131 GCGGCTGAAGGCGGCGGCGGCGG - Intergenic
1141993398 16:87622743-87622765 TCAGCGGCAGGGTGGGGCGGGGG - Intronic
1142068613 16:88076831-88076853 TCTCCGGCTGGGGGCGGCGGCGG - Exonic
1142319577 16:89372286-89372308 TCTGGGGCAGGCGGAGGCGGCGG + Intronic
1203086939 16_KI270728v1_random:1189524-1189546 GCCCGGGCCGGCGGCGGCGGGGG + Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142811789 17:2399010-2399032 GCCGCGGCGGGCGGGGGTGGGGG - Intronic
1142848244 17:2692297-2692319 TGCGGGGCAGCCGGCGGGGGCGG - Intronic
1143499456 17:7330356-7330378 TCCCCGGCCGGCAGCGGTGGGGG + Intergenic
1143520169 17:7440226-7440248 ACCGGGGCAGGCGGGGGCTGGGG - Intronic
1144500955 17:15786471-15786493 CCTGCGGCTGACGGCGGCGGGGG + Intergenic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144662304 17:17079058-17079080 ACTGCGGCAGGGGGTGGCGGGGG + Intronic
1144910060 17:18673040-18673062 TCCCCAGGCGGCGGCGGCGGCGG - Exonic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1146058655 17:29593411-29593433 TCCTCGCGAGGCGGCGGCGGCGG - Intronic
1146182984 17:30709209-30709231 TCCTCGGCAGACGGCGGGGCGGG - Intergenic
1146187263 17:30731943-30731965 TCCGGGGGAGGCGGCTTCGGGGG + Intergenic
1146332305 17:31937304-31937326 TCCGGGGGAGGCGGCTTCGGGGG + Exonic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1146492351 17:33292124-33292146 CCCGCGGCTGGCGGCAGCGGCGG + Exonic
1147144573 17:38477665-38477687 GCCCGGGCCGGCGGCGGCGGGGG + Exonic
1147285911 17:39402285-39402307 GGCGGGGGAGGCGGCGGCGGCGG - Intronic
1147313149 17:39606740-39606762 GGCGGGGCAGGCGGCGGAGGTGG - Intronic
1147402861 17:40191538-40191560 TCAGGGGCGGGCGGCGGCGCGGG - Intronic
1147591850 17:41688984-41689006 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1147971137 17:44219570-44219592 TCCGGGCGAGGCGGCGGCGCTGG + Intronic
1148060099 17:44830241-44830263 GGAGCGGGAGGCGGCGGCGGCGG - Intronic
1148122660 17:45222005-45222027 GCAGCGGCTGGCGGTGGCGGCGG - Exonic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1148180663 17:45602318-45602340 TCTGCGGGTGGCGGCGGCGCGGG - Intergenic
1148268240 17:46243606-46243628 TCTGCGGGCGGCGGCGGCGCGGG + Intergenic
1148786835 17:50149729-50149751 GACGGGGCGGGCGGCGGCGGCGG + Exonic
1148852256 17:50560971-50560993 TCCGCGCCAGGCGGCGGGGGAGG - Intergenic
1149430656 17:56593888-56593910 TCCCGGGCCGGCGGCGGCGCAGG - Exonic
1149599693 17:57885491-57885513 GCCGGGGCACGCGGGGGCGGGGG - Exonic
1149995877 17:61405690-61405712 TCGGTGGCAGGCGGCGGCAACGG + Exonic
1150055267 17:62008679-62008701 TCGGGGGGAGGGGGCGGCGGGGG - Intronic
1150326624 17:64263135-64263157 TCAGGGCCAGGCGGGGGCGGTGG - Intronic
1150638588 17:66933880-66933902 TCCACGGCTGGCGGGGGGGGGGG + Intergenic
1151812546 17:76453020-76453042 TCCGAGGCGGGCGCCGGCGCCGG + Exonic
1152049188 17:77959098-77959120 CCCGGCGCGGGCGGCGGCGGCGG - Intergenic
1152049237 17:77959240-77959262 TCCGTCCCCGGCGGCGGCGGCGG - Intergenic
1152111556 17:78359971-78359993 ACCGCGGCAAGGGGCCGCGGCGG + Exonic
1152362541 17:79839352-79839374 TGCGGGGCGAGCGGCGGCGGCGG - Exonic
1152433103 17:80260507-80260529 CGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433115 17:80260534-80260556 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433128 17:80260564-80260586 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433141 17:80260594-80260616 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433154 17:80260624-80260646 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433167 17:80260654-80260676 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433180 17:80260684-80260706 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433193 17:80260714-80260736 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433206 17:80260744-80260766 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433219 17:80260774-80260796 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433232 17:80260804-80260826 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152725281 17:81942055-81942077 TGCGCGGGAGGCGGAGGTGGGGG - Intronic
1152970705 18:158668-158690 GCGGCGGGAGGCGGCGGCGCAGG - Exonic
1153457232 18:5295278-5295300 CCCGCGGCCGGGGGCGGGGGCGG + Intronic
1153794395 18:8609479-8609501 TCCTCTCCCGGCGGCGGCGGCGG + Exonic
1154367671 18:13726346-13726368 GCGGCGGGAAGCGGCGGCGGCGG - Exonic
1154367672 18:13726349-13726371 TGCGCGGCGGGAAGCGGCGGCGG - Exonic
1154494330 18:14944631-14944653 TCAGCGGCAGGGGGCCGGGGGGG + Intergenic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1156008514 18:32470687-32470709 GCGGCTGCGGGCGGCGGCGGCGG + Intergenic
1156036624 18:32772137-32772159 TCCGAGCCGGGCGGCGGCGGCGG - Exonic
1156502018 18:37566137-37566159 GCCACGGCGGGCGGCGGCCGGGG + Intergenic
1157279121 18:46334246-46334268 TCCTCGCGCGGCGGCGGCGGCGG - Exonic
1157464291 18:47930764-47930786 GCCGCGGCGGCCGGCGGCCGAGG - Intronic
1157496800 18:48162090-48162112 TGGGCGGCCTGCGGCGGCGGGGG - Intronic
1157706651 18:49813386-49813408 TCCGCGGCGGCCGGAAGCGGAGG + Intronic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1158259096 18:55588109-55588131 GCAGGAGCAGGCGGCGGCGGTGG - Intronic
1158436035 18:57435957-57435979 TGCGCGGTTGGAGGCGGCGGAGG - Exonic
1158601943 18:58863512-58863534 GCCGGGCCGGGCGGCGGCGGCGG - Intronic
1158602113 18:58864069-58864091 TGCCCGGCCGGCGCCGGCGGGGG - Intronic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1159045746 18:63367245-63367267 GCCGGGGCGGGCCGCGGCGGAGG + Exonic
1160163707 18:76493319-76493341 TCCGCGGGGGGCGGGGGGGGGGG + Intronic
1160680317 19:409106-409128 TTCGATGCGGGCGGCGGCGGCGG + Exonic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719128 19:589888-589910 GCTCCGGCCGGCGGCGGCGGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160826864 19:1084312-1084334 CCCGCTGCAGGAGGCGGCGGCGG + Exonic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160935503 19:1592723-1592745 GCCGCGGCAAGTGGCGGCGGCGG - Intronic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161108781 19:2456974-2456996 GCCGCGGCGGGCGGCGGGCGCGG - Exonic
1161215796 19:3094554-3094576 GCCGCGGCGGGCGGCGGCCGAGG + Exonic
1161439050 19:4280112-4280134 TCCGGGGTGGGCGGCTGCGGAGG - Exonic
1161608807 19:5229649-5229671 GCCGCGGAAGGTGGAGGCGGAGG - Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162046891 19:8005801-8005823 TCCGCGGCCGGCGGAGACGCGGG + Intronic
1162118234 19:8445153-8445175 TCCGCGGCCGACGCGGGCGGCGG + Intronic
1162975812 19:14206559-14206581 TCCTCGGCAGACGGCGGGGCGGG + Intergenic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163146152 19:15380234-15380256 TCCTCTGGGGGCGGCGGCGGTGG + Exonic
1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG + Exonic
1164617228 19:29674481-29674503 GCAGCGGCAGGAGGAGGCGGAGG + Exonic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165080114 19:33302104-33302126 CCCACGGGCGGCGGCGGCGGCGG - Exonic
1165300322 19:34964252-34964274 AGGGCTGCAGGCGGCGGCGGTGG - Intergenic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165850860 19:38849704-38849726 GGGGCGGCGGGCGGCGGCGGCGG - Exonic
1165850899 19:38849839-38849861 GCGGCGGCGGGCGGCGGAGGCGG - Exonic
1166306870 19:41940287-41940309 TCTTCATCAGGCGGCGGCGGGGG + Intergenic
1166358676 19:42242525-42242547 CCCGGGGGAGGCGGCGGCAGCGG - Exonic
1166361255 19:42253870-42253892 TCCCCCGGCGGCGGCGGCGGCGG - Intronic
1166702715 19:44891455-44891477 GCCGGCGCAGGCGGCGGTGGCGG - Exonic
1166748325 19:45152468-45152490 GCCGCGCCAGGCGGTGGCGTGGG - Exonic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1166843415 19:45712423-45712445 TCCCGGGCAGGGGGCGGAGGGGG + Exonic
1166872050 19:45876925-45876947 TCCGCGGGAGGAGTCGGTGGTGG + Intergenic
1166876646 19:45901868-45901890 TCTGGGAGAGGCGGCGGCGGGGG - Intronic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
1166983887 19:46648741-46648763 CCTGCGGGAGGCGTCGGCGGGGG - Exonic
1167145532 19:47679423-47679445 CCTGCGACAGGGGGCGGCGGCGG + Exonic
1167258089 19:48442982-48443004 GCCGGGGAAGGCGCCGGCGGGGG - Exonic
1167323516 19:48810847-48810869 TCCGCTGCAGGGCGCGGAGGAGG - Intronic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1167638631 19:50668526-50668548 GCCACGGCGGGCGGCGGCTGCGG + Exonic
1168076323 19:53982538-53982560 GCGGGGGCCGGCGGCGGCGGCGG + Exonic
1168146495 19:54422297-54422319 TCGACGGCAGGCGGAGGCTGCGG + Exonic
1168294031 19:55370146-55370168 TCGGAGACAGGAGGCGGCGGAGG - Intronic
1168305538 19:55433277-55433299 TCCGACGCCGGCGGGGGCGGGGG - Exonic
925609789 2:5693142-5693164 AGCGCGGCCGGCGGCGGCGGCGG + Exonic
926035174 2:9630693-9630715 CCCGCGGCTGGAGGAGGCGGGGG + Intronic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926090028 2:10043626-10043648 TGGGCTGCGGGCGGCGGCGGCGG - Exonic
926101757 2:10122528-10122550 TCTCCGGAAGGCGCCGGCGGAGG + Exonic
926128724 2:10287019-10287041 TCCGTGGCAGGTACCGGCGGAGG - Intergenic
926154898 2:10448285-10448307 GGGGCGGCGGGCGGCGGCGGCGG + Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927472121 2:23384930-23384952 ACCGCGGGGGGCGGGGGCGGCGG + Intergenic
927887601 2:26728245-26728267 ACGGCGGCAGCGGGCGGCGGCGG + Exonic
927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG + Intergenic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
928983222 2:37156925-37156947 TCTCCGGCCGGCGGCGGCGGCGG - Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929174235 2:38960560-38960582 TGCGCCGCGGGCGGCGACGGCGG - Exonic
929778340 2:44942231-44942253 GGCGCGGGAGGCGGCAGCGGCGG + Exonic
929778355 2:44942282-44942304 GGCGGAGCAGGCGGCGGCGGCGG + Exonic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
931253391 2:60551852-60551874 CCCGGAGCAGGCGGCGGCGGCGG - Intronic
931253668 2:60553278-60553300 TGCGGGGCGGGCGGCGGCGGCGG + Exonic
931671713 2:64653815-64653837 GCGGCGGCAGGCAGCGGAGGAGG + Exonic
932231501 2:70087562-70087584 GCAGGGGCGGGCGGCGGCGGCGG - Exonic
932765311 2:74465384-74465406 CCGGCGGGAGGCGGAGGCGGAGG - Exonic
933684618 2:85133431-85133453 GGCGGAGCAGGCGGCGGCGGTGG + Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934638288 2:96010473-96010495 TGCGGGGCGGGCGGCGCCGGGGG - Intergenic
934678252 2:96265334-96265356 TGCCCGGCGGGCGCCGGCGGAGG - Exonic
934783297 2:96986541-96986563 TCCCCAGCTGGCGGCGGCGGCGG - Exonic
934795365 2:97094937-97094959 TGCGGGGCGGGCGGCGCCGGGGG + Intergenic
935592549 2:104855589-104855611 GCAGGGGCTGGCGGCGGCGGGGG + Exonic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936713607 2:115161418-115161440 ACCGCGGAAGCCGGCGGCCGTGG + Intronic
937221807 2:120346282-120346304 GGCGCGGCAGGCGTCGGCGGGGG - Exonic
937261138 2:120587378-120587400 CCCGCGGCCGGCGGAGGTGGGGG + Intergenic
938440852 2:131331147-131331169 GCAGCAGCTGGCGGCGGCGGCGG + Intronic
938451544 2:131425332-131425354 TCGGCAGGCGGCGGCGGCGGCGG - Intergenic
938451546 2:131425335-131425357 GCCTCGGCAGGCGGCGGCGGCGG - Intergenic
938487361 2:131724218-131724240 GCCGGCGCAGGCGGCGGTGGCGG + Intronic
940009483 2:149038814-149038836 AGCGCAGCAGGCGGGGGCGGTGG + Intronic
940830033 2:158456920-158456942 AGCGGGGCGGGCGGCGGCGGCGG + Intergenic
941020925 2:160407531-160407553 ATCGCTGCGGGCGGCGGCGGCGG + Intronic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942046520 2:172102303-172102325 CACCCGGCGGGCGGCGGCGGCGG - Exonic
942061896 2:172234958-172234980 TCGGCGGTGGGCGGCGCCGGGGG + Intergenic
942448392 2:176093049-176093071 TTCGGGGCGGGCGGCGGCGGCGG + Exonic
942451027 2:176107998-176108020 ACCGGGGCTGGTGGCGGCGGGGG + Exonic
942748647 2:179264407-179264429 GCCGGTGCAGTCGGCGGCGGCGG - Intronic
942890366 2:180980634-180980656 GCCGAGCCGGGCGGCGGCGGCGG + Exonic
942944335 2:181656880-181656902 CCCGCAGCAGACGGAGGCGGCGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
943645907 2:190408113-190408135 TCCGCCTCCTGCGGCGGCGGCGG - Intergenic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944221809 2:197310746-197310768 TCGGCGGGAGGAGGCGGCGGCGG - Exonic
944433217 2:199659347-199659369 GCCGCGCCCGGCGGCGGCTGGGG - Intergenic
944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG + Intergenic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944743681 2:202635410-202635432 GGCCCCGCAGGCGGCGGCGGCGG + Exonic
944743684 2:202635413-202635435 CCCGCAGGCGGCGGCGGCGGCGG + Exonic
945431660 2:209771994-209772016 GCAGCGGGAGGAGGCGGCGGCGG + Exonic
946322126 2:218960283-218960305 GCTGGGGGAGGCGGCGGCGGAGG - Exonic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
946692399 2:222319461-222319483 TCGGCAGGCGGCGGCGGCGGCGG + Intergenic
947119483 2:226800023-226800045 CCCGCGGCGGGCGCAGGCGGGGG + Intergenic
947860530 2:233354564-233354586 TCCTCGGGCGGCGGCGGCGGAGG - Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
948386106 2:237582036-237582058 TCCGCAGCAGGCCCTGGCGGGGG + Intronic
1168757198 20:325853-325875 TCCGCGGCTGGGGGTGGGGGAGG - Exonic
1169093169 20:2873626-2873648 TCCGAGCCCCGCGGCGGCGGCGG - Intronic
1169278486 20:4248869-4248891 TCCAGCGCGGGCGGCGGCGGGGG - Exonic
1170150505 20:13221723-13221745 GCGGCGGCCGGCGGCGGCGGCGG - Intergenic
1170150506 20:13221726-13221748 GGCGCGGCGGCCGGCGGCGGCGG - Intergenic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1170890091 20:20368871-20368893 TCCGCGGCGGTAGGGGGCGGGGG - Exonic
1170999147 20:21396423-21396445 CCCGCTGCACGCGGCGGCGGCGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172951201 20:38724436-38724458 GCTGCGGAGGGCGGCGGCGGCGG - Intergenic
1173221800 20:41137616-41137638 TCCGACGCTGGGGGCGGCGGCGG - Exonic
1173454160 20:43189993-43190015 GCCCGGGCGGGCGGCGGCGGCGG - Intergenic
1173672932 20:44810484-44810506 TGTGCTGCTGGCGGCGGCGGCGG + Intergenic
1174287738 20:49484108-49484130 TCCGAGGCGGGGGGCGCCGGCGG + Intergenic
1174374006 20:50113224-50113246 TCCGGGGCGGGCGTCAGCGGCGG - Intronic
1174386542 20:50191076-50191098 TTAAAGGCAGGCGGCGGCGGCGG - Exonic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1174386667 20:50191529-50191551 AGCTCGGCGGGCGGCGGCGGCGG - Exonic
1175340938 20:58228608-58228630 GATGCGGCGGGCGGCGGCGGGGG - Exonic
1175911416 20:62407044-62407066 GCCTCGGCGGGCGGCGGCGGGGG + Exonic
1176157018 20:63627015-63627037 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1176207111 20:63895199-63895221 ACCCCGGGCGGCGGCGGCGGCGG - Exonic
1176549732 21:8216028-8216050 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176550162 21:8217354-8217376 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176557623 21:8260257-8260279 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568657 21:8399062-8399084 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176569090 21:8400389-8400411 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176576568 21:8443291-8443313 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176577004 21:8444624-8444646 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176952665 21:15064957-15064979 AACTCGGGAGGCGGCGGCGGAGG - Exonic
1177792784 21:25738216-25738238 TTGGGGGCAGGGGGCGGCGGCGG - Intronic
1177834085 21:26170695-26170717 GCCCCGGGAGACGGCGGCGGTGG - Intronic
1179529542 21:42009633-42009655 TCCGCGGGAGGGGCCGGGGGCGG + Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179674904 21:42974739-42974761 GCGGCGGCGGGCGGCGGCCGCGG - Intronic
1179775527 21:43659544-43659566 TGCACAGAAGGCGGCGGCGGCGG - Exonic
1180064542 21:45405736-45405758 TCCGCGGCCGGCGGGGTCGTCGG + Intronic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180177647 21:46098235-46098257 TCCTGGGAAGGCGGCGGCGGCGG + Intronic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1180961938 22:19766185-19766207 CCCTCTGCGGGCGGCGGCGGCGG - Intronic
1180962036 22:19766499-19766521 CCCGGGGCCGGCGGCGCCGGCGG + Exonic
1181793072 22:25282860-25282882 TCAGCTGGCGGCGGCGGCGGCGG + Intergenic
1181813709 22:25421138-25421160 GGCGCGGCGGGCGGCGGCCGCGG + Intergenic
1181831671 22:25564960-25564982 GGCGCGGCGGGCGGCGGCGGCGG + Exonic
1182237001 22:28883808-28883830 GGCGGCGCAGGCGGCGGCGGCGG - Exonic
1182338113 22:29598595-29598617 TACGCGGGAGGCTGAGGCGGAGG + Intergenic
1182374727 22:29838214-29838236 ACCGTGGTCGGCGGCGGCGGCGG - Exonic
1183409697 22:37647534-37647556 TCTGCGGCAGGCTGGGGAGGCGG - Intronic
1183963354 22:41426214-41426236 TCCACAGCAGGAGGCGGCCGAGG - Intergenic
1184004670 22:41699544-41699566 TGTGAGGCAGGCGGCGACGGCGG + Exonic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184523808 22:45009883-45009905 CGCGCGGGAGGAGGCGGCGGCGG - Intronic
1203254618 22_KI270733v1_random:132349-132371 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203255055 22_KI270733v1_random:133686-133708 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203262674 22_KI270733v1_random:177428-177450 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203263111 22_KI270733v1_random:178765-178787 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
949987520 3:9552690-9552712 GGCGGGGCCGGCGGCGGCGGCGG + Exonic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951208320 3:19947259-19947281 TCCAGCGCCGGCGGCGGCGGCGG + Exonic
952241226 3:31532942-31532964 CTCGCACCAGGCGGCGGCGGCGG + Exonic
952382892 3:32818201-32818223 TCGTCGGGGGGCGGCGGCGGGGG + Exonic
952646439 3:35664667-35664689 TCCGGAGCAGGTGGCGGCGGGGG + Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
953027528 3:39153557-39153579 TGCGCGTCCGGCAGCGGCGGCGG + Exonic
953705208 3:45225817-45225839 CCCGGAGGAGGCGGCGGCGGCGG - Exonic
954004205 3:47578822-47578844 GCGGCGGACGGCGGCGGCGGCGG - Exonic
954004206 3:47578825-47578847 ACAGCGGCGGACGGCGGCGGCGG - Exonic
954249694 3:49358248-49358270 TGCTCGGCTAGCGGCGGCGGCGG - Exonic
954402876 3:50328194-50328216 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
954540766 3:51391751-51391773 TCGGCCCCAGGCGGTGGCGGAGG - Exonic
954575034 3:51671267-51671289 TCCGCAGCGGGCGGCTGCTGAGG + Exonic
954702043 3:52455606-52455628 TCTGCGCCGGGCGGCGGTGGCGG + Exonic
955387615 3:58492070-58492092 CCCGCGCCCGGCGACGGCGGCGG - Intergenic
955911548 3:63863834-63863856 GCGGCGGTTGGCGGCGGCGGAGG + Exonic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
960664120 3:120094031-120094053 TCAGAGGCGGGCGGTGGCGGTGG + Intronic
960955251 3:123026947-123026969 GGCTCCGCAGGCGGCGGCGGTGG + Intronic
961012915 3:123448133-123448155 CCCCCTGCGGGCGGCGGCGGCGG - Exonic
961182379 3:124887040-124887062 TCCGCGGGGGCCGGCGGCCGGGG + Exonic
961623006 3:128239523-128239545 TCTGAGGCAGGCGGGGGCAGAGG - Intronic
961698822 3:128726139-128726161 TCCGCTCGGGGCGGCGGCGGTGG + Exonic
961735706 3:129001232-129001254 TCCGCGCCAGGCGGGCGGGGCGG + Intronic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963733073 3:148991436-148991458 TGCGCGGCCGGCAGGGGCGGTGG - Exonic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
964570786 3:158105828-158105850 GCCGGCGGAGGCGGCGGCGGAGG - Exonic
964743310 3:159989084-159989106 GCCGCGGCAGGTGAGGGCGGTGG - Exonic
965475233 3:169147841-169147863 ACCGAGGCAGGAGGGGGCGGGGG + Intronic
966866514 3:184261462-184261484 CGCTGGGCAGGCGGCGGCGGCGG + Exonic
968114792 3:196081558-196081580 TGCGCGGCGTGCGGCGCCGGGGG - Intronic
968478115 4:821873-821895 TCCGCGGCAGGCTGGGCCGCAGG - Intronic
968850269 4:3073942-3073964 CCCGCTCCAGGCGTCGGCGGGGG + Intergenic
970333133 4:15004168-15004190 TTCATGGCGGGCGGCGGCGGAGG - Exonic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
971196156 4:24472740-24472762 GCCGGCACAGGCGGCGGCGGCGG - Intergenic
972765942 4:42152281-42152303 TCAGCGACAGGCGGCGGCGGCGG - Exonic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
974047137 4:56907864-56907886 CCCGCGGGCGGTGGCGGCGGCGG + Intronic
975778980 4:77819664-77819686 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
975985377 4:80197375-80197397 TGCGAGGCAGGCGGCGCCGGAGG + Intronic
976830343 4:89307875-89307897 TCTGCGCCCGGCGGGGGCGGCGG - Exonic
977809714 4:101346099-101346121 TCCGCGCGGGGCGGGGGCGGGGG - Intronic
978361068 4:107931659-107931681 TCCTCGGCCGGCGGCTGCGACGG - Exonic
978384642 4:108167733-108167755 TCCGGAGGAGGTGGCGGCGGCGG - Exonic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
979283033 4:118888861-118888883 TTCGCAGCAGGCGGCTGGGGCGG + Exonic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
980053796 4:128061540-128061562 GCCTCGGCGGGCGGCGGCAGCGG + Intronic
980053798 4:128061543-128061565 TCGGCGGGCGGCGGCAGCGGCGG + Intronic
981270742 4:142845721-142845743 TCCCAGGCCGGCGGCGGCGGCGG + Intronic
982042364 4:151409027-151409049 GGCGGGGCCGGCGGCGGCGGGGG + Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
983940161 4:173529185-173529207 GCAGCGGCTGGCGGCGGCGGCGG + Exonic
985791696 5:1931584-1931606 CCCGCGGGTGGCGGCGGCTGTGG - Intergenic
986858798 5:11903700-11903722 CGGCCGGCAGGCGGCGGCGGCGG - Intronic
987050403 5:14143567-14143589 GCGGCGGGGGGCGGCGGCGGCGG - Intergenic
990545249 5:56815637-56815659 CCTGAGGCAGGCGGCGGCGGAGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
992052750 5:72956199-72956221 TGCGCTTCGGGCGGCGGCGGCGG + Intronic
992473159 5:77077435-77077457 TGCGCGGCAGCCGGCGGGAGCGG - Exonic
993292103 5:86086970-86086992 TGCTAGGCAGGGGGCGGCGGTGG - Intergenic
995052721 5:107724736-107724758 TGGGCGGGAGGCGGCAGCGGTGG - Intergenic
995224953 5:109690751-109690773 TGGGCGGCGTGCGGCGGCGGCGG + Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
998364279 5:141618814-141618836 CCCTCGGCGGGCGGCGACGGCGG - Exonic
1001586412 5:172835997-172836019 ACAGGGGCAGGGGGCGGCGGTGG - Intronic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002352040 5:178590127-178590149 AATGCGGCGGGCGGCGGCGGCGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1004193976 6:13487714-13487736 CCCGGAGCTGGCGGCGGCGGGGG - Intergenic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004396123 6:15248128-15248150 CCCGTGGCTGGCGGCGGCTGCGG + Intronic
1005040344 6:21595189-21595211 ATCCTGGCAGGCGGCGGCGGCGG + Exonic
1006180393 6:32150534-32150556 GCGGCGGCAGCGGGCGGCGGCGG + Exonic
1006180396 6:32150537-32150559 GCGGCAGCGGGCGGCGGCGGGGG + Exonic
1006256781 6:32838498-32838520 GCCGCGGCAGGCGGGGGTGGGGG - Intronic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1007673482 6:43575957-43575979 GCCGCGGCGGGCGGCGGGGGTGG + Exonic
1007784199 6:44270773-44270795 AGCGCCGCCGGCGGCGGCGGCGG + Exonic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1007901700 6:45419895-45419917 GCAGTGGCAGGCGGCGGCTGTGG + Intronic
1007902216 6:45422738-45422760 GCAGCAGCAGGAGGCGGCGGCGG + Exonic
1007902217 6:45422741-45422763 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1009431631 6:63572570-63572592 GGCGATGCAGGCGGCGGCGGGGG - Exonic
1009431644 6:63572614-63572636 TGCAGGGCAGGAGGCGGCGGTGG - Exonic
1011128764 6:84033788-84033810 GCGGTGGGAGGCGGCGGCGGCGG + Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011931792 6:92723601-92723623 CCCGGGGCTGGCGGCGACGGAGG - Intergenic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1013099457 6:106974815-106974837 GAGGCGGCGGGCGGCGGCGGAGG - Intronic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1014137622 6:117907476-117907498 GCCGGGGCGGGCGGCGGCGGCGG + Intergenic
1014246898 6:119078810-119078832 TGCGGGACTGGCGGCGGCGGCGG - Intronic
1014802381 6:125791091-125791113 TCAGCGGCGGGCGGCGGCGAGGG - Intronic
1015024919 6:128520700-128520722 TCTCCGGCAGGAGGCGGTGGCGG - Intergenic
1016923329 6:149317425-149317447 GGAGCAGCAGGCGGCGGCGGCGG - Intronic
1017164214 6:151391768-151391790 AGTGCTGCAGGCGGCGGCGGCGG - Intergenic
1017672280 6:156778839-156778861 CCCGGCGCGGGCGGCGGCGGCGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672317 6:156778971-156778993 GCAGCAGCAGGAGGCGGCGGCGG + Exonic
1017672318 6:156778974-156778996 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017842351 6:158232212-158232234 GCGGGGGGAGGCGGCGGCGGCGG + Intergenic
1018078097 6:160234124-160234146 TTCTCGGCAGGCAGGGGCGGGGG - Intronic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019343717 7:519916-519938 TCCGGGGGAGGCGGGGGGGGGGG - Intronic
1019529042 7:1494562-1494584 TCCGGGGGAGGCTGCGGCTGGGG + Intronic
1019536130 7:1530786-1530808 CGAGCGCCAGGCGGCGGCGGCGG + Exonic
1019564671 7:1673487-1673509 TCCGGGGCAGGGGGCGGGGAGGG - Intergenic
1019577681 7:1745422-1745444 TCCGGCGGAGGCGGGGGCGGCGG - Exonic
1019681919 7:2355171-2355193 TCCTCGGCGGCCGGCGGCGAGGG - Exonic
1019828222 7:3301263-3301285 TCAGCGCCGGGCGGGGGCGGCGG + Intergenic
1019828330 7:3301608-3301630 TCGGCGGCCGGTGGCGGCGGCGG + Exonic
1019913021 7:4113041-4113063 GCCAAGGCAGGCGGTGGCGGGGG - Intronic
1019989585 7:4682394-4682416 CGCGGGGAAGGCGGCGGCGGCGG - Exonic
1020096242 7:5371040-5371062 TCCGCGGCGGGCAGTGGCAGCGG + Exonic
1020727339 7:11832144-11832166 CCCGCCAGAGGCGGCGGCGGCGG - Exonic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1021828051 7:24573749-24573771 GGACCGGCAGGCGGCGGCGGCGG + Intronic
1022100293 7:27165322-27165344 TCCCCGGCAGGCGGCGACGCTGG - Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022101965 7:27174167-27174189 GGCGAGGCAGGCGGCGGTGGTGG - Exonic
1022207562 7:28179676-28179698 TCCGCGCCAGGCCGGGGCAGGGG + Intronic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1022973487 7:35537300-35537322 CCCGCGGCAGGGCGGGGCGGGGG + Intergenic
1023417890 7:39949849-39949871 ACCTCTGCTGGCGGCGGCGGCGG + Intergenic
1023417892 7:39949852-39949874 TCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1023881709 7:44324892-44324914 CGAGCGGCAGGCGGCGGGGGTGG - Intronic
1024471649 7:49773409-49773431 TCTGCGGCCGGCTGCGGAGGTGG + Intergenic
1025069776 7:55887831-55887853 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069785 7:55887854-55887876 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069794 7:55887879-55887901 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025916924 7:65873339-65873361 GCGGAGGGAGGCGGCGGCGGCGG + Intronic
1026360533 7:69598377-69598399 GCTGAGGCGGGCGGCGGCGGCGG + Intergenic
1026968297 7:74453932-74453954 TCCGCCGCAGCCCGCGCCGGGGG + Intronic
1027138195 7:75639190-75639212 ACCGGGGCAGGCGGCGGCGGCGG + Intronic
1027177678 7:75915090-75915112 CCCGCGGCCGGCGAAGGCGGTGG + Exonic
1028621487 7:92833567-92833589 TCCTCCGGCGGCGGCGGCGGCGG - Exonic
1029281560 7:99438948-99438970 CCCTCGGGCGGCGGCGGCGGCGG + Intronic
1029375639 7:100175568-100175590 TCACCTGCAGGCGGAGGCGGCGG + Exonic
1029461137 7:100694370-100694392 GCGGAGGGAGGCGGCGGCGGCGG - Intergenic
1029461139 7:100694373-100694395 GCCGCGGAGGGAGGCGGCGGCGG - Intergenic
1029537247 7:101163883-101163905 CACGCGGCAGGCCGCGGCGCAGG - Exonic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1032011795 7:128351981-128352003 GCTGGGGCGGGCGGCGGCGGCGG - Exonic
1032021573 7:128409702-128409724 TCCGGGGCGGGCGGCCGAGGAGG - Intronic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1034192732 7:149224099-149224121 ACGGGGGCAGGCGGCGGCTGTGG + Exonic
1034441217 7:151086862-151086884 CCCGGGGCCGGGGGCGGCGGCGG + Exonic
1034800593 7:154053075-154053097 TCGGGGGCGGGGGGCGGCGGCGG + Intronic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1036454065 8:8892933-8892955 CCCGGGGCAGGCCCCGGCGGCGG + Exonic
1036723757 8:11201218-11201240 CCCGGGGGAGGCGGCTGCGGCGG - Exonic
1037529115 8:19756999-19757021 CCCCCGGCGGGCAGCGGCGGAGG + Intronic
1038039746 8:23714669-23714691 CCCGCGGCGGGCGGCGGCACTGG - Intergenic
1038152655 8:24956532-24956554 TCCCCGGCCCGCGGCGGCGGTGG + Exonic
1039212815 8:35235800-35235822 GCCACCGCAGGCGGCGGCGGAGG + Exonic
1040760907 8:50842026-50842048 TCTGTGGCAGGCAGGGGCGGGGG - Intergenic
1041167208 8:55102141-55102163 CCTGCTGCTGGCGGCGGCGGCGG + Intergenic
1041689757 8:60678225-60678247 TGCGCGGCCGGCGGCGGCCGGGG - Intergenic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1042611665 8:70607787-70607809 CCTGCGGGAGGGGGCGGCGGCGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1044719754 8:95134004-95134026 ACGGCCGCGGGCGGCGGCGGCGG - Exonic
1044821881 8:96160713-96160735 TCCCCAGGAGGCGGTGGCGGCGG + Exonic
1046547433 8:115669111-115669133 GTCCCGGCGGGCGGCGGCGGCGG - Intronic
1046770367 8:118111689-118111711 CCGGCTGGAGGCGGCGGCGGCGG + Exonic
1049145967 8:141001232-141001254 TCCGGGACCGGCGGCGGCGGCGG + Intronic
1049405318 8:142449706-142449728 GCGGGCGCAGGCGGCGGCGGCGG + Exonic
1049419527 8:142510702-142510724 TCCGCGGCTCTCGGCGGCGGCGG + Intronic
1049585629 8:143431175-143431197 TCCGCTAGCGGCGGCGGCGGCGG + Intergenic
1049668388 8:143858950-143858972 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049668804 8:143860549-143860571 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669219 8:143862151-143862173 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669634 8:143863753-143863775 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670044 8:143865346-143865368 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049682120 8:143923994-143924016 GCAGCGGCAGCTGGCGGCGGAGG - Exonic
1049682454 8:143925701-143925723 GCGGCGGGAGGAGGCGGCGGTGG - Exonic
1049719653 8:144109880-144109902 TGCGGCGCAGGGGGCGGCGGCGG - Exonic
1049788485 8:144462528-144462550 CGCCGGGCAGGCGGCGGCGGCGG - Intronic
1049828311 8:144684807-144684829 TCTGCGGCAGGCGCGGGCTGGGG - Intergenic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1053007294 9:34612624-34612646 TCCGCGGCAGGTGTCGTCAGGGG - Intergenic
1053943499 9:43279861-43279883 ACCGCGGCACGGGGCGGGGGCGG + Intergenic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056799530 9:89681465-89681487 GCGGCGGGGGGCGGCGGCGGTGG - Intergenic
1056990467 9:91405885-91405907 TCGGCGGCCGGGGGCGGGGGTGG - Intergenic
1057995668 9:99820130-99820152 TCTGCGGCGCGCGCCGGCGGCGG + Intergenic
1059470934 9:114504716-114504738 GCCGGGGCGGGCGGCGGCGGGGG - Exonic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060468707 9:123930056-123930078 ACCCCTGGAGGCGGCGGCGGCGG - Exonic
1060700602 9:125746941-125746963 GCGGCGGCGGGCGGCGGCGGAGG - Intergenic
1060700610 9:125746960-125746982 CCCGGGGGAGGCAGCGGCGGCGG - Intergenic
1060811677 9:126614085-126614107 GCGGCGGCAGGCGGGGGAGGGGG - Intergenic
1060979646 9:127785177-127785199 ACCGGGGGAGGCGGAGGCGGGGG + Intergenic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061149070 9:128818743-128818765 TCGAGGGCTGGCGGCGGCGGCGG + Exonic
1061248424 9:129413387-129413409 GCCGCGGCGGGCGGGGGCCGGGG - Intergenic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1062444504 9:136587969-136587991 TGCGGGGGAGGCGGGGGCGGGGG + Intergenic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062619141 9:137411673-137411695 GGAGCGGCAGGCGGAGGCGGGGG + Intronic
1062721582 9:138047056-138047078 TCCCCGCCAGGCTGTGGCGGGGG + Intronic
1203471019 Un_GL000220v1:115493-115515 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203471455 Un_GL000220v1:116826-116848 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203478840 Un_GL000220v1:159465-159487 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203479276 Un_GL000220v1:160798-160820 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203586619 Un_KI270747v1:9766-9788 ACCGCGGCACGGGGCGGGGGCGG + Intergenic
1186496464 X:10015592-10015614 GCGGCGGCCGGCGGCGACGGCGG + Exonic
1186496486 X:10015677-10015699 ACCGCGGCGGGGGGCGCCGGCGG - Exonic
1186607965 X:11111347-11111369 TGAGAGGAAGGCGGCGGCGGCGG + Exonic
1186829856 X:13379310-13379332 TGCTCGGCCAGCGGCGGCGGCGG - Intergenic
1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG + Intronic
1189002794 X:36963746-36963768 CCCGCGGCCCGCGGCGGAGGTGG - Intergenic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189325559 X:40109013-40109035 TCCCGGGAACGCGGCGGCGGCGG + Intronic
1189473629 X:41333199-41333221 ACCGCGGGGGGCGGGGGCGGAGG + Intergenic
1190713058 X:53083052-53083074 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192533931 X:71911836-71911858 GCGGCGGCAGGAGCCGGCGGTGG + Intergenic
1194383605 X:93225034-93225056 TGCACCGCAGGCGGAGGCGGAGG + Intergenic
1197776329 X:130120879-130120901 CACGCGGAACGCGGCGGCGGCGG + Intergenic
1198310212 X:135422461-135422483 GCCGCGGCGGGGGGCGGAGGCGG + Intergenic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1200147773 X:153935295-153935317 GCCTCGGCAGGCGGGGGTGGGGG + Exonic
1200231022 X:154443978-154444000 TCCACAGGAGCCGGCGGCGGGGG + Intergenic
1200231075 X:154444191-154444213 GCGGCGGCGGGCGGCGGCGGCGG - Exonic
1200277855 X:154751153-154751175 GCCGCGGCGGCCGGAGGCGGGGG - Intronic