ID: 1142764696

View in Genome Browser
Species Human (GRCh38)
Location 17:2058568-2058590
Sequence CCCCGAGGGCGTCTTTGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 81}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142764687_1142764696 10 Left 1142764687 17:2058535-2058557 CCCCGGCCCCGACGGCAAGGGCA 0: 1
1: 0
2: 0
3: 12
4: 83
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764681_1142764696 19 Left 1142764681 17:2058526-2058548 CCCCGGCGTCCCCGGCCCCGACG 0: 1
1: 0
2: 1
3: 32
4: 278
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764689_1142764696 8 Left 1142764689 17:2058537-2058559 CCGGCCCCGACGGCAAGGGCAAG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764690_1142764696 4 Left 1142764690 17:2058541-2058563 CCCCGACGGCAAGGGCAAGCTCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764688_1142764696 9 Left 1142764688 17:2058536-2058558 CCCGGCCCCGACGGCAAGGGCAA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764682_1142764696 18 Left 1142764682 17:2058527-2058549 CCCGGCGTCCCCGGCCCCGACGG 0: 1
1: 0
2: 0
3: 29
4: 209
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764692_1142764696 2 Left 1142764692 17:2058543-2058565 CCGACGGCAAGGGCAAGCTCGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764684_1142764696 17 Left 1142764684 17:2058528-2058550 CCGGCGTCCCCGGCCCCGACGGC 0: 1
1: 0
2: 3
3: 37
4: 327
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81
1142764691_1142764696 3 Left 1142764691 17:2058542-2058564 CCCGACGGCAAGGGCAAGCTCGA 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142764696 Original CRISPR CCCCGAGGGCGTCTTTGCTG TGG Exonic
900439297 1:2645368-2645390 CACCCAGGGCCTCCTTGCTGTGG - Exonic
906365377 1:45205873-45205895 CCCCGGGGGCGTCGCGGCTGGGG - Exonic
913234430 1:116767662-116767684 ACCCAAGGCCGTCTTTGCAGTGG - Intronic
920699934 1:208210216-208210238 CCAAGAGGGACTCTTTGCTGAGG + Intronic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
924626853 1:245702667-245702689 CCCCTAGGCCCTCTGTGCTGGGG + Exonic
1063469827 10:6275351-6275373 CCCCGAGGGTGGCTCCGCTGAGG - Intergenic
1067848860 10:49742739-49742761 TCCCGAGGGGGCCTTTGTTGGGG - Intronic
1071816930 10:89241650-89241672 CCCCTGGGGAATCTTTGCTGAGG + Intronic
1076810937 10:132886001-132886023 GTCCGAGGGCGCCTTTGATGAGG - Intronic
1076998628 11:311250-311272 CCCCGCGGGGGTCTGGGCTGCGG - Intronic
1077000115 11:318509-318531 CCCCGCGGGGGTCTGGGCTGCGG + Intergenic
1077292240 11:1803257-1803279 CCCCGAGGGTGACCTTCCTGTGG + Intergenic
1083696722 11:64448484-64448506 CCCCGCAGGCGTGTCTGCTGTGG + Intergenic
1088401131 11:109423281-109423303 CCCAGAGGGCCGCTTTGCGGTGG + Intronic
1088640801 11:111871274-111871296 CCCCGGGAGGGTCTTAGCTGTGG - Intronic
1089489420 11:118872511-118872533 CCCCGAAGGCTTCCTTCCTGGGG + Intergenic
1090716579 11:129436869-129436891 CACCGAGGCGGTCTCTGCTGAGG + Exonic
1090860232 11:130646596-130646618 CCACGAGGGAGTCACTGCTGTGG - Intergenic
1092934491 12:13347854-13347876 CCCTGAGGCTGTCTTTCCTGGGG + Intergenic
1095829480 12:46569330-46569352 GCCTGGGGGCGTGTTTGCTGGGG + Intergenic
1098567661 12:71953992-71954014 CCCAGAGGGCTTCTTGGTTGTGG - Intronic
1100172517 12:91991883-91991905 CCCAGAGGACTTCTTTCCTGAGG - Intronic
1101224453 12:102674031-102674053 CCCCAAGGACTTCTGTGCTGGGG + Intergenic
1102991008 12:117316220-117316242 ACCAGGGGGCATCTTTGCTGGGG + Intronic
1108809982 13:54210924-54210946 GCCCCAGGGTGACTTTGCTGGGG + Intergenic
1113655815 13:112067360-112067382 CGCCGAGGGCGCCTGGGCTGCGG + Intergenic
1114411653 14:22506359-22506381 CCCTGAGGGAATCTTTGCTGAGG + Intergenic
1124058303 15:26262888-26262910 CCCCAAGGGCGTCGTTGATGGGG + Intergenic
1128622265 15:69160767-69160789 CCCGGAGCGCGTCTCCGCTGAGG + Intronic
1131149482 15:90037912-90037934 CCCCGAGGGAGGCCTTGATGAGG + Intronic
1138991713 16:62398137-62398159 TCCCTAGGGTGTCTTTGCTAAGG + Intergenic
1140500970 16:75433198-75433220 CCCCGCGGGCGTCTGCCCTGTGG - Intronic
1141449781 16:84090844-84090866 CCCCGAGGTCATCCCTGCTGGGG + Intronic
1141699558 16:85636171-85636193 CCCCGGGGGCATCTTTCCTGGGG - Intronic
1141751729 16:85962708-85962730 CCCCGGGGGCGTCCTGGCTTTGG + Intergenic
1142365230 16:89646570-89646592 GCCCGAGGGCGCCTCTGCCGTGG - Exonic
1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG + Exonic
1148075661 17:44934033-44934055 CCCCGAGGGAGTCTTTGAGCAGG + Exonic
1151730522 17:75908542-75908564 GCCCGAGGGCCACTTTTCTGTGG + Intronic
1152568387 17:81110542-81110564 CCCGGCGTGCGTCTTTGCCGTGG + Intronic
1155207238 18:23570875-23570897 CCCCGAGGCCGGCTCTACTGAGG + Intronic
1164595015 19:29526696-29526718 ACTCGGGGGGGTCTTTGCTGGGG + Intronic
1167294261 19:48640094-48640116 CCACCAGGGCTTCTCTGCTGAGG - Exonic
1167294944 19:48644554-48644576 CCCCCAGGGCCTCCTTTCTGGGG - Exonic
925513508 2:4653655-4653677 CCCCAATGGCCTCATTGCTGTGG + Intergenic
928125751 2:28614625-28614647 CCTCCAGGCCGTCTTTGCAGTGG - Intronic
930762179 2:55049628-55049650 CCCCGAGGGCGCTTTGTCTGCGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932319286 2:70809242-70809264 CCCTGAGGGTGTCTGTGCTCAGG + Exonic
932462171 2:71889547-71889569 ACCCCAGGGTGTGTTTGCTGTGG - Intergenic
942515108 2:176744087-176744109 CCCAGAGAGCCTCTTTGTTGAGG + Intergenic
947006373 2:225516033-225516055 CCACGAAGGCGGCTTTTCTGAGG - Intronic
948079197 2:235191618-235191640 CCCCGACGGCTTCCTTGCTTTGG + Intergenic
1172502836 20:35439134-35439156 CTCAGAGGACGTCTCTGCTGGGG - Intronic
1180050791 21:45330215-45330237 TCCCGAGGATGTGTTTGCTGAGG + Intergenic
1180080296 21:45483584-45483606 CTCCGGGGGCGTCTGTGGTGGGG - Intronic
1184039725 22:41935626-41935648 GCCCGAGGGGCTTTTTGCTGCGG + Intergenic
955346328 3:58164643-58164665 CCCTGTGGGTGGCTTTGCTGAGG - Intronic
962128638 3:132649210-132649232 CCCGTAGGGGGTCTGTGCTGAGG + Intronic
968619493 4:1597401-1597423 CCCCCAGTGCGTGTTTGCTGTGG - Intergenic
979440892 4:120748787-120748809 CCCTGAGGGTGAGTTTGCTGAGG + Intronic
985489735 5:172236-172258 CCCCTAGGGCTCCTTGGCTGAGG - Intronic
985796266 5:1964285-1964307 CCCGGAGGGCTTCCCTGCTGAGG + Intergenic
987234410 5:15928440-15928462 CAACGAGGCCGTCTTTGATGTGG + Exonic
994401346 5:99284291-99284313 CCTCTAGGACTTCTTTGCTGTGG + Intergenic
997446356 5:133943174-133943196 CTCCCAGGCTGTCTTTGCTGGGG + Intergenic
1000353412 5:160370543-160370565 CGCCGAGAGCTTCTTTGCTCCGG - Exonic
1000622905 5:163505600-163505622 GGCCGAGGGCGTCTGAGCTGAGG + Exonic
1001823157 5:174725218-174725240 CCCAGAGGGTGTCTTGGATGCGG - Intronic
1008667697 6:53732458-53732480 CCTCGAGGTAGTCTCTGCTGGGG - Intergenic
1019428188 7:987115-987137 CCCCGAGGGCCTGTTTGCTGAGG + Exonic
1024095183 7:45977179-45977201 ATCTGAGGGCGGCTTTGCTGAGG - Intergenic
1034672990 7:152871665-152871687 CCACGAGGGTGTCTATCCTGAGG - Intergenic
1035580728 8:737918-737940 CCCCGAGGGCGTCAGGGTTGGGG + Intronic
1037226837 8:16602563-16602585 CCCCTAGGGGTTCTTTGCTGTGG + Intergenic
1037903801 8:22703656-22703678 CCCCGAGGGCGTTTTTCATTAGG + Intergenic
1049180233 8:141218451-141218473 CGCCGAGGGCGTCTTTTGTGGGG + Exonic
1049778460 8:144416850-144416872 GGCTGAGGGCGGCTTTGCTGGGG + Exonic
1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG + Intronic
1060316355 9:122514999-122515021 GCCCGAGGGCATCTCTCCTGGGG + Intergenic
1061586868 9:131575247-131575269 CCCCGAAGGTGTCTGAGCTGAGG - Intergenic
1062088760 9:134663045-134663067 CCCTGTGGGTGGCTTTGCTGAGG + Intronic
1203794722 EBV:170141-170163 CCCCCCGGGGGTCTTTCCTGGGG - Intergenic
1203794921 EBV:170679-170701 CCCCACGGGGGTCTTTCCTGGGG - Intergenic
1203795114 EBV:171202-171224 CCCCCCGGGGGTCTTTCCTGGGG - Intergenic
1203795315 EBV:171740-171762 CCCCCCGGGGGTCTTTCCTGGGG - Intergenic
1185642674 X:1597280-1597302 CCCCGAGGGCTCCTTAGGTGAGG + Intronic
1186389432 X:9144017-9144039 CCCTAAGGGCATCTCTGCTGGGG + Intronic
1186795679 X:13044523-13044545 CACCGAGGGCGTCTCACCTGAGG + Exonic