ID: 1142768334

View in Genome Browser
Species Human (GRCh38)
Location 17:2078717-2078739
Sequence AGGAGTAAAAGGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1382
Summary {0: 1, 1: 0, 2: 7, 3: 105, 4: 1269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142768328_1142768334 28 Left 1142768328 17:2078666-2078688 CCAGCCACTGAATACATATCTGC 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG 0: 1
1: 0
2: 7
3: 105
4: 1269
1142768327_1142768334 29 Left 1142768327 17:2078665-2078687 CCCAGCCACTGAATACATATCTG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG 0: 1
1: 0
2: 7
3: 105
4: 1269
1142768329_1142768334 24 Left 1142768329 17:2078670-2078692 CCACTGAATACATATCTGCTGAG 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG 0: 1
1: 0
2: 7
3: 105
4: 1269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142768334 Original CRISPR AGGAGTAAAAGGAAGGATGG AGG Intronic
900146283 1:1160257-1160279 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
900471963 1:2859488-2859510 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471973 1:2859520-2859542 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471983 1:2859552-2859574 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900996336 1:6125320-6125342 AGGAGGAGAAGGTAGGAAGGGGG + Intronic
901183179 1:7355775-7355797 AGGAGCAAGAGGGAGGCTGGTGG - Intronic
901583309 1:10264366-10264388 AGAAGTAAAAGAAATGATGATGG + Intronic
901628588 1:10637521-10637543 AGGAGGGAATGGAAGGCTGGCGG - Exonic
901689283 1:10962053-10962075 AGGAGGAGGAGGAAGGAAGGAGG - Intronic
901850583 1:12012402-12012424 TGTAGTAGAAGGATGGATGGTGG + Exonic
902083451 1:13837663-13837685 AGGAGAGAAAGGAGGGAGGGAGG - Intergenic
902091070 1:13903686-13903708 AGGAGTAAAGGGAAAAAGGGAGG + Intergenic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902767347 1:18626225-18626247 GGGAGGAGAAGGAAGAATGGAGG + Intergenic
902894442 1:19469127-19469149 AGTAGTCAAAGGAAGCTTGGCGG + Intronic
903286187 1:22278205-22278227 AAGAGAAAGAGGATGGATGGAGG + Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
904463232 1:30692754-30692776 AGGAGGAAGAGGAAGCAAGGAGG + Intergenic
904703470 1:32373142-32373164 AGAAATAAAAAGAAGAATGGGGG - Intronic
904991214 1:34594247-34594269 AGGAGTGAAAGGAGGGATTAGGG - Intergenic
905039875 1:34947419-34947441 AGGAGGGAAAGGAGGTATGGAGG + Intergenic
905076500 1:35276308-35276330 TGGAAAAAAAGGAAGGAAGGAGG - Intronic
905183475 1:36180105-36180127 AGGAGTACAGGGAAGGCTGCTGG - Intronic
905475201 1:38221471-38221493 AGGAGCACAAGGAAGGAAAGGGG - Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905828865 1:41048303-41048325 AGGAATCAAAGGAATGATAGAGG + Intronic
905846611 1:41239393-41239415 AGGAGTTAAAGGAAGGCTTTGGG - Intronic
905945183 1:41895684-41895706 AGGAGTAGAAGGCAAGGTGGAGG + Intronic
905949841 1:41940865-41940887 AGGCGGAAAGGGAAGGAGGGAGG + Intronic
906155712 1:43612883-43612905 AAGAATTCAAGGAAGGATGGAGG - Intronic
906509203 1:46401171-46401193 AGGAGTAGAAGCAGGGTTGGAGG + Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906668764 1:47639920-47639942 AGGACAGACAGGAAGGATGGAGG - Intergenic
906905565 1:49887078-49887100 AGGAGTATAGGCAAGGAAGGTGG + Intronic
907087734 1:51692579-51692601 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
907420553 1:54343999-54344021 AGGAGAAAAAGAAGAGATGGTGG + Intronic
907521104 1:55023870-55023892 AGGAGAAGAAGGAGGAATGGAGG - Intergenic
907601587 1:55776467-55776489 AGGAGTGATAGGAAGGATCTGGG + Intergenic
907686284 1:56615057-56615079 GGGAATAAGAGGAAGGTTGGAGG - Intronic
907918473 1:58891928-58891950 AGGAAGAAAAGAAAGGAAGGAGG - Intergenic
908035441 1:60046422-60046444 AGAAGAAGAAGGAAGGAAGGAGG - Intronic
908131614 1:61081168-61081190 AGAAGTAAAATAAGGGATGGGGG + Intronic
908287305 1:62621109-62621131 AGGAGAAGAAGGAAGAAAGGAGG + Intronic
908372644 1:63498825-63498847 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
908426166 1:64009573-64009595 AGAAGAAAAAGGAACGAGGGGGG - Intronic
908461851 1:64354409-64354431 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
908574695 1:65447293-65447315 AGGAAGGAAAGGAAGGAGGGAGG - Intronic
908592095 1:65646325-65646347 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
908617453 1:65938114-65938136 AGGAGAAAAAGGAAGATAGGTGG - Intronic
908812506 1:67997990-67998012 AGGAGTAAGAGGTAGGAGAGAGG + Intergenic
908824132 1:68117086-68117108 AGGAGGAAAAGCAGGGATAGAGG - Intronic
908854114 1:68405346-68405368 ATGAGTAAAAGGAAGGAGAGAGG + Intergenic
909223788 1:72992213-72992235 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
909724421 1:78816827-78816849 AGGAATGAAAGGGAGGTTGGAGG - Intergenic
909909820 1:81246706-81246728 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
909928961 1:81472911-81472933 GGGAATAAAAGGAGGGAAGGAGG + Intronic
910021790 1:82599666-82599688 AGGACAAGAAGGAAGGAAGGAGG - Intergenic
910059167 1:83068133-83068155 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
910229050 1:84967755-84967777 AGGAGAAAAAGGAGAGAGGGAGG + Intronic
910229058 1:84967784-84967806 AGGAGAAAAAGGAGAGAGGGAGG + Intronic
910538045 1:88322665-88322687 AGGAGCAAAAGCAAGAGTGGGGG + Intergenic
910820062 1:91336406-91336428 AGTAGGAAAAGAAGGGATGGAGG - Intronic
911570262 1:99510906-99510928 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
912174313 1:107139168-107139190 TGTGGTAAAAGGATGGATGGGGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912544389 1:110440540-110440562 AGGAGGGAAAGGCAGCATGGGGG - Intergenic
912620632 1:111153155-111153177 AGAAGTAAAGGGAAGAATTGTGG - Intronic
912854399 1:113154222-113154244 AGGAGGGAAAGGAAGGAGGGTGG + Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
914085987 1:144455134-144455156 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
914249691 1:145911556-145911578 AGGTGTACAAGGAAGGATAAGGG + Exonic
914336969 1:146724407-146724429 AGGGGAAACAGGAAGAATGGGGG + Intergenic
914786995 1:150842538-150842560 AGGGAAAAAAGGAAGGAGGGAGG + Intronic
915029124 1:152861058-152861080 AGGAGGAGAAGGAAGGAGGAGGG - Intergenic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915376378 1:155399858-155399880 AGGAGAAAAGTGTAGGATGGAGG + Intronic
915446123 1:155975984-155976006 AAAAGAAAAAGGAAGCATGGAGG + Intronic
915623996 1:157103496-157103518 ATGTAGAAAAGGAAGGATGGAGG - Intergenic
915948731 1:160173513-160173535 AGGAGAAAAATGAAGGATCCGGG + Intronic
917043379 1:170830876-170830898 AAGAAGAAAAGAAAGGATGGAGG - Intergenic
917284928 1:173413733-173413755 AGGATTGGCAGGAAGGATGGAGG - Intergenic
917474238 1:175354531-175354553 ATGAGCCAAAGGAAGGGTGGTGG + Intronic
917539569 1:175899697-175899719 AGGAGACAGAGGGAGGATGGGGG + Intergenic
917601640 1:176580190-176580212 AGAAGTAAAAGGTAGGACAGAGG - Intronic
917697810 1:177545643-177545665 AGGAGGAAAAAGAGGGATAGAGG - Intergenic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917941674 1:179928324-179928346 AGGAGGAAAAGGAAGGAGAGGGG - Intergenic
918282426 1:183020417-183020439 GAGAGAAAAAGGAGGGATGGAGG - Intergenic
918365928 1:183807561-183807583 GGGAGTTTAAGGCAGGATGGTGG + Intronic
918648667 1:186931916-186931938 AGCAGTAAAAGAGAGGAAGGTGG - Intronic
918692963 1:187505236-187505258 TGGAGGAAAAGGAGGGATGTTGG + Intergenic
918930343 1:190847220-190847242 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
919003041 1:191859613-191859635 AGGAGAGAGAGGAAGGAAGGAGG - Intergenic
919591544 1:199510244-199510266 AGGAGTGACAGGAAGGCTTGGGG - Intergenic
919679645 1:200421601-200421623 AGGAGTAGAAGGAATGATCAGGG + Intergenic
919836329 1:201576166-201576188 AGGAGTCAAAGAAAGGGTGGAGG - Intergenic
919990068 1:202703384-202703406 GGGAGTAAAAAGAAGGGCGGGGG + Intronic
920398194 1:205661311-205661333 AGGAGGCAAAGGAGGGATGCAGG + Intronic
920432916 1:205930062-205930084 AGGAGGAAAAGGGTGGTTGGTGG + Intronic
920607569 1:207404292-207404314 AGGAGCAAAAGGGAGAGTGGTGG - Intergenic
920776376 1:208941869-208941891 AGGAGAAAAATCAAGGAAGGAGG - Intergenic
920916593 1:210262574-210262596 ATGAGGAGAAGGAAGGAGGGAGG - Intergenic
921065930 1:211621873-211621895 AGGAGTAAAGGGGTGGAGGGTGG - Intergenic
921092957 1:211860350-211860372 AGTAGCAAAAGAGAGGATGGAGG + Intergenic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
921317334 1:213905075-213905097 AGGACAAGAAGGAAGGAAGGAGG + Intergenic
921396863 1:214677818-214677840 AGGAGGAGGAGGAAGGAGGGAGG - Intergenic
921459922 1:215414384-215414406 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
921519989 1:216146816-216146838 AGGAGAAGAAGGAGGAATGGAGG - Intronic
921639868 1:217540215-217540237 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
921945403 1:220882759-220882781 AGGAGGAGGAGGAAGGAGGGAGG - Intronic
922023630 1:221730070-221730092 AGGAGAAAGAGGAGGGGTGGGGG - Intronic
922429741 1:225539142-225539164 AGGAGTAAAAGAAAAGGTAGTGG - Intronic
922790898 1:228310413-228310435 AATAGTAAATGGATGGATGGTGG - Intronic
922906258 1:229175704-229175726 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
922914298 1:229243163-229243185 AGGAGGAAAGGGAAGGGAGGTGG + Intergenic
923052161 1:230396424-230396446 GAGAGTGAAAGGGAGGATGGTGG - Intronic
923204549 1:231745727-231745749 AGAAGTAAGAGGTAGGATAGAGG - Intronic
923244609 1:232119447-232119469 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
923257416 1:232233644-232233666 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
923625055 1:235606923-235606945 AGGAAAGAAAGGAAGGAGGGAGG - Intronic
923984336 1:239363955-239363977 ATGAGTAAATGGATGGTTGGGGG + Intergenic
924868978 1:248019725-248019747 AGAAGGAGAAGGAAGGAAGGAGG - Intronic
1062875116 10:936861-936883 AGTATTAAAATGAAGAATGGTGG + Intergenic
1063272535 10:4527222-4527244 AAATGTAAAAGGAATGATGGAGG + Intergenic
1063509744 10:6634031-6634053 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1063527824 10:6801528-6801550 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1063572953 10:7233359-7233381 TGAGGTAAAAGCAAGGATGGAGG + Intronic
1063633778 10:7761076-7761098 AGGAGCAGAAGGTAGGAGGGAGG + Intronic
1063961044 10:11305554-11305576 AGGAAGAGAAGGAAGGTTGGGGG + Intronic
1064146053 10:12827203-12827225 AGGAAGGAAAGGAAGGAGGGAGG - Intronic
1064325125 10:14343333-14343355 ATGAATAACAGGAAGAATGGAGG - Intronic
1064562546 10:16607266-16607288 AGGAGGTACAGGAAGCATGGCGG - Intronic
1064609243 10:17079954-17079976 AGAAGTAGAGGGAAGGATGCAGG + Intronic
1064629918 10:17299304-17299326 AGAAAGAAAAGGAAGGAAGGAGG + Intergenic
1064849973 10:19699317-19699339 AGGAGGGAAAGGTAGGAGGGAGG + Intronic
1065169186 10:23010438-23010460 AGGAGGGAAAGGAAGGAGAGGGG - Intronic
1065169193 10:23010458-23010480 AGGAGGGAAAGGAAGGAGGGAGG - Intronic
1065169200 10:23010478-23010500 GGGAGGGAAAGGAAGGAGGGAGG - Intronic
1065195929 10:23265389-23265411 AGGAGAAGAAGGAAGAATGTGGG + Intergenic
1065360040 10:24880993-24881015 AAGAGAGAAAGGAAGGAAGGAGG - Intronic
1065443342 10:25773648-25773670 AGGAGAAGAAGGAGGAATGGAGG + Intergenic
1065497279 10:26342089-26342111 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1065745537 10:28837695-28837717 GGGAGGAAAAGAAAGGAGGGAGG + Intergenic
1065827934 10:29588908-29588930 AGGAATAAAAGGGGGGGTGGGGG - Intronic
1065899495 10:30192455-30192477 TGGTGTAAAGGGGAGGATGGGGG - Intergenic
1065933546 10:30500182-30500204 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
1065951630 10:30657751-30657773 AGGAGGGAAAAGAAGGAGGGAGG - Intergenic
1066779807 10:38931856-38931878 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1067267291 10:44757171-44757193 AGGAGAAACGGGAAAGATGGAGG - Intergenic
1067798800 10:49342220-49342242 AGGAGCAATAGAAAGGTTGGGGG + Intergenic
1068201429 10:53788634-53788656 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1068230830 10:54168024-54168046 GGGAGTAGAAGGAGGAATGGAGG - Intronic
1068258527 10:54545548-54545570 AGGAGAGAAAGCAAGGAAGGAGG + Intronic
1068579126 10:58719346-58719368 AGTTGGAAAAGGGAGGATGGAGG - Intronic
1068592481 10:58865441-58865463 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1068895512 10:62195552-62195574 AAGACAAAAAGGAAGGAAGGAGG + Exonic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069362704 10:67661276-67661298 AAGAGAAAAAGGAGGGAGGGAGG + Intronic
1069420501 10:68242290-68242312 ATGAGAAAAAGGAGGGATTGGGG - Intergenic
1069463835 10:68620317-68620339 TGGGGTAAATGGAAGGATTGGGG - Intronic
1069678953 10:70270213-70270235 AGGAAAAAAAGAAAGGAAGGTGG + Intronic
1069718530 10:70535644-70535666 AGGAGGAGAAGGAAGGGAGGAGG - Intronic
1069771097 10:70901100-70901122 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
1070978773 10:80627798-80627820 AGGAAGAAAAGGAAGGAAGCGGG + Intronic
1071603354 10:86969631-86969653 AGGAGACAAATGAAGGAAGGAGG - Intronic
1071839322 10:89452743-89452765 AGAAGGAAAGGGAAGGATGCAGG + Intronic
1071897873 10:90085482-90085504 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1071956029 10:90760303-90760325 AGGAGTAAAAAGGAGGACAGAGG + Intronic
1072222295 10:93336757-93336779 AGGAGGAGAAGGAAGGAAGAAGG + Intronic
1072491519 10:95910447-95910469 AGGAAATAAAGGAAGGAGGGGGG + Intronic
1072586793 10:96789956-96789978 AGGAGGGGAAGGAAGGAGGGAGG - Intergenic
1072743351 10:97923409-97923431 AGGAGGAAAGGGAGGGCTGGTGG + Intronic
1072744819 10:97932681-97932703 GTGAGTGAGAGGAAGGATGGAGG + Intronic
1072946800 10:99817528-99817550 AAGAGAAAAAGTGAGGATGGTGG + Intronic
1073017652 10:100414488-100414510 AGGAGAAAAAGAAAGAAGGGAGG + Intergenic
1073063664 10:100746166-100746188 AGGAGAAAAGGGAGGGACGGTGG - Exonic
1073108772 10:101048396-101048418 AGGAGGAGAAGAAAGGAAGGCGG - Intergenic
1073514800 10:104066683-104066705 GGGAGTAACAGGAAGGCTGGAGG + Intronic
1073680580 10:105699150-105699172 AGGGATGAAAGGAAGGAGGGAGG + Intergenic
1073857018 10:107688256-107688278 ACCAGGAAAAGGAAGGAGGGAGG + Intergenic
1074002115 10:109383833-109383855 AGAAAGAAAAAGAAGGATGGTGG - Intergenic
1074929116 10:118105564-118105586 AGTAGTATAAACAAGGATGGAGG - Intergenic
1074955028 10:118380278-118380300 AGGAGGAAAAGAAAGGATTTGGG - Intergenic
1075485116 10:122815435-122815457 AGGAGGAAAGCGAAGGAGGGAGG - Intergenic
1075520511 10:123141069-123141091 AGGAGGAAAAGGGAGGCTGTAGG - Intergenic
1075651122 10:124128834-124128856 AGGTGCAAAGGGAAGGAGGGAGG + Intergenic
1076078490 10:127556650-127556672 AGGAGAAACAGCAAGGAAGGGGG + Intergenic
1076922063 10:133459379-133459401 AGGAGTGCAAGGAAGGACAGAGG + Intergenic
1077283211 11:1754675-1754697 TGGAGGAAATGGAGGGATGGAGG + Intronic
1077422710 11:2460500-2460522 AGGAAAAAAGGGAAGGAGGGAGG - Intronic
1077738695 11:4820529-4820551 AGGAATAAGAGGAAGAAGGGAGG - Intronic
1077883203 11:6367055-6367077 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1078046267 11:7916604-7916626 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1078241564 11:9535237-9535259 ATGAATTAAAGGCAGGATGGTGG + Intergenic
1078306020 11:10187156-10187178 AGTAGTAAGAGAAAGCATGGAGG - Intronic
1078611389 11:12822520-12822542 AGGAGTACAATGGAAGATGGGGG + Intronic
1078892168 11:15567260-15567282 AGAAGGAAACGGAAGGAAGGAGG - Intergenic
1079138753 11:17793537-17793559 AGAAGTAAGAGGAAGGAGAGTGG + Intronic
1079468622 11:20757054-20757076 AGAAAGAGAAGGAAGGATGGAGG - Intronic
1079750995 11:24197123-24197145 AAGAGTAAAAGGAAATAAGGTGG - Intergenic
1079822493 11:25148310-25148332 AGGAAAAGAAGGAAGGAAGGAGG + Intergenic
1079822512 11:25148384-25148406 AGGAAAAGAAGGAAGGAAGGAGG + Intergenic
1079985052 11:27191359-27191381 TGGAGTGAAAGGAAGGTGGGTGG - Intergenic
1080028051 11:27633519-27633541 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1080050808 11:27857133-27857155 AGCTGGAAAAGGAAGGAAGGTGG - Intergenic
1080576103 11:33600549-33600571 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1080732855 11:34978515-34978537 AGGAGAAAAAGAAAGGATAAGGG + Intronic
1080744173 11:35092919-35092941 AGGCGCAAAATAAAGGATGGAGG + Intergenic
1080762603 11:35266668-35266690 AGTCTTAAAAGGAAGGATGCTGG + Intronic
1081761498 11:45579592-45579614 AGGAGAAGAAGGAAGGATACAGG - Intergenic
1082038725 11:47667251-47667273 AGGAGTAGATGGATGGCTGGGGG - Intronic
1082753859 11:57052348-57052370 ATGATTAAAAGAATGGATGGGGG + Intergenic
1083224631 11:61276992-61277014 AGGAGACAGAGGAAGGAAGGAGG + Intronic
1083790320 11:64980542-64980564 AAAACAAAAAGGAAGGATGGGGG + Intergenic
1084022639 11:66426727-66426749 CTGTGTAAAAGGAAGGGTGGAGG + Intergenic
1084495969 11:69503688-69503710 AGGAGGAAGAGGAGGGGTGGGGG - Intergenic
1084949592 11:72657334-72657356 AGGGGAAAGAGGAGGGATGGAGG + Intronic
1085303598 11:75472913-75472935 AGGAGAGAAAGGAAGGAGGAGGG + Intronic
1085345050 11:75763257-75763279 AGGGCTGAAAGGAAGGAAGGGGG - Intronic
1085878260 11:80434662-80434684 AGGAGAAAATGGTAGCATGGAGG - Intergenic
1086079576 11:82889404-82889426 AGGAGAAGGAGGAGGGATGGAGG + Intronic
1086393665 11:86391936-86391958 AGGAGTAAGAGGGAGGATGGAGG + Intronic
1086518721 11:87645998-87646020 AGAAGGGAAAGGAAGGAAGGGGG - Intergenic
1087176090 11:95097195-95097217 AGGAGAAAAAGCAAGGAAGGAGG + Intronic
1087279825 11:96197879-96197901 AAGTGTAAAAGTAAGGATGGAGG + Intronic
1087314537 11:96589195-96589217 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1087578487 11:100021927-100021949 AGGAGAAAGATGAAGGTTGGAGG + Intronic
1087630570 11:100646378-100646400 AGAAAGAAAAGGAAGGAAGGAGG + Intergenic
1088292345 11:108254117-108254139 AGGAAAAACAGCAAGGATGGTGG + Intronic
1088438394 11:109841148-109841170 AAGAGAAGAAGGAAGGAAGGAGG + Intergenic
1088650666 11:111955358-111955380 AGGAAGGAAAGGAGGGATGGAGG + Intronic
1088711152 11:112509934-112509956 AGGAGGAAGAGGATGGAAGGAGG - Intergenic
1088880879 11:113972389-113972411 AGGAGGAAAAGGAAGATCGGCGG - Intergenic
1088987232 11:114920051-114920073 TGGAGAAAGAGGAGGGATGGGGG - Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089444806 11:118543429-118543451 AGGAGCAAAAGGGAGAACGGAGG - Intronic
1090404823 11:126470270-126470292 AGAATGAAAAGGAAGGATAGGGG - Intronic
1090490138 11:127153487-127153509 AGGAGAAAAAGGTAGGGTTGGGG - Intergenic
1090500405 11:127255374-127255396 AGGAGTGAGAGGGAGGAGGGAGG + Intergenic
1090592507 11:128287586-128287608 GGGAGAAAAAGGAAGGAAAGTGG - Intergenic
1090927097 11:131258939-131258961 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1091425821 12:388882-388904 AGGGGGAGAAGGAAGAATGGGGG - Intronic
1091568422 12:1663789-1663811 AGGAGGGAAAGGAGGGAAGGAGG + Intergenic
1092092248 12:5812596-5812618 AGAAGAAAAAGGAAGGAAGGTGG + Intronic
1092626888 12:10337371-10337393 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1092700471 12:11223646-11223668 AGGAGGAAAGGGTAGGAAGGGGG + Intergenic
1092723856 12:11466613-11466635 GGGAGTAGAAGGAGGAATGGAGG + Intronic
1092749343 12:11703958-11703980 AGAAGAAAAAGGAAGAAAGGAGG + Intronic
1092964619 12:13629626-13629648 AGGAGCAAGAGGAGGGAAGGAGG - Intronic
1093525101 12:20096379-20096401 AGGAGGAAATGGAAGCGTGGAGG + Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094077260 12:26491033-26491055 ATGCATAAGAGGAAGGATGGAGG + Intronic
1094078843 12:26510274-26510296 AGGAGTAAAAGGATGGTGGGTGG - Intronic
1094213056 12:27912846-27912868 AGGAGAAAAAAGAGAGATGGAGG + Intergenic
1094299257 12:28943262-28943284 AGAAATAAAAGGCAGGATAGAGG - Intergenic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1095085719 12:38056005-38056027 AGGGGAAAAGGGAAGGAAGGCGG - Intergenic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095873453 12:47055392-47055414 AGGAGAACAAAGAAGGGTGGTGG - Intergenic
1095959236 12:47823622-47823644 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
1096067291 12:48751221-48751243 AGGAGGAAAAGGTAGGAAGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096616948 12:52838653-52838675 AGGAGGAACAAGAAGGAAGGGGG + Intronic
1096956200 12:55528796-55528818 AGGAGGAAAAGGTGGGAAGGGGG + Intergenic
1097341468 12:58443305-58443327 AGAAGTGAAAGGAGAGATGGAGG + Intergenic
1097591521 12:61581354-61581376 AGGAGGAAAAGGAAGAAAGGAGG - Intergenic
1097694041 12:62760003-62760025 GGGAGAAGAAGGAAGAATGGAGG - Intronic
1097704843 12:62857372-62857394 AGAAGCAAAGGGAAGAATGGTGG + Intronic
1097939134 12:65284683-65284705 TGGAGTAAAAGGAAGGGTACAGG + Intronic
1098173778 12:67771075-67771097 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1098460808 12:70731096-70731118 AGGAGAGAGAGGAAGGAAGGAGG + Intronic
1098628924 12:72704619-72704641 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1098876708 12:75873132-75873154 AGGAGGATAAGGCAGGATTGAGG - Intergenic
1099134893 12:78885262-78885284 AGGAGGGAAGGGAAGGAAGGAGG + Intronic
1099167498 12:79324426-79324448 AGGAGAAAAGGGAATGAAGGCGG - Intronic
1099188569 12:79541140-79541162 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1099369145 12:81809100-81809122 AGGAGGAAAAAGAAAGAGGGGGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099762451 12:86940067-86940089 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1099849118 12:88069642-88069664 AGAAGGAAAAGGAAGGAATGTGG + Intronic
1100561201 12:95750358-95750380 GGGAGTAGAAGGAGGAATGGAGG - Intronic
1100591047 12:96029943-96029965 TGGAGTTTAAGGAAGGAAGGAGG - Intronic
1100726505 12:97414525-97414547 AGGAAGAAAGGGAAGAATGGAGG - Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100758430 12:97777943-97777965 AGGAAAAGAAGGAAGGAAGGAGG - Intergenic
1100877270 12:98975304-98975326 AGGAGGAAAAGGAAGAAGGAAGG - Intronic
1101010328 12:100443088-100443110 AGGAAGGAAAGGAGGGATGGAGG - Intergenic
1101278536 12:103227122-103227144 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1101615109 12:106328729-106328751 GGAAGTGAATGGAAGGATGGAGG + Intronic
1101711874 12:107275363-107275385 AGGATAAAAAGGAAGGCAGGTGG + Intergenic
1101823750 12:108204356-108204378 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1101952653 12:109188458-109188480 AGGAAAAGAAGGAAGGAGGGAGG - Intronic
1102833132 12:116026133-116026155 AGGAGTCAAAAAAAGGATGTCGG + Intronic
1102887078 12:116530361-116530383 AGCTGTGAAAGGAAGGCTGGGGG + Intergenic
1103002517 12:117396119-117396141 AGGAGAAAAAGGATTGATGAAGG - Intronic
1103132280 12:118479665-118479687 AGGAGAAGAAGGAGGGATGCAGG + Intergenic
1103561348 12:121794696-121794718 AGGAGTAAGAGGAGGGGTGGGGG - Intronic
1103584791 12:121944304-121944326 AGGAGCAAGAGGAATGTTGGGGG - Intronic
1103896649 12:124277794-124277816 AGGAGGAGAAGGAAGGAGAGGGG - Intronic
1103921405 12:124401221-124401243 AAAAGAAAAAGAAAGGATGGGGG + Intronic
1103923422 12:124411048-124411070 AGGAGGAAGAGGAGAGATGGGGG + Intronic
1104066867 12:125313644-125313666 AGGGGTGAAAGGAAAGGTGGGGG - Intronic
1104152828 12:126100929-126100951 AAGAAAAAAAGGAAGGAAGGAGG + Intergenic
1104238595 12:126964033-126964055 AGGAGGGAAAGAAAGGAGGGAGG + Intergenic
1104300940 12:127564584-127564606 AGAAGTAGATGAAAGGATGGGGG - Intergenic
1104508837 12:129357360-129357382 AAGAGAGAAAGGAAGGAGGGAGG + Intronic
1104508852 12:129357465-129357487 AGTAGAAAAAGGAAGGAGGAAGG + Intronic
1104559203 12:129828773-129828795 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
1105051257 12:133053254-133053276 AGGAAAAAAAGTAAAGATGGGGG + Intronic
1105274809 13:18910457-18910479 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1105705077 13:22963443-22963465 AGGGTTAAAAGGAAGGAGGGAGG + Intergenic
1105858035 13:24388630-24388652 AGGGTTAAAAGGAGGGAGGGAGG + Intergenic
1106681446 13:32012537-32012559 AGGAATAAAGTGAAGGATGAGGG - Intergenic
1106689215 13:32095950-32095972 AGGGAAGAAAGGAAGGATGGAGG - Intronic
1106807830 13:33329460-33329482 AGAAGTAGAAAGTAGGATGGTGG - Intronic
1107075439 13:36317713-36317735 GGGAGTAGAAGGAGGAATGGAGG - Intronic
1107328620 13:39272754-39272776 AGGATGGAAAGGAAGGAAGGAGG + Intergenic
1107337661 13:39372935-39372957 AGGAGGAAAAGTCAGGAAGGAGG - Intronic
1107676908 13:42807144-42807166 TGGAATCAAAGGAAGGAAGGGGG - Intergenic
1108392088 13:49956501-49956523 AGAAGAAAGAGGAAGGAAGGAGG - Intergenic
1108667140 13:52644007-52644029 GGGTGGAAAAGGCAGGATGGAGG - Intergenic
1108913555 13:55582688-55582710 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1108919688 13:55659417-55659439 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1108947294 13:56041584-56041606 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1108953089 13:56116861-56116883 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1109370696 13:61416173-61416195 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1109716890 13:66230817-66230839 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1109847615 13:68016411-68016433 AAGAATAAAAGGAGGGATGGGGG - Intergenic
1110037250 13:70703741-70703763 AGGAGATAAAGGAAGGAAGGAGG + Intergenic
1110076460 13:71250553-71250575 AGGAGAAAAAGGGAGAGTGGTGG + Intergenic
1110237638 13:73233182-73233204 AGAAGTAATAGTAAGTATGGTGG - Intergenic
1110628237 13:77676032-77676054 AGGAGAAAAAGAAAGGAGGGAGG - Intergenic
1110725487 13:78817847-78817869 GGGAGAAAAAGGAAGAAAGGTGG + Intergenic
1110846501 13:80195808-80195830 AGGAAAAAAGGGAAGGAGGGAGG + Intergenic
1111301907 13:86359677-86359699 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1111497875 13:89076893-89076915 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
1111631843 13:90853010-90853032 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1111681970 13:91453795-91453817 AGGAATAAAAGAAAGGAAGAAGG - Intronic
1112346500 13:98594338-98594360 AGGAGTAAACCGAAGCAAGGTGG - Intergenic
1112795025 13:103047546-103047568 AGGGAAAAAAGGAAGGATGGGGG - Intronic
1112924674 13:104659573-104659595 AGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1112975184 13:105308961-105308983 AGGTGAAACAGGAAGGCTGGAGG - Intergenic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113451170 13:110410975-110410997 AGGAGAAAAGGGCAGAATGGTGG - Intronic
1113630841 13:111882553-111882575 AGGAGACAAAGGAAGGGTGGAGG + Intergenic
1113754854 13:112804036-112804058 AGGAGGAAAAGGAGGGAAGGAGG - Intronic
1114079952 14:19195232-19195254 AGGAGGAAAAGCAAGGAGAGTGG - Intergenic
1114148546 14:20008069-20008091 AGGAAAAGAAGGAAGGAGGGAGG + Intergenic
1114148610 14:20008221-20008243 AGGAAAAGAAGGAAGGAAGGAGG + Intergenic
1114257298 14:21014304-21014326 AGGAAAAAGAGGAAGGAAGGTGG + Intergenic
1114354023 14:21887777-21887799 AGGAGGAGGAGGAAGGATGAGGG + Intergenic
1114752002 14:25215354-25215376 AGGAGTAAAATAAAGGAGTGAGG + Intergenic
1114987377 14:28247764-28247786 AAGAGAAAAAGCAAGGATGCTGG - Intergenic
1115302102 14:31895853-31895875 AGAAGTAAAAGGAATTCTGGGGG - Intergenic
1115693998 14:35876920-35876942 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
1115834146 14:37378633-37378655 AGGAGGAAAGGGAGGGAGGGAGG + Intronic
1115904667 14:38192060-38192082 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1116179537 14:41517226-41517248 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116585932 14:46704139-46704161 AGGAGAAAAAGCAAGTATTGTGG + Intergenic
1117187089 14:53251013-53251035 AGGAGGAGAAGGAGGGAGGGAGG - Intergenic
1117225675 14:53656111-53656133 GGAAGGCAAAGGAAGGATGGGGG - Intergenic
1117571339 14:57052083-57052105 AGTAGGAAAAGAAAGGATGAAGG - Intergenic
1117799052 14:59425038-59425060 AGGAAAAAAAGGAATGAAGGTGG - Intergenic
1117840591 14:59856665-59856687 AGGAGAGCAAGGAAGGATTGGGG - Intronic
1119093017 14:71801856-71801878 AGGAGTAAAAGGAAGGAGAAAGG + Intergenic
1119822494 14:77629837-77629859 AGGAATAGAAGGAGGGAAGGAGG + Intergenic
1120182759 14:81362443-81362465 AGAAGTAAAAAGTAGAATGGTGG + Intronic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120635179 14:86942215-86942237 AGGAATAGATGGAAGGAGGGAGG + Intergenic
1121099732 14:91242289-91242311 ATGAGTAAATGGAGGGATAGGGG + Intronic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121612830 14:95293209-95293231 AGGAAAAGAAGGAAGGAGGGAGG - Intronic
1121825235 14:97004967-97004989 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
1121833078 14:97068806-97068828 AGGAGTAAAAGGAAGCTCAGAGG - Intergenic
1122040853 14:98986473-98986495 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1122250365 14:100434952-100434974 AGGAGCAGAAGGAAGGATCAGGG - Intronic
1122353803 14:101111951-101111973 AGGAGGAAGGGGAAGGAAGGAGG - Intergenic
1122579458 14:102762406-102762428 GGGAGAATAAGGGAGGATGGTGG + Intergenic
1122853979 14:104551448-104551470 AGGTGAAAAAGGAAGGGAGGAGG - Intronic
1202828337 14_GL000009v2_random:1029-1051 AGTAATAAAAGGAAGGAGGGTGG - Intergenic
1202937453 14_KI270725v1_random:104384-104406 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1124012417 15:25849481-25849503 AGGCGTAGAAGGAGGGAGGGTGG - Intronic
1124044973 15:26140327-26140349 TGGAGAAAAAGGTGGGATGGGGG + Intergenic
1124056065 15:26242041-26242063 AGGAGGAAAAGGAGGTATCGAGG - Intergenic
1124142220 15:27087553-27087575 AGCAGGAAAAGGAAGTAAGGAGG + Intronic
1124172422 15:27387967-27387989 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
1124469930 15:29975266-29975288 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1124589511 15:31040784-31040806 AGGAGTCACAGGAGGGCTGGTGG + Intronic
1125131655 15:36290084-36290106 GGGAGTAGAAGGAAGAATGGAGG + Intergenic
1125447734 15:39776111-39776133 AGGAAAAAAAGGAAGGTGGGAGG + Intronic
1125629021 15:41132392-41132414 AGGAGAAGAAGGAGGAATGGAGG - Intergenic
1125962771 15:43846224-43846246 AGGAGATTAAGGAAGTATGGGGG + Intronic
1126066189 15:44827939-44827961 AGGAACAGAAGGATGGATGGAGG - Intergenic
1126093643 15:45072624-45072646 AGGAACAGAAGGATGGATGGAGG + Intronic
1126173408 15:45713155-45713177 GGAAGGAAAAGGAAGGAAGGAGG - Intergenic
1126173417 15:45713189-45713211 GGAAGGAAAAGGAAGGAAGGAGG - Intergenic
1126282291 15:46968043-46968065 AGTAGTAAAAGAAATGATGAGGG + Intergenic
1126660215 15:51025832-51025854 AGGAAGAAAATGAAGGAGGGAGG - Intergenic
1126811458 15:52409934-52409956 AGGAGAAGAAGGAAGGAAAGAGG + Intronic
1126951310 15:53884809-53884831 AGGAGTAAAGGGAAAGAGGGGGG - Intergenic
1127017671 15:54707454-54707476 AAAAGTAAAAGGAAAGAGGGCGG - Intergenic
1127393996 15:58529032-58529054 AGGAATAGAAGGAGGGGTGGGGG - Intronic
1127537570 15:59904332-59904354 AAGAGATAAAGAAAGGATGGGGG + Intergenic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1127693252 15:61418619-61418641 AGAAGTAAAGGGAAGGAAGAAGG + Intergenic
1128338900 15:66806177-66806199 AAGAGAGACAGGAAGGATGGAGG - Intergenic
1128408595 15:67369551-67369573 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1129658827 15:77541913-77541935 AGGAGAAAAAGAAGGGAAGGAGG - Intergenic
1129665359 15:77576509-77576531 AGGGGAGAAAGGAAGGAGGGAGG + Intergenic
1130155014 15:81342886-81342908 AGGAGGAAATGGAGGGAGGGTGG + Intronic
1130306087 15:82712956-82712978 AGGAGAAAAAGGAAGGATCAGGG - Intergenic
1130483662 15:84384751-84384773 AGAAAAAAAAGGAAGGAAGGAGG - Intergenic
1130750011 15:86701734-86701756 AGGAGTGAAAGGAAGGAGAGAGG - Intronic
1130854974 15:87832542-87832564 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1130947619 15:88560917-88560939 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1131126169 15:89859248-89859270 AAGAAAAAAAGGAAGGAAGGAGG - Intronic
1131172607 15:90189200-90189222 AGGAAGAAAAGGTAGGAAGGAGG + Intronic
1131449323 15:92526003-92526025 AGGGGAAGAAGGAAGGAAGGAGG - Intergenic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1131963731 15:97815563-97815585 AGTAGGGAAAGGAAGGATGGAGG + Intergenic
1132044553 15:98552349-98552371 AGGAGTAAAAGGGATGGGGGAGG + Intergenic
1132070421 15:98771878-98771900 TGGAGAAGAAGGAAGGAGGGAGG - Intronic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133154761 16:3865440-3865462 AGAAGAAAAAGGCAGGAAGGGGG + Intronic
1133539424 16:6734723-6734745 AGGAGGAAAAGAAAGGAGAGAGG - Intronic
1133651255 16:7815972-7815994 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1133717932 16:8467073-8467095 AGGAGAAGAAGAAAGGAGGGAGG + Intergenic
1133732997 16:8591808-8591830 AGGAGTAAAAGGTTTTATGGTGG - Intergenic
1133778890 16:8921420-8921442 TGGGGTTAAAGGTAGGATGGAGG + Intronic
1133912067 16:10075232-10075254 AGGATGAAAGGGAAGGAGGGAGG - Intronic
1134440513 16:14297030-14297052 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1134509516 16:14834776-14834798 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134697221 16:16233592-16233614 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134733001 16:16477593-16477615 AAGAGGAAAAGGGAGGGTGGGGG + Intergenic
1134745231 16:16582642-16582664 AGGAGAGAAAGGAAGGAAGGAGG - Intergenic
1134799677 16:17071936-17071958 AGGGAAAAAAGGAAGGAGGGAGG - Intergenic
1134974625 16:18561082-18561104 AAGAGGAAAGGGATGGATGGAGG - Intronic
1135000246 16:18771133-18771155 AGGAGAGAAAGGAAGGAAGGAGG + Intergenic
1135207479 16:20495090-20495112 AGGGGTCAAAGGAAAGAGGGTGG + Intergenic
1135211406 16:20528542-20528564 AGGGGTCAAAGGAAAGAGGGTGG - Intergenic
1135231452 16:20711940-20711962 AGGAAGAAAAGGAAGAGTGGTGG - Intronic
1135263860 16:21004702-21004724 AGAGGAGAAAGGAAGGATGGAGG - Intronic
1135668593 16:24356074-24356096 AGGGGTGAAAGCAAGGATGAAGG - Intronic
1135964038 16:27021303-27021325 AGCAGTGAGAGGAAGGATGGGGG - Intergenic
1136065152 16:27753742-27753764 AGGAAAAGAAGGAAGGAGGGAGG - Intronic
1136901093 16:34038714-34038736 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1136939663 16:34510984-34511006 AGGAGGAAAAGGAGGGCGGGAGG - Intergenic
1136946096 16:34652819-34652841 AGGAAGAAAAGGAAGGCGGGAGG + Intergenic
1136960157 16:34837576-34837598 AGGAGGAAAAGGAGGGCGGGAGG + Intergenic
1137523325 16:49212202-49212224 AGGAGCTAAAGGAAGGCTGATGG - Intergenic
1137529037 16:49265108-49265130 AGGAGAAAAAGGTGGGAAGGGGG + Intergenic
1137559540 16:49493852-49493874 AGAAGTCACAGGAAGGCTGGTGG + Intronic
1137612372 16:49827300-49827322 AGGAAGACAAGGAAGGATGAGGG - Intronic
1137831838 16:51551240-51551262 AGGTGTGAGAGGACGGATGGAGG - Intergenic
1138163396 16:54777166-54777188 AGGAGTAAAGGGAAGTAAAGGGG - Intergenic
1138243595 16:55448713-55448735 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
1138495766 16:57408313-57408335 ATGAGTGAATGGATGGATGGAGG - Intronic
1138498393 16:57423049-57423071 AGGAGGAAAGGGAGGGAGGGAGG + Intergenic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1138644209 16:58411527-58411549 AGAAAGAAAAGGAAGGAGGGAGG + Intergenic
1138804800 16:60080103-60080125 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1138943847 16:61823307-61823329 AAGAGTTAAAGGAGGGAAGGTGG - Intronic
1138991600 16:62397071-62397093 AGGAAGAAAAGGAAGGAAGGAGG + Intergenic
1139039374 16:62983595-62983617 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1139424934 16:66873721-66873743 AGGAGGAGAAGGGAGGAGGGGGG - Intergenic
1139538474 16:67595217-67595239 GTGAGTCAAAGGAAGGGTGGGGG - Intronic
1139602178 16:67993508-67993530 AGGAGTAAAAGGGAGGGTGGAGG - Exonic
1139834604 16:69828210-69828232 AGGAGGGAAAGAAAGGAAGGTGG - Intronic
1139997302 16:70992912-70992934 AGGGGAAACAGGAAGAATGGGGG - Intronic
1140035291 16:71367179-71367201 AGTAGAATAAGGAAGGATGCAGG + Intronic
1140245129 16:73241488-73241510 AGTAATAAAAGGAGGGTTGGGGG + Intergenic
1140271643 16:73471649-73471671 AGGAGTAAAAGGAGGGCTCAGGG + Intergenic
1140358466 16:74325336-74325358 AGGAGAAAAGGTAAGGCTGGGGG + Intergenic
1140379084 16:74470276-74470298 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1140535258 16:75703964-75703986 AGGAAAAAAAAAAAGGATGGGGG - Intronic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1140996000 16:80260046-80260068 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141734616 16:85844067-85844089 GGAAGGAAAAGGAAGGAAGGAGG - Intergenic
1141813599 16:86393581-86393603 AGAAGTGAAAAGGAGGATGGGGG + Intergenic
1141882912 16:86871821-86871843 AGGAGAGAAGGGAAGGAGGGAGG - Intergenic
1141934766 16:87229919-87229941 AGCAGAAACAGGATGGATGGGGG - Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1142794903 17:2300092-2300114 AGGAGAAAAAGGAAAGAGGATGG - Exonic
1142958145 17:3535141-3535163 GGGAGAGAAAGGAAGGAAGGAGG - Intronic
1143036296 17:4001163-4001185 AGGAGGAAGAGGCAGGATGGAGG + Intergenic
1143262004 17:5606496-5606518 AGGACCGAAAGTAAGGATGGAGG + Intronic
1143391299 17:6560838-6560860 AGGAGGAAAAGGAGGGGAGGAGG - Intergenic
1143391373 17:6561121-6561143 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143391504 17:6561571-6561593 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143391514 17:6561602-6561624 AGGAGGAAGAGGAGGGAAGGAGG - Intergenic
1143481585 17:7230276-7230298 AGGACTCACTGGAAGGATGGAGG + Exonic
1144213004 17:13031173-13031195 AGGAACAGAAGGAAGGAAGGAGG - Intergenic
1145091846 17:19992608-19992630 AGGAATAAAAGGCTGGATGCGGG - Intergenic
1145214579 17:21042404-21042426 GGGAGGGAAAGGAAGAATGGGGG + Intronic
1145709116 17:26952547-26952569 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1146093068 17:29901707-29901729 AGAAAGAAAAGGAAGGAGGGAGG - Intronic
1146587969 17:34099235-34099257 AAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146597752 17:34184545-34184567 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1147402785 17:40191212-40191234 AGGAGCGAAAGGCAGGAGGGCGG - Intronic
1148233149 17:45949805-45949827 AGAAGGAATGGGAAGGATGGTGG + Intronic
1148444794 17:47731040-47731062 TGGAGGAAGAGGAAGGCTGGGGG - Intergenic
1148562011 17:48611689-48611711 GGGAGAGAAAGGAAGGGTGGAGG + Intronic
1148743878 17:49907833-49907855 AGGACAGAAAGGCAGGATGGTGG + Intergenic
1149027894 17:52051056-52051078 AGGGGAAAAATGAAGAATGGAGG + Intronic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1149824180 17:59811977-59811999 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
1149867893 17:60160900-60160922 AGGAGTAGAGGGAGGGAGGGAGG + Intronic
1150105779 17:62461562-62461584 AGGAAGAGAAGGAAGGAGGGAGG - Intronic
1150330212 17:64288187-64288209 AGGAGGAAGAGGGAGGAGGGAGG + Intergenic
1150516524 17:65816434-65816456 AGGAGAAAAAGGTGGGAAGGGGG - Intronic
1150580911 17:66473100-66473122 AGGAGAAGAAGGAGGAATGGGGG - Intronic
1150731483 17:67698953-67698975 AGAAGTAAAAGGCAGGTTGGGGG - Intergenic
1150772004 17:68050250-68050272 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1150772025 17:68050361-68050383 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1150859454 17:68786342-68786364 AGGGGTGAGAGGAAGGAAGGAGG - Intergenic
1151228239 17:72662484-72662506 AGAAAGAAAAGGAAGGAAGGAGG + Intronic
1151484509 17:74389927-74389949 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1152514863 17:80817289-80817311 TGAAGGAAAAGGAAGGCTGGGGG + Intronic
1153025729 18:670654-670676 AGGAAGATAAGGAGGGATGGTGG - Intronic
1153436067 18:5069260-5069282 GGGAGGGAAAGGAAGGATAGTGG + Intergenic
1154092234 18:11376311-11376333 AGGAGCAGAAGGCAGGATGGAGG + Intergenic
1154111687 18:11574590-11574612 AGAAAGAAAAGGAAGGAGGGAGG + Intergenic
1154406174 18:14093288-14093310 AGGAGAAAGCGGCAGGATGGAGG - Intronic
1154466499 18:14647720-14647742 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1154961238 18:21311049-21311071 AGGAGTGACAGGAGTGATGGAGG + Intronic
1155427579 18:25722692-25722714 AGGAGCAACAAGAAGGCTGGAGG - Intergenic
1155828396 18:30479688-30479710 AGAAGGGAAAGGAAGGATGCAGG + Intergenic
1156074875 18:33262369-33262391 ATGAAAAAAAGGAAGGTTGGAGG - Intronic
1156687219 18:39664713-39664735 AGAAGTAAAAAGGAGGATGTAGG + Intergenic
1157196704 18:45625740-45625762 AGGAGTAAAAGGAAAGACGACGG + Exonic
1157220423 18:45825313-45825335 AGGAAGGAAAGGAAGGAGGGAGG + Intergenic
1158058735 18:53313031-53313053 AGGAGGAAAGGGAAGAAGGGAGG + Intronic
1158090109 18:53700998-53701020 AGGAAAGGAAGGAAGGATGGAGG + Intergenic
1158241593 18:55384706-55384728 AGGAGAAAAAGACAAGATGGAGG - Intronic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158641594 18:59208177-59208199 AGGAGGAAATGGAGGGAGGGAGG + Intergenic
1159006921 18:63021547-63021569 AGGTGGAAAAGAAGGGATGGAGG - Intergenic
1159164325 18:64682903-64682925 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1159352545 18:67294545-67294567 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
1159754222 18:72343680-72343702 AGGGGTAGGGGGAAGGATGGAGG + Intergenic
1160448655 18:78947051-78947073 AGGAGGAAAAGGGAGGAGGATGG + Intergenic
1160872155 19:1282436-1282458 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160872180 19:1282497-1282519 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1161259962 19:3332421-3332443 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1161259975 19:3332462-3332484 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1161404017 19:4081842-4081864 AGGAGTAGGAGGGAGGAAGGAGG - Intergenic
1161427732 19:4213280-4213302 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
1161762099 19:6181305-6181327 AGGAAAGAAAGGAAGGAGGGAGG + Intronic
1162331594 19:10033150-10033172 AGGGGAAGAAGGAGGGATGGAGG + Intergenic
1162337843 19:10072727-10072749 AGAAGAAAAAGAAAGGAAGGAGG + Intergenic
1163463089 19:17450733-17450755 AGGAGGAGAAGGAAGGGAGGAGG - Intronic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1164302445 19:23973640-23973662 AGGAGTAGAAGGAAAGCAGGAGG + Intergenic
1164588658 19:29494413-29494435 AGAAGGAAAAGGAAGGAAGGAGG + Intergenic
1164889743 19:31813007-31813029 AAGAGTAAAAGGATGGATATAGG + Intergenic
1164953625 19:32361783-32361805 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1164956657 19:32392336-32392358 AGGAAGAAAGGGAAGGAAGGAGG + Intergenic
1165510452 19:36263909-36263931 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
1165844332 19:38808651-38808673 AGAAAGAAAAGGAAGGAAGGCGG + Intronic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166169116 19:41014854-41014876 AGTAGGAAAAGGAAGGAGGAGGG + Intronic
1166182422 19:41118267-41118289 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
1166528926 19:43530770-43530792 AGGAGGAAAATGAAGTGTGGAGG - Intronic
1166692725 19:44833471-44833493 AGAAAGAAAAGGAAGGAGGGAGG + Intergenic
1166801571 19:45460895-45460917 AGGAGTATAATGCAGGATGCAGG + Intronic
1167195508 19:48025574-48025596 AGGAGTAAGAGGAGACATGGAGG - Intergenic
1167204704 19:48093184-48093206 AGGAGAACAAGGTAGGATGAAGG - Intronic
1167237122 19:48321812-48321834 AGGATTCATAGGAAGGAAGGCGG + Intronic
1167386027 19:49164339-49164361 AGGAAAGAAAGGAAGGAGGGAGG - Intronic
1167598049 19:50437580-50437602 AGGGGAAAAAGGGAGGATTGGGG + Intronic
1167698794 19:51030262-51030284 GGGAGTAAAAGGGAGGACCGGGG - Intronic
1168220359 19:54956125-54956147 GGGAGAGAAAGGAAGGAAGGAGG + Intronic
1168433870 19:56302556-56302578 AGGAAGAAAAGGAAGGGGGGAGG - Intronic
1202644362 1_KI270706v1_random:126791-126813 AGTAATAATAGGAAGGAGGGTGG + Intergenic
925082206 2:1079160-1079182 AGGAATAAAAGCAAGGAGAGGGG - Intronic
925119364 2:1405386-1405408 AGTAATAAAAGGATGGATGAGGG - Intronic
925199185 2:1952715-1952737 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199239 2:1952874-1952896 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199256 2:1952927-1952949 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925235571 2:2274349-2274371 AGGAGAGAAGGGAAGGAGGGAGG + Intronic
925544409 2:5002251-5002273 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
926033918 2:9618924-9618946 AGGACTAAGGGGAAGGGTGGAGG - Intronic
926241973 2:11095502-11095524 AGGAATAAAAGGCAGGATGAGGG + Intergenic
926266882 2:11331005-11331027 AGGAGCAGAAAGAAGGAGGGAGG + Intronic
926413457 2:12627788-12627810 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
926636606 2:15186802-15186824 TGGAGAACAAGGAAGGATTGGGG - Exonic
926828807 2:16937253-16937275 AGGAGGGAAAGGACGGAGGGAGG + Intergenic
926904505 2:17793191-17793213 AGGAGGAAAATGAGGCATGGAGG + Intronic
927019137 2:18999393-18999415 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
927110725 2:19862154-19862176 AGGAGACAAAGGAAAGCTGGGGG + Intergenic
927175857 2:20406970-20406992 AAAAGAAAAAGGAAGGAAGGAGG - Intergenic
927287503 2:21371678-21371700 AGGGGGAAAAGGAGGGAAGGAGG + Intergenic
927322755 2:21767008-21767030 AGGAGAAAAAGGAAGCAGGGAGG - Intergenic
927375666 2:22410577-22410599 CTGAGTAAAAGTAAGGATAGTGG - Intergenic
927524383 2:23723487-23723509 GGGAGGAAAAGGAGGGAGGGAGG + Intergenic
927699492 2:25258933-25258955 AGGAGGAAGATGCAGGATGGGGG + Intronic
928036409 2:27828303-27828325 AAAAGAAAAAGGAAGGTTGGAGG + Intronic
928228004 2:29470914-29470936 AAGGATAAAAGAAAGGATGGTGG + Intronic
928269297 2:29841990-29842012 AGGAGTGAAGAGGAGGATGGAGG - Intronic
928373775 2:30759158-30759180 AGGAGAAAAACGAGGGAGGGAGG - Intronic
928373800 2:30759242-30759264 AGGAAGAAAAGAAAGGAAGGAGG - Intronic
928692632 2:33816717-33816739 AGGAAGGAAAGGAGGGATGGAGG - Intergenic
928945585 2:36769078-36769100 AAGAGAAACAGGAAGGATGCTGG + Intronic
928960134 2:36915889-36915911 AGAGGGAAAAGGAAGGAAGGTGG + Intronic
929131294 2:38575828-38575850 AGGGGAAAAAGCAAAGATGGGGG - Intronic
929137526 2:38638832-38638854 AGGAGAAAGAGAAAGAATGGGGG + Intergenic
929611378 2:43273284-43273306 AGAAGAAAAAGAAATGATGGAGG + Intronic
929802982 2:45120257-45120279 AGGAGCCAAAGGAAGGAGGCAGG + Intergenic
929891703 2:45923797-45923819 AGGAGCAGAGGGAAGGAGGGAGG + Intronic
929891787 2:45924371-45924393 AATAGGAAAATGAAGGATGGAGG + Intronic
930102872 2:47616629-47616651 AAGAGTAAAAGAGAGGGTGGTGG + Intergenic
930366500 2:50446354-50446376 AGGAGTGAAAAGAGGGAGGGAGG - Intronic
930482666 2:51968680-51968702 AGAAGTAAGAGGTAGGAAGGAGG + Intergenic
930517363 2:52424734-52424756 AGGAGGGCAAGGAAGGAAGGAGG + Intergenic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
931307240 2:61041650-61041672 AGCAGTGAATGGAAGGAGGGAGG + Intronic
931512048 2:63009422-63009444 AGAAGAAAAAGGAAGGAATGGGG + Intronic
931607158 2:64064152-64064174 AGGAGTTAAAGAAAGGAAGCTGG + Intergenic
931773399 2:65518663-65518685 AGGAGGTAAGGAAAGGATGGAGG - Intergenic
932046600 2:68356575-68356597 AGGACCAACAGGAAGGATGAGGG + Intergenic
932208153 2:69902248-69902270 AGGAGAAGAAAGAAGGAAGGAGG - Intronic
932974091 2:76578291-76578313 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
933012951 2:77089648-77089670 GGGAGTAGAAGGAGGAATGGAGG - Intronic
933360907 2:81282628-81282650 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
933521247 2:83377202-83377224 AGGAGTTAAGGGAAGGAAGGAGG - Intergenic
934103500 2:88675440-88675462 AGCATTAAAAGGAATGATGGTGG + Intergenic
934506737 2:94900334-94900356 AGTAATAACAGGAAGGAGGGTGG + Intergenic
934903536 2:98179751-98179773 AAGAGAGAAAGGAAGGAGGGAGG - Intronic
934991444 2:98924700-98924722 AGGAGTAGGAGGAAGGAGGTGGG - Intronic
935038879 2:99406317-99406339 AGGAGCACAAAGAAGGTTGGTGG - Exonic
935123242 2:100200001-100200023 AGGAGGAAGAGGGAGGAAGGAGG - Intergenic
935253056 2:101282555-101282577 AGCAGCAAATGGAAGGAGGGAGG - Intronic
935516662 2:104048882-104048904 GAAAGTAAAAGGAAGGAAGGAGG - Intergenic
935874822 2:107494869-107494891 AGGAAAAAGGGGAAGGATGGAGG + Intergenic
936135321 2:109888118-109888140 AGAAGGAAAAGAAAGGATGGAGG + Intergenic
936209376 2:110483367-110483389 AGAAGGAAAAGAAAGGATGGAGG - Intergenic
936379405 2:111970741-111970763 AGGAGGAGAAGGGAGGAGGGAGG - Intronic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936428562 2:112438606-112438628 AGAAGGAAAAGAAAGGATGGAGG - Intergenic
936500634 2:113063149-113063171 AGGATTAAAGGGAAGGAGGTGGG - Exonic
936688915 2:114862704-114862726 AGGAGTAAAAGGAGAAATGTAGG + Intronic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
937034550 2:118769876-118769898 AGGAAGAAAAGGGAGGAAGGGGG + Intergenic
937140043 2:119592135-119592157 AGGAGAAAGAGGGAGGCTGGAGG + Intronic
937509836 2:122583046-122583068 GGAAGGAAAAGGAAGGAAGGAGG + Intergenic
937509859 2:122583148-122583170 AGAAGAAAAAGGAAGGAGGAAGG + Intergenic
937953715 2:127407896-127407918 AGGAGCAGAAGGAGGGAGGGAGG - Intergenic
938142006 2:128802334-128802356 GGAAGGAAAAGGAAGGAGGGAGG - Intergenic
938615061 2:132989076-132989098 AGGAACAAGAGGAAGCATGGCGG + Intronic
938992712 2:136645681-136645703 AGGAGTGAAAGGAAGGAGGCAGG + Intergenic
938999895 2:136722145-136722167 AGGAATAAAGGGAAGGAAAGAGG - Intergenic
939361424 2:141177180-141177202 AGGAGTCACAAGAAGGAAGGAGG + Intronic
939379346 2:141414250-141414272 AAAAGAAAAAGGAAGGAAGGAGG + Intronic
939472883 2:142647059-142647081 AGGATTAAAAAGAAAGATGTGGG + Intergenic
939616441 2:144366619-144366641 AGGATTAAAAGGCAGCATGTTGG - Intergenic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
939978334 2:148747297-148747319 AGGAGTAAAAGGTAGTATGGAGG - Intronic
939994235 2:148905517-148905539 AGAAGTGAGAGGAAGGATGCTGG + Intronic
940342918 2:152600268-152600290 AGGAGAAAAAGAAAGTATTGAGG + Intronic
940496216 2:154432434-154432456 AGGAGGAAAAGGAGGTATGTTGG + Intronic
940665451 2:156602898-156602920 AGAAGTAAAAGCAGGGAAGGAGG + Intronic
940696378 2:156984673-156984695 AGGAGGAGGAGGAAGGAGGGAGG + Intergenic
940745210 2:157559966-157559988 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
941143230 2:161811429-161811451 AGGAGAAAATGGAAAAATGGAGG - Intronic
941456339 2:165714934-165714956 AGGAGAAGAAGGAGGAATGGAGG + Intergenic
941465192 2:165817249-165817271 AGGAGAAGAAGGAAGGAAGGAGG + Intergenic
942184848 2:173415267-173415289 AAGAAAAAAAGGAAGGAAGGAGG - Intergenic
942610194 2:177735534-177735556 AGGAGAATAAGGAAACATGGCGG + Intronic
942663540 2:178291721-178291743 AGGAAAGAAAGGAAGGAGGGAGG - Intronic
943413071 2:187564917-187564939 AGGAGTAGAAGGAGGAATGGAGG + Intronic
943801734 2:192068478-192068500 AGGAGTAAAAGGATCAAGGGAGG + Intronic
943821655 2:192330557-192330579 AGGAGAGAAAGGAGGGAGGGAGG + Intergenic
943860621 2:192857738-192857760 AGGAACAAAAGGAAGGAAGGAGG + Intergenic
944104199 2:196061716-196061738 TGGAGAAAAAGAAAGAATGGGGG + Intronic
944393990 2:199248197-199248219 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
944417599 2:199494440-199494462 AGGAGTAAAAGAAAAGACTGGGG + Intergenic
944542874 2:200770220-200770242 AGGAAGAAAAAGAGGGATGGAGG - Intergenic
944823111 2:203451547-203451569 AGGGTTAAGAGGAAGGCTGGAGG + Intronic
945032746 2:205680882-205680904 GGGAGGAAGAGGAAGGAGGGAGG + Intergenic
945153246 2:206811280-206811302 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
945258478 2:207822622-207822644 AGGAGTAAAGGGAATCATGTCGG - Intergenic
945580308 2:211586538-211586560 AGAAGTAAAAGGAAGTATTCTGG - Intronic
945692236 2:213051692-213051714 AGTAATAAAAGGAAAGATGGAGG + Intronic
945938169 2:215923643-215923665 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
945959133 2:216114007-216114029 AGGAGAGAAAGAACGGATGGTGG + Intronic
946088898 2:217202822-217202844 AGGAATGAAAGGAAGAATGGAGG - Intergenic
946502494 2:220264331-220264353 AGGAATCAGAGGAAGGATAGAGG - Intergenic
946549861 2:220789368-220789390 AGGTGTCAAAGGAAGAGTGGAGG - Intergenic
947007169 2:225525621-225525643 AGAGGTAGAAGGATGGATGGTGG + Intronic
947395586 2:229683810-229683832 AGGAGCCAAAGTAGGGATGGGGG + Intronic
947513915 2:230784592-230784614 AGGAGGGAAAATAAGGATGGTGG + Intronic
947912862 2:233812927-233812949 AGGAGTTTAAAGCAGGATGGTGG + Intronic
947937616 2:234021538-234021560 AGGAATAAAACAAAGGATAGGGG - Intergenic
947978368 2:234386981-234387003 TGGAAAAAAAGGAAGGAAGGAGG + Intergenic
948005952 2:234607624-234607646 AGGAATAGAAGAAAGGAGGGAGG - Intergenic
948282710 2:236760250-236760272 AGGAAGAAAGGGAAGGAGGGAGG + Intergenic
948735062 2:239998229-239998251 AGGAGGAAAGTGAAGGAGGGAGG - Intronic
1168844991 20:938268-938290 ATGAGTGAAAGGAAGGAGAGAGG + Intergenic
1169023453 20:2347975-2347997 ATGAATAAAAGTCAGGATGGGGG + Intergenic
1169241610 20:3986229-3986251 AGGAGGAAAAGGAAGGAAGGAGG - Intronic
1169530994 20:6484946-6484968 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1169585981 20:7086041-7086063 AGGAAAAGAAGGAAGGAGGGAGG - Intergenic
1170069002 20:12344702-12344724 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1170106095 20:12755156-12755178 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1170132849 20:13041501-13041523 AGGAGTAAAAGAAGGTATGATGG - Intronic
1170727980 20:18946940-18946962 AAAAGCAAAAGGAAGGTTGGAGG + Intergenic
1170947262 20:20902426-20902448 AAGAAGAAAAGGAAGGAAGGAGG - Intergenic
1171179505 20:23082168-23082190 GGAAGTGAAAGGAAAGATGGAGG - Exonic
1171198875 20:23225202-23225224 AGGAATACAAGGAGGGAGGGGGG + Intergenic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1171271788 20:23823829-23823851 AGAAGCAAAAGGAAGGAGGGAGG + Exonic
1171331123 20:24339747-24339769 GGGAGGAAAAGGGAGGGTGGGGG - Intergenic
1171756439 20:29113940-29113962 AGGAAGAAAAGGAAGGAAAGAGG + Intergenic
1171894330 20:30745723-30745745 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1171958063 20:31475070-31475092 AGACGAGAAAGGAAGGATGGGGG - Intronic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172323121 20:34012527-34012549 AGGAAAAAAACAAAGGATGGCGG - Intronic
1172530832 20:35630358-35630380 ATGAGTAAAAGGGAGAGTGGGGG - Intronic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1172620819 20:36317199-36317221 AGGAGAGGAAGGAAGGAAGGAGG - Intronic
1172898251 20:38315748-38315770 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
1172936236 20:38622576-38622598 GGGATTAAAGGGAAGGATGTGGG + Intronic
1173349468 20:42231955-42231977 AGGAGATAAAGTATGGATGGGGG - Intronic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173629029 20:44496174-44496196 ATACGTAAAAGGAAGGAGGGAGG + Intergenic
1173856848 20:46255720-46255742 AGCAGGAAAAGGAAGAAGGGAGG - Intronic
1174166101 20:48584578-48584600 AGAAGAAGAAGGAAGGAAGGAGG - Intergenic
1174187530 20:48717223-48717245 AAGAGAAAAAGGCAGGAGGGTGG + Intronic
1174304914 20:49608329-49608351 TGGAGTGAAAGGGAGGAGGGAGG - Intergenic
1174352899 20:49981226-49981248 AGGAACAGAAGGAAGGCTGGGGG + Intergenic
1174440222 20:50545655-50545677 AGAAGCAAAAAGAAAGATGGAGG + Intronic
1174642530 20:52056854-52056876 GGGAGTAAAGGAAGGGATGGTGG + Intronic
1174701238 20:52611246-52611268 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1174706171 20:52658342-52658364 AGGAGTGAAAGAAAGGAGGAGGG + Intergenic
1174796598 20:53527657-53527679 AAGAGTGAAAGCAAGGCTGGGGG + Intergenic
1174941469 20:54933720-54933742 AGGAGAAGAAGGAAGAAAGGAGG + Intergenic
1174952332 20:55055911-55055933 AGGAAGAAAAGGAAGAAGGGAGG - Intergenic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175067405 20:56301157-56301179 GGGAGTAAAAGGAGGGACAGAGG + Intergenic
1175095946 20:56541562-56541584 AGGAGTACACGTAAGGCTGGCGG - Intergenic
1175160168 20:57002495-57002517 AGGAGAGGAAGGAAGGAGGGAGG - Intergenic
1175225976 20:57444266-57444288 AAGGGATAAAGGAAGGATGGGGG - Intergenic
1175256624 20:57651963-57651985 AGGAGTGAGAGGAAGGCGGGGGG - Exonic
1175299956 20:57935774-57935796 TGGAGTTAAAGGCAAGATGGGGG - Intergenic
1175367854 20:58467745-58467767 AGGACTAAGAGGAGGGCTGGGGG - Intronic
1175369497 20:58478403-58478425 AGGGGAAAAGGGAAGGAAGGAGG - Intronic
1175452163 20:59078634-59078656 AGGAGTAAATGGAAGGTTTGTGG - Intergenic
1175603114 20:60291033-60291055 AGGAGCAAGAGGGAGGGTGGTGG + Intergenic
1175983997 20:62755228-62755250 AGGAGTGAATGGAGGGAAGGAGG - Intronic
1176047385 20:63099928-63099950 AGGAAAAAAAGGAAGGAGGGAGG + Intergenic
1176100514 20:63362344-63362366 AGGAGGAGAAGGAAGGTAGGGGG - Intronic
1176383986 21:6127878-6127900 AGGAGAAAGAGGAGGGAGGGAGG + Intergenic
1176607518 21:8845858-8845880 AGTAATAAAAGGAAGGAGGGTGG - Intergenic
1176808095 21:13510881-13510903 AGGAAGAAAGGGAAGGAGGGAGG + Intergenic
1176960380 21:15152785-15152807 AGAAGTAAAGGGAAGGAATGGGG - Intergenic
1177164435 21:17583935-17583957 AGCAACAAAAGGAAGGAAGGAGG - Intronic
1177301321 21:19249268-19249290 AGGAGGAAAAGGGGGGAAGGCGG - Intergenic
1177637492 21:23806588-23806610 AGGAAGAAAACGAAGGAAGGAGG + Intergenic
1178002339 21:28176399-28176421 AGAAGAAGAAGGAAGGAAGGAGG + Intergenic
1178341797 21:31791845-31791867 TGGATTAAAAGGAAAGATGAGGG + Intergenic
1178357898 21:31923710-31923732 AAGAACAGAAGGAAGGATGGAGG - Intronic
1178719814 21:34998410-34998432 AGGAGGAGGATGAAGGATGGAGG - Intronic
1178763838 21:35430475-35430497 AAAAGAAAAAGGAAGGAAGGAGG - Intronic
1178840845 21:36136387-36136409 GGGAGTGAAATGAAGGATGGGGG + Intronic
1179081659 21:38176906-38176928 AGGAATAAAAGGAAGAAGAGGGG + Intronic
1179190454 21:39118286-39118308 AGGAGCAAGAGAAAGAATGGAGG + Intergenic
1179277604 21:39906536-39906558 AGGAGCGGAAGGAAGGAAGGAGG - Intronic
1179328748 21:40377752-40377774 AGGAGTGAGAGGAGGCATGGAGG + Intronic
1179387414 21:40956221-40956243 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1179567488 21:42258338-42258360 AGGAATAGAGGGAGGGATGGAGG - Intronic
1179739488 21:43410360-43410382 AGGAGAAAGAGGAGGGAGGGAGG - Intergenic
1180357605 22:11855650-11855672 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1180380659 22:12136683-12136705 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1180500820 22:15927468-15927490 AGGAGGAAAAGCAAGGAGAGTGG + Intergenic
1180798623 22:18620652-18620674 AGGATAGAAAGGAAGGAAGGTGG + Intergenic
1181223093 22:21374612-21374634 AGGATAGAAAGGAAGGAAGGTGG - Intergenic
1181255645 22:21561022-21561044 AGGATAGAAAGGAAGGAAGGTGG + Intronic
1181856952 22:25788712-25788734 AGGAGGAGAAGGAAGGAGGAGGG - Intronic
1181893875 22:26089057-26089079 AGGAAGAAAAAGAGGGATGGAGG + Intergenic
1182008312 22:26979673-26979695 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1182022315 22:27091277-27091299 AGCAATAAAAGGGTGGATGGGGG + Intergenic
1182093290 22:27610152-27610174 AGGCAGAAAAGGAAGGATGGTGG + Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182935514 22:34218302-34218324 AGGAGTCAGAGGCAGGAGGGTGG - Intergenic
1183067357 22:35372276-35372298 AGGAGTGAGAGGAAGGGTGGAGG - Intergenic
1183209727 22:36443400-36443422 AGGAGTGAAGGGAGGGAGGGAGG - Intergenic
1183251809 22:36735600-36735622 AGTAGCAAAAGGAAAGAAGGGGG - Intergenic
1184014810 22:41777997-41778019 AGGAGGAGAAGGAAGGAAGGAGG - Intronic
1184014814 22:41778014-41778036 AGGAGGAGAAGGAAGAAAGGAGG - Intronic
1184839997 22:47046902-47046924 AGGAGTGTAAGAAAGGCTGGCGG + Intronic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1185079778 22:48703324-48703346 AGGAGAAGAAGGAAGGACGGCGG - Intronic
1203290053 22_KI270735v1_random:28005-28027 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
949313627 3:2727871-2727893 AGGGGTTAAAAGAAGGAAGGCGG + Intronic
949433367 3:4002497-4002519 AAGAGAAAAAGCAAGGCTGGGGG + Intronic
949671012 3:6398926-6398948 GGGAGAAAAAGGAGGAATGGAGG - Intergenic
949760180 3:7462053-7462075 AGAAGAAAAAGGAAGGAATGGGG - Intronic
949818498 3:8089223-8089245 AGGAGGAAAAGGACGGATGAGGG + Intergenic
949836468 3:8275379-8275401 AGGAGTAAAAGGAAAGTCTGAGG - Intergenic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
950996233 3:17499929-17499951 AGGAATACTAGAAAGGATGGTGG + Intronic
951044844 3:18026568-18026590 AAGAGAAATAGGAAGGAGGGGGG - Intronic
951154554 3:19333972-19333994 AGGAATAAAAGGAAGAAGAGTGG + Intronic
951650031 3:24941159-24941181 AGGAATAGAAGGATGGAGGGTGG + Intergenic
951887695 3:27540013-27540035 AGGAGGAAAAGGGAGAATGAGGG + Intergenic
952154973 3:30633102-30633124 TGGAGTATCAGGAAGGATGAGGG + Intronic
952282499 3:31937549-31937571 AGGACTGAAAGGCATGATGGGGG - Intronic
953134955 3:40174415-40174437 AGGAGTATAAGTATGAATGGGGG - Intronic
953176418 3:40557407-40557429 TGGAGAAAAAGGAATGTTGGTGG - Intronic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
953825844 3:46250714-46250736 AGGAGAAGAAGGAGGAATGGAGG + Intronic
953852218 3:46473037-46473059 AGGCGCAAGAGGCAGGATGGAGG - Intronic
953900988 3:46843976-46843998 AGGAGGATTTGGAAGGATGGGGG - Intergenic
953969738 3:47337788-47337810 AGGAGCAAAAGTGGGGATGGTGG - Intronic
954142190 3:48613805-48613827 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
954213481 3:49111444-49111466 AGGAGGATAAGGGAGGATGGAGG - Intronic
954498431 3:50987695-50987717 ACGAAGAAAAGGCAGGATGGTGG + Intronic
954725725 3:52607802-52607824 AGAAATAAAGAGAAGGATGGAGG - Intronic
955011659 3:55022639-55022661 AGGAGAGAGAGGAAGGAAGGAGG - Intronic
955096588 3:55804773-55804795 AGCAGTGAAAAGAATGATGGTGG - Intronic
955253217 3:57304941-57304963 GGGAGAAAAAGGAGGAATGGAGG - Intronic
955697258 3:61649172-61649194 AATAGAAAAAGGAAGGAAGGAGG - Intronic
955724441 3:61918129-61918151 ATGAGGCAAAGGCAGGATGGTGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955767353 3:62358888-62358910 AGGAGTATAAGGAGGGATTCAGG + Intergenic
956330215 3:68098583-68098605 AGGAGCAAAAGATAGGGTGGTGG + Intronic
956629069 3:71296874-71296896 AAGAGAAAAAGGAAGCTTGGAGG - Intronic
957193871 3:77042682-77042704 AGGAATGAAAGGAGGGAGGGAGG - Intronic
957295101 3:78325150-78325172 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
957416926 3:79917421-79917443 AGGAAGAGAAGGAAGGAGGGAGG + Intergenic
957525925 3:81378757-81378779 AGGAGAAACAGCAATGATGGGGG - Intergenic
957805246 3:85139897-85139919 TGGAGTGAAGGGAAGGATGTAGG + Intronic
958022986 3:88018388-88018410 AGAAAGAAAAGGAAGGAAGGAGG + Intergenic
958115305 3:89208480-89208502 AAGAGAAAAAGAAAGGAGGGAGG + Intronic
958860454 3:99438900-99438922 AGCAGAAGAAGGAAGGAGGGAGG + Intergenic
959034667 3:101346968-101346990 AGGAGGAGGAGGAAGGAGGGAGG + Intronic
959248124 3:103901919-103901941 AGGAGTAAAAGAAAAAATGTTGG - Intergenic
959288488 3:104444355-104444377 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
959349893 3:105249055-105249077 AGGAGCAAAAGGAGGGCAGGGGG - Intergenic
959972404 3:112422001-112422023 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
960283023 3:115797928-115797950 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
960334547 3:116400459-116400481 AGAAAGAAAAGGAAGGAAGGAGG - Intronic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
960647351 3:119902330-119902352 AGCAATAATAGGAAGGAGGGAGG + Intronic
960865456 3:122194941-122194963 AGGAGGAAGAGGAAGGGAGGTGG - Intronic
960899224 3:122537839-122537861 AGGAAAAAAAGGAAGGAAGGAGG - Intronic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
961343865 3:126248297-126248319 AGGAGGAGAAGGAGGAATGGAGG - Intergenic
961460261 3:127045562-127045584 AGGAGAGAAAGGGAGGAGGGAGG + Intergenic
961619518 3:128212698-128212720 AGGAGTAAAAGCATGTTTGGAGG + Intronic
961673823 3:128552910-128552932 TGGAGCAGCAGGAAGGATGGGGG + Intergenic
961712915 3:128841001-128841023 GGGAGAAAAAGGAGGAATGGAGG + Intergenic
962113495 3:132475511-132475533 AGGAGAAACAAGAAAGATGGTGG + Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
963402205 3:144813640-144813662 ACGAGTAAAAGAACGGAGGGAGG - Intergenic
963684188 3:148415618-148415640 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
963810487 3:149772012-149772034 AAAAAAAAAAGGAAGGATGGAGG - Intronic
963883703 3:150555838-150555860 AGGAGTTAAAGCAAGTATGATGG + Intronic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964942013 3:162170031-162170053 AGGAAGAAAAGAAAGGAGGGAGG - Intergenic
965070185 3:163908827-163908849 GGGAGAAGAAGGAGGGATGGAGG - Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965230412 3:166043825-166043847 TGGAGGTAAAGGAAGGATGGAGG + Intergenic
965507658 3:169534253-169534275 ATGAGTAGAAGGACAGATGGAGG - Intronic
965520660 3:169665828-169665850 AGGAGTGGAGGGGAGGATGGCGG - Intergenic
965544361 3:169900165-169900187 AATAATAAAAGGAAGGATAGAGG - Intergenic
965565436 3:170111467-170111489 AGAAGAAAAAAGAAGGGTGGGGG + Intronic
965713257 3:171577689-171577711 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
965834964 3:172841152-172841174 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966112347 3:176418389-176418411 AGGAAAAAAAGGAATTATGGAGG + Intergenic
966697889 3:182811531-182811553 ATGAGCCAAAGGAAGGAAGGTGG - Intronic
966907493 3:184538539-184538561 AGAAAGAAAAGGAAGGAGGGAGG - Intronic
967021002 3:185522489-185522511 GGAAGGAAAAGGAAGGAAGGAGG + Intronic
967212310 3:187179952-187179974 GGGAGTAGAAGGAGGAATGGAGG + Intronic
967446885 3:189577671-189577693 AGGAAAAGAAGGAAGGAAGGAGG - Intergenic
967446917 3:189577834-189577856 AGGAAAAGAAGGAAGGAAGGAGG - Intergenic
967488125 3:190057785-190057807 GGGAGTGAAAGGAAAGATGAAGG + Intronic
967594056 3:191309854-191309876 AGGATGAACAGGAAGCATGGTGG - Intronic
967624790 3:191670926-191670948 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
968259795 3:197311379-197311401 AGCAGTCAAAGGAAGAAGGGTGG + Intergenic
968339213 3:197941151-197941173 AGGAGAGAGAGGAAGGAGGGAGG - Intronic
968339253 3:197941299-197941321 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
969085794 4:4655482-4655504 AGGAGTATAAGGAGGCATGAAGG + Intergenic
969392626 4:6901504-6901526 AGGAGGTACAGGAAGGATCGGGG + Intergenic
969495220 4:7522727-7522749 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
969637635 4:8378507-8378529 GGGAGTAAAAAGATGGGTGGTGG - Intronic
969866269 4:10078767-10078789 AGGGGTCAGGGGAAGGATGGGGG - Intronic
970311655 4:14788230-14788252 AGGAGTGAGGGGAAGGAAGGGGG + Intergenic
971178673 4:24306794-24306816 AGTAGTAATAGGAAGGAGGAAGG + Intergenic
971423204 4:26492367-26492389 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971423253 4:26492661-26492683 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971665530 4:29478667-29478689 AGGAATGAAAGGAGGGAAGGAGG + Intergenic
971769593 4:30879162-30879184 AGGAATAAAGGGAGGGAGGGAGG - Intronic
972142762 4:35982120-35982142 AGAAGTAAAGGGAAGTATGAAGG + Intronic
972162987 4:36247623-36247645 AGGAGGAAAAGGAGGGAGAGAGG - Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972369450 4:38408883-38408905 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
972371603 4:38429456-38429478 AAGATGAAAAGAAAGGATGGTGG + Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
972790228 4:42364734-42364756 AAGAGAGAAAGGAAGGAAGGAGG - Intergenic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
972987417 4:44781065-44781087 AGGAAAGAAAGGAGGGATGGGGG - Intergenic
973173752 4:47178016-47178038 AAGATTAAAAGGATGGATGTTGG + Intronic
973714486 4:53661755-53661777 AGGAGTAAATGGAAATGTGGAGG + Intronic
974850741 4:67402709-67402731 AGGGGGAAAAGGTAGGAAGGAGG + Intergenic
975074249 4:70185142-70185164 TGGAGTAGAAGGAAGGGTTGTGG + Intergenic
975515912 4:75248010-75248032 AGGTGTCAAAGGTAGTATGGGGG + Intergenic
975796176 4:78008813-78008835 AGAACTGAAAGGAAGGATAGAGG - Intergenic
975865233 4:78718301-78718323 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
976125404 4:81828971-81828993 AGGAGGATAGGGAAGGATGTGGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976377984 4:84366578-84366600 AGGAGTAAAAGCAAGGGTCAGGG + Intergenic
976460041 4:85300625-85300647 AGAAGTAGAAAGTAGGATGGTGG - Intergenic
976696392 4:87923136-87923158 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
976717701 4:88140304-88140326 AGCAGGAAAAGGATGGATGAGGG + Intronic
976858934 4:89639607-89639629 AGGAATGGAAGGAAGGAAGGAGG + Intergenic
976883780 4:89962008-89962030 AGGAGGAAGAGGAAGGAAAGTGG + Intergenic
977013072 4:91659066-91659088 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
977062654 4:92275935-92275957 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
977075355 4:92443403-92443425 GGGAGTAGAAGGAGGAATGGAGG + Intronic
977416878 4:96744206-96744228 AGGAGGGAAGGGAAGGAGGGAGG - Intergenic
977865767 4:102025742-102025764 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
977919220 4:102625191-102625213 GGGAGAAAGAGGAAGGAGGGAGG - Intergenic
978132139 4:105211723-105211745 AGGAGTAAATGGAGGCATAGAGG + Intronic
978188894 4:105890796-105890818 TGGAGGAAAAGGAAGTATGGAGG - Intronic
978411778 4:108433927-108433949 CGGAGGAAAAGGAAGGAAGCAGG + Intergenic
979002611 4:115243768-115243790 AGGAGGAAAAGGAGGAAAGGAGG - Intergenic
979286331 4:118929122-118929144 AGGAAAAGTAGGAAGGATGGAGG + Intronic
979418000 4:120466854-120466876 AGGAGGAAAGGGAGGGAAGGAGG + Intergenic
980332334 4:131426054-131426076 AAAAAAAAAAGGAAGGATGGAGG + Intergenic
980882855 4:138731173-138731195 AGAAGTAAAAGGTAGTATAGAGG + Intergenic
981001030 4:139829185-139829207 AGGAAAGAAAGGAAGGAGGGAGG + Intronic
981458103 4:144979756-144979778 AGGAGAAAAAGGAAAAAGGGTGG - Intronic
981539581 4:145834010-145834032 GGGAGTAGAAGGAGGAATGGAGG - Intronic
981917142 4:150046943-150046965 AGGGGGAGAAGGAAGGAAGGGGG - Intergenic
981925581 4:150136105-150136127 GGGAGTGAAACCAAGGATGGAGG + Intronic
982037324 4:151358592-151358614 AGGAATAAAAGGATGGCTGGGGG + Intergenic
982183917 4:152777542-152777564 AAGAAAAAAAGGAAGGAAGGAGG + Intronic
982497254 4:156107909-156107931 AGGAGAAGAAGGAGGAATGGAGG + Intergenic
982535302 4:156601565-156601587 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
982754706 4:159204418-159204440 AGGGGTAGTAGGAAGGAAGGTGG + Intronic
982981361 4:162140833-162140855 AGGAGTAGAAGAAAGAAAGGAGG + Intronic
983360275 4:166717567-166717589 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
983629326 4:169833735-169833757 TTGAGTAACAGGAAGGATTGTGG - Intergenic
984185944 4:176544073-176544095 AGGAGTAGCAGCAACGATGGAGG - Intergenic
984671196 4:182489838-182489860 GGGAAGAAAAGGAAGGAGGGAGG - Intronic
985163800 4:187071411-187071433 AGGAGAGGAAGGAAGGAAGGAGG - Intergenic
985219213 4:187685118-187685140 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
985273363 4:188216041-188216063 GGAAGGAAAAGGAAGGAAGGAGG - Intergenic
985390020 4:189483906-189483928 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
985756676 5:1723561-1723583 AGGGGTGGAAGGAAGGAGGGAGG - Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985993750 5:3584816-3584838 AGGAATGAAAGGAAGAAGGGGGG + Intergenic
986202247 5:5589287-5589309 AGGAGCACCAGGAAGGATGCTGG + Intergenic
986388737 5:7264868-7264890 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
986403667 5:7404723-7404745 AGGAGGAAAATAAATGATGGTGG - Intronic
986721219 5:10563117-10563139 GGGAAAAAAAGGAAGGAAGGAGG + Intergenic
986736546 5:10672488-10672510 AGGATTAAAGGGGAGGATGAGGG + Intergenic
986767740 5:10942673-10942695 AGGAAAAAAAGGAAGGAATGAGG - Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
986879103 5:12147870-12147892 AGGAGGAGGAGGATGGATGGAGG - Intergenic
987191247 5:15480648-15480670 AGGACTAAGAGGAAGGATGTGGG - Intergenic
987455141 5:18134931-18134953 AGGAGGAAAAGGAAGAAGAGGGG - Intergenic
987642585 5:20631620-20631642 AAGAGAAGAAGGAAGGAGGGAGG + Intergenic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
989325190 5:40184909-40184931 AAGAAAAAAAGGAAGGAGGGAGG + Intergenic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
989710789 5:44394600-44394622 AGGAGTAAAAGAGAGGAGGTCGG - Intergenic
990041936 5:51387244-51387266 GGGAGTAAAAGAAAGGGAGGAGG + Intronic
990658740 5:57988200-57988222 AGGAAGGAAAGGAAGGAGGGAGG - Intergenic
990820370 5:59832961-59832983 AGGATGAAATGGAGGGATGGGGG + Intronic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
991245283 5:64503676-64503698 AGGAAAAAAAGGAGGGAGGGAGG + Intergenic
991272136 5:64796760-64796782 AGAAGGAAAAGGAGGGAGGGAGG - Intronic
991272149 5:64796804-64796826 AGAAGGAAAAGGAGGGAGGGAGG - Intronic
991433631 5:66573500-66573522 AGGAGAAAAGGGAGGGAGGGAGG + Intergenic
991450762 5:66748456-66748478 AGGAAGAGAAGGAAGGAAGGAGG - Intronic
992034967 5:72764169-72764191 AGGAGGGAAAAGGAGGATGGAGG - Intergenic
992082825 5:73251250-73251272 TGGAGGAATAGGCAGGATGGAGG + Intergenic
992394520 5:76358622-76358644 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
992692770 5:79256762-79256784 AGAAATGAAAGGAAGGGTGGGGG - Intronic
992744563 5:79806488-79806510 AGGAGGAATAGAAAGGAAGGAGG + Intergenic
992837579 5:80655276-80655298 AGGAAAAAAAAAAAGGATGGAGG - Intronic
992949548 5:81844811-81844833 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
992994460 5:82318665-82318687 AGGAGGAAAGGGAGGGAGGGAGG + Exonic
993021664 5:82598855-82598877 AGGAAGAAAAGAAAAGATGGAGG + Intergenic
993144621 5:84078564-84078586 AAGAGGAATAGGAAGGAAGGTGG + Intronic
993626541 5:90231783-90231805 AGGAAGGAAAGGAAGGAGGGAGG + Intergenic
994779153 5:104068978-104069000 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
995095090 5:108226358-108226380 AGAAGTAAAAGGTATGATGGAGG - Intronic
995142843 5:108752220-108752242 AGGAGTAAAAAAAGGGAAGGAGG - Intronic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995733609 5:115273441-115273463 AGGAGGAAAGGGAAGTTTGGAGG - Intronic
996401515 5:123068417-123068439 TGGAGTAAAAGGTAAGATGCAGG + Intergenic
996404569 5:123093053-123093075 TGGAGTGAAAGGAAGGGTGGAGG + Intronic
996473931 5:123893471-123893493 ACTAGTAAAAGGAAACATGGGGG + Intergenic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
996745591 5:126844003-126844025 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
997251947 5:132395916-132395938 AGGAGAACAGGGAAGGAGGGAGG + Intergenic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
997337909 5:133120759-133120781 AGGAATAAAAGGCAGGCTCGGGG - Intergenic
997506538 5:134422012-134422034 AGGAGAAGAAGGAAGGAAGAAGG - Intergenic
997769818 5:136544057-136544079 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
997772783 5:136569777-136569799 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
997986001 5:138502083-138502105 AGGAGAATAAGGAAGGAGGGTGG - Intergenic
998007315 5:138665570-138665592 AGGGGTAAGAGGAGGCATGGTGG + Intronic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999524892 5:152393969-152393991 AGGATTAAAAGGCAAGTTGGGGG + Intronic
999539710 5:152558077-152558099 ATAGGAAAAAGGAAGGATGGAGG - Intergenic
999558354 5:152770671-152770693 AAAAGGAAAGGGAAGGATGGAGG + Intergenic
999773865 5:154795465-154795487 GGGAGAGAAAGGAAGGAAGGAGG - Intronic
1000380213 5:160622328-160622350 AGGAGTAGAAGGCAGGGTAGGGG - Intronic
1000557417 5:162743383-162743405 AGGCGCAAAATAAAGGATGGAGG - Intergenic
1000885475 5:166743554-166743576 GGGAGTACAAGGAGGAATGGAGG + Intergenic
1001022295 5:168193648-168193670 TGTAGAAAAAGGAAGGGTGGGGG + Intronic
1001164682 5:169353023-169353045 AAGAGGAGAAGGAAGGATAGAGG - Intergenic
1001226446 5:169948565-169948587 AGGAGAGAAGGGAAGGAGGGAGG - Intronic
1001330185 5:170756501-170756523 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1001354665 5:171007846-171007868 AGGAGAAGAAGGAGGAATGGAGG + Intronic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001408725 5:171495344-171495366 GGGAGTCGAAGGAAGGAAGGAGG + Intergenic
1001511078 5:172322405-172322427 AGGAGGAAAAGGAGGGAGGGAGG - Intergenic
1001802928 5:174559022-174559044 TGGAGTGGAAGGAAGGAAGGAGG - Intergenic
1002259065 5:177981830-177981852 ACGGATAAAAGGATGGATGGTGG + Intergenic
1002485701 5:179534668-179534690 AAGTGTAAAAGGACAGATGGAGG + Intergenic
1002500859 5:179646811-179646833 AGGAGGAAAGGGACGGAGGGAGG - Intergenic
1002988532 6:2215675-2215697 AGGAAGGAAAGGAAGGAAGGGGG + Intronic
1003122672 6:3330495-3330517 GGGAGTGACAGGAAGGAGGGAGG - Intronic
1003286339 6:4737249-4737271 AGTAATAGAAGGAACGATGGGGG + Intronic
1003466140 6:6381948-6381970 AGGAGATAAAAGAAGGAAGGAGG + Intergenic
1003517559 6:6829931-6829953 AGGACGAGAAGGAAGGAAGGAGG + Intergenic
1004109728 6:12705126-12705148 AGGAGAAAAGGGAGGGAGGGAGG + Intergenic
1004283669 6:14301394-14301416 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1004459914 6:15826255-15826277 AGAAGGAGAAGGAATGATGGAGG + Intergenic
1004751471 6:18566168-18566190 AGGAATAAAAGGAATAAGGGAGG - Intergenic
1004811554 6:19269306-19269328 AGGAATAAGGGGAAGGATGTGGG - Intergenic
1005272068 6:24176791-24176813 AGAAGTAGAAGGTAGAATGGTGG - Intronic
1005423885 6:25680883-25680905 TGGAGACAGAGGAAGGATGGGGG + Intronic
1005437681 6:25832499-25832521 AGGAGGGAAAGCAAGGAAGGAGG - Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005473778 6:26187617-26187639 AGGTGTAAAGGGAAAGAAGGTGG + Intergenic
1005883472 6:30076701-30076723 AGGAGAAAAAGAGAGAATGGAGG - Intergenic
1006144352 6:31949393-31949415 GGGATAAAAAGGAAGGATGAGGG - Intronic
1006602109 6:35233068-35233090 GGGAGGAAAAGGGAGTATGGGGG + Intronic
1006729400 6:36225129-36225151 AGAGGGAAAAGGAAGGGTGGAGG + Intronic
1006965327 6:37977872-37977894 AGGAGAGAAAGGAAGGAAGAAGG - Intronic
1007134460 6:39507901-39507923 AAGAGGGAAAGGAAGGAAGGAGG - Intronic
1007341525 6:41194059-41194081 AGGAGGATCAGGAAGGATGAGGG - Intronic
1007647242 6:43392305-43392327 AGGGGCAACAGGAAGGCTGGAGG + Intergenic
1007964412 6:45990387-45990409 AAGAGTAAAAGTCAAGATGGAGG - Intronic
1008067835 6:47069401-47069423 AGGAGGAAAAAAGAGGATGGCGG - Intergenic
1008216444 6:48795682-48795704 AGAAGTAATAGAAAGGGTGGTGG - Intergenic
1008216515 6:48796611-48796633 ATGAGTATAAGGATGGATGAGGG - Intergenic
1008333504 6:50271879-50271901 ATGAATAAAAGAAAGAATGGTGG + Intergenic
1008536796 6:52512377-52512399 AGGAGGAAAAGGGTGGAGGGAGG + Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1009297510 6:61971790-61971812 ATGTGTTTAAGGAAGGATGGTGG - Intronic
1009957018 6:70467971-70467993 ATGAGTGAAAGGAAGGCTGATGG + Intronic
1010102773 6:72128767-72128789 AGGAGTAAAAGTAATGATAGTGG - Intronic
1010390854 6:75335509-75335531 AGGAATGAAGGGAAGGAGGGAGG - Intronic
1010586840 6:77664978-77665000 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1011255228 6:85413926-85413948 TGGAGAAAAAGGAGGGGTGGGGG + Intergenic
1012258043 6:97056471-97056493 AGGAGTGACGGGAAGGCTGGTGG - Intronic
1012345487 6:98180292-98180314 AGGAAGAAAAGGAAGGAGAGAGG - Intergenic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1012621395 6:101348692-101348714 AGGACTAAAAGGGAGTGTGGTGG - Intergenic
1012676379 6:102118240-102118262 AAGAGAAAAAGAAAGGAGGGAGG + Intergenic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1012734154 6:102917932-102917954 AGGAGGGAAAGGAAGAAGGGAGG - Intergenic
1012734160 6:102917952-102917974 GGGAGGGAAAGGAAGGAGGGAGG - Intergenic
1012872833 6:104692115-104692137 AGGGAGAAAAGGAAGGAAGGGGG + Intergenic
1013006644 6:106080422-106080444 GGGAGGAGAAGGAAGGATGCTGG - Intergenic
1013520464 6:110928180-110928202 AGGAATGAAGGGAAGGAGGGAGG - Intergenic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1013843827 6:114426767-114426789 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1013891560 6:115033166-115033188 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1014360300 6:120466696-120466718 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1014455011 6:121624867-121624889 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1014794136 6:125706305-125706327 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1014804262 6:125811685-125811707 AGAAGAAAAAGGAAAGATGGCGG - Intronic
1014947420 6:127515377-127515399 AGGAGAACAAGAAAGGAGGGAGG - Intronic
1015136004 6:129871559-129871581 AGTAGTATAAGGAAGGATAATGG - Intergenic
1015269524 6:131324706-131324728 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1015771661 6:136774165-136774187 AGGAGGAGAAGGAAGTGTGGAGG - Intronic
1015787429 6:136932232-136932254 AGGGGTAAACTGAAGTATGGAGG + Intergenic
1015886502 6:137923599-137923621 AGGGGTGAAAGGAAGCTTGGTGG + Intergenic
1016068653 6:139710711-139710733 TGGAGTAGAAGCAAGGAAGGGGG + Intergenic
1016105809 6:140160515-140160537 AGGATTAAAAAGAAGGGGGGGGG + Intergenic
1016248715 6:142017081-142017103 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1016317747 6:142808682-142808704 ATGAATAGAAGGATGGATGGAGG + Intronic
1016317784 6:142808812-142808834 AGGGATAAATGGATGGATGGTGG + Intronic
1016508338 6:144810591-144810613 AATAGTAAAAGGAAAGAAGGAGG + Intronic
1016532623 6:145075231-145075253 AGGAAGAAAAGGAGGGAAGGAGG + Intergenic
1017041116 6:150309237-150309259 AGGAAAAAAAGGAAGGAAGGAGG + Intergenic
1017064940 6:150519840-150519862 ACGATTAAAAGGGAGGATGCAGG + Intergenic
1017988860 6:159469106-159469128 AGGAGGGAAAGGAAAGAGGGAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018229687 6:161663764-161663786 AGGAGGCAAGGGAAGAATGGAGG - Intronic
1018361010 6:163068063-163068085 TGGAGCAAATGGATGGATGGAGG - Intronic
1018471855 6:164104540-164104562 TGGAGTCACAGGAAGGAAGGAGG + Intergenic
1018521618 6:164656595-164656617 AGGAGAAGAAGGAGGAATGGAGG + Intergenic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018661268 6:166089308-166089330 AGGAGGAAAGGGAAGCACGGAGG + Intergenic
1018689380 6:166332692-166332714 ATAAGTAAAATGATGGATGGTGG - Intronic
1018703184 6:166444212-166444234 AGGATTAAAAGGAAGGGGAGAGG - Intronic
1018858421 6:167692174-167692196 AGAAGGAAAGGGAAGGAGGGAGG + Intergenic
1019269446 7:138911-138933 AGGAGTATAATGAAGCGTGGCGG + Intergenic
1019769395 7:2874165-2874187 AGTAGATAAAGCAAGGATGGAGG - Intergenic
1019937695 7:4267189-4267211 AGGGGTAAAGGAAAGGAAGGAGG - Exonic
1020050324 7:5077024-5077046 AGGAAGAAAAGGAAGGAAGAAGG - Intergenic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020092316 7:5348641-5348663 AGGAGTAGAGGGAGGGAGGGAGG + Intronic
1020226996 7:6288330-6288352 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1020532854 7:9357847-9357869 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1020728169 7:11843108-11843130 AGGAGGAAAAGGAGTGATAGTGG - Intergenic
1020983778 7:15106994-15107016 AGGGGTAAAAGGAGGGAGAGTGG - Intergenic
1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG + Intergenic
1021303368 7:19000367-19000389 TGGAGTAAAAGCAAGCAAGGAGG - Intronic
1021466167 7:20945479-20945501 AGGCAGAAAAGGAAGGAAGGAGG - Intergenic
1021738311 7:23660561-23660583 GGGAGTTAAAGGCAAGATGGGGG - Intergenic
1021865018 7:24947147-24947169 AGGAGTAAAACAACAGATGGAGG + Intronic
1022140739 7:27491430-27491452 AGGAGAGGAAGGAGGGATGGGGG + Intergenic
1022174603 7:27861225-27861247 AGTAGTAAAAGGATGGCAGGTGG - Intronic
1022331672 7:29385206-29385228 TGGAGTAAAAGGAAGGCAGAAGG - Intronic
1022343221 7:29487701-29487723 GGGAGGGAAAGGAAGGAGGGAGG - Intronic
1022872588 7:34494742-34494764 AGTAGCAAGAGGAAGGTTGGGGG - Intergenic
1022988070 7:35679815-35679837 AGAAGTAAGAGGAAGGATTTAGG - Intronic
1023053519 7:36273643-36273665 GGGAGGAAAAGGCAGGAGGGAGG - Intronic
1023145947 7:37151272-37151294 AGGATTACAATAAAGGATGGGGG - Intronic
1023224633 7:37956314-37956336 AGAAGAAAAAAGAAGGATGTAGG + Intronic
1023261881 7:38366952-38366974 AGGAAAGAAAGGAAGGAGGGTGG + Intergenic
1023288602 7:38645269-38645291 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1023699035 7:42875051-42875073 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1023766494 7:43516254-43516276 AGGAAAAAAAGAAAGGAGGGAGG + Intronic
1024278872 7:47701507-47701529 AAGAAGAAAAGGAAGGAGGGAGG + Intronic
1024739635 7:52339982-52340004 AGGAAAGAAAGGAAGGAGGGAGG - Intergenic
1024805237 7:53131941-53131963 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1024988730 7:55218524-55218546 AAGAGAAAAAGGAATGATAGAGG + Intronic
1025307744 7:57879335-57879357 AGGAAGAAAAGGAGGGAGGGTGG - Intergenic
1025605060 7:63033798-63033820 AAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1025837934 7:65113116-65113138 AGGAATAAAAGGAGGGAGGGAGG + Intergenic
1025879335 7:65519964-65519986 AGGAATAAAAGGAGGGAGGGAGG - Intergenic
1025885134 7:65582865-65582887 AGGAATAAAAGGAGGGAGGGAGG - Intergenic
1025887761 7:65614467-65614489 AGGAGGAGGAGGAAGGATGGAGG - Intergenic
1026218494 7:68370538-68370560 AGGAAAAAAAGGAAGGATAAAGG + Intergenic
1026545889 7:71321837-71321859 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1026582725 7:71631666-71631688 AGGAGATAAGGGAAGGAAGGAGG + Intronic
1026675361 7:72423992-72424014 AGGAAAAGAAGGAAGGAAGGAGG + Intronic
1026927560 7:74204521-74204543 AGGGGGGAAAGGAAGGAGGGAGG + Intronic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027224241 7:76234051-76234073 GGGAGGGAAAGGAAGGAGGGAGG - Intronic
1027386355 7:77663000-77663022 AGGAGAGAGAGGAAGGAAGGAGG + Intergenic
1027401800 7:77816752-77816774 AGAAGTAAAAAGTAGAATGGAGG - Intronic
1027703659 7:81501006-81501028 AGGAAAAAAAGGAAGGAAGTCGG - Intergenic
1027738842 7:81973569-81973591 AGAAGGAAAAGGAGGGAGGGAGG + Intronic
1027851802 7:83460935-83460957 GGGAGTAGAAGGAGGAATGGAGG - Intronic
1027916775 7:84334680-84334702 GGTAGTAAAAGGGAGGATTGAGG - Intronic
1028244650 7:88462461-88462483 AGTAGTAGAAGAAGGGATGGAGG - Intergenic
1028959481 7:96732735-96732757 AGGAGGAAAAGAAAGGTAGGGGG - Intergenic
1029088263 7:98028289-98028311 AGGAATGAAAGGAGGGAAGGAGG + Intergenic
1029118879 7:98253032-98253054 AGGAGAAAAAAGAAAGATGTCGG + Intronic
1029150282 7:98475511-98475533 AGGAAAAAAAGGAAGGAAGGAGG + Intergenic
1029805447 7:102991300-102991322 TGGGGGAAAAGGAAGGTTGGAGG + Intronic
1030108362 7:106006190-106006212 AGGAGGAAATGGAATCATGGGGG - Intronic
1030552285 7:110977676-110977698 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1030811612 7:113979299-113979321 AGGAATTAAAGGAAGGAAGCTGG - Intronic
1030875623 7:114809890-114809912 GGGAGGAAAAGGAGGGAGGGAGG + Intergenic
1031525449 7:122818187-122818209 GGGAGTAGAAGGAGGAATGGAGG - Intronic
1031728073 7:125263346-125263368 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1031776184 7:125911255-125911277 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1031777194 7:125918863-125918885 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032057204 7:128693357-128693379 CGGAGTGAGAGGAGGGATGGAGG - Intergenic
1032720314 7:134546248-134546270 AGGAGAAAAAGGAAAAAAGGTGG - Intergenic
1032885037 7:136128382-136128404 AGGAGTGAATGGAAGGATTCAGG + Intergenic
1033026205 7:137775364-137775386 AGGAGAAGAAGAAAGGTTGGTGG - Intronic
1033039014 7:137901503-137901525 ATGAGGAAAAGGAGGGTTGGGGG + Intronic
1033141672 7:138832550-138832572 AGAAGGAAAAGGAAGGATCCTGG + Intronic
1033211368 7:139462515-139462537 AGGAGAAGAAGGAGGAATGGAGG - Intronic
1033314429 7:140285769-140285791 AGGAGTCTCAGGAAGGGTGGAGG - Intergenic
1033435299 7:141328377-141328399 AGAGGTAAAAGAAAGGATTGAGG - Intronic
1033909603 7:146247803-146247825 AGGAGAAGAAGGAGGAATGGAGG + Intronic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1034679188 7:152915742-152915764 AGGAAGAAAAGGGAGGAAGGGGG - Intergenic
1034680068 7:152921947-152921969 AGAAGAAAAAGAAAGCATGGTGG + Intergenic
1034913384 7:155016805-155016827 AGGAGTACAAACAAGGCTGGAGG + Intergenic
1034978918 7:155463482-155463504 AGGAGGAGGAGGAAGGAAGGAGG - Exonic
1035257538 7:157640942-157640964 AGCAGTAAAAGGAATGGTGATGG + Intronic
1035951522 8:4027298-4027320 AGGAGTAGAAAGTAGGATGATGG + Intronic
1036207786 8:6818010-6818032 GGGAGAAAAAGGGAGGAAGGAGG - Intronic
1036218849 8:6903648-6903670 AGGGGGAAGAGAAAGGATGGGGG + Intergenic
1036547621 8:9787378-9787400 AGGAGGAAGAGGAGTGATGGAGG - Intergenic
1036575227 8:10021791-10021813 AAGAGTAAAAGGAAGGAAATGGG + Intergenic
1036675954 8:10833445-10833467 AGGAGAAAAAGGAGGGAGGAAGG + Intronic
1037085771 8:14847713-14847735 AGGAGGAAAGGGAGGGAGGGAGG + Intronic
1037098010 8:15008698-15008720 AGGAGAAAAGGGGAGGAGGGAGG + Intronic
1037114474 8:15206887-15206909 TGGAATGAAAGGTAGGATGGAGG + Intronic
1038242697 8:25824396-25824418 AGGAGGAAGAGGAACCATGGAGG + Intergenic
1038338451 8:26663914-26663936 AGAGGACAAAGGAAGGATGGAGG - Intergenic
1038437694 8:27547734-27547756 AGAAGTAAAAAGTAGAATGGAGG - Intergenic
1038476928 8:27875182-27875204 AGGAGTGAAGGGAGGGAGGGAGG - Intronic
1038576645 8:28710047-28710069 AAGAGTAAAAGGTAGAATGCTGG + Intronic
1038679334 8:29652432-29652454 AGAAGAAAGAGGAAGGAAGGAGG + Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039312332 8:36330820-36330842 AGGAGTAATAGAAAGAATGGGGG - Intergenic
1039312392 8:36331226-36331248 AGGAGTAATAGAAAGAATAGGGG + Intergenic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1039884215 8:41646249-41646271 AGGAGGAAAAGGAGGGAAAGGGG - Exonic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1041319525 8:56598940-56598962 AGGATAATAAGGAAGCATGGAGG + Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041940564 8:63382532-63382554 AGGAGAAAAATGAAGGGTGCAGG + Intergenic
1042036656 8:64540906-64540928 AGGAGTGGAAGGAGGGAGGGAGG + Intergenic
1042036686 8:64541010-64541032 AGGAAAGAAAGGAAGGAGGGAGG + Intergenic
1042091722 8:65166064-65166086 AGAAGGAAAAGAAAGGATGGGGG + Intergenic
1042464810 8:69116250-69116272 AGGAATGAAAGGAAGGACTGTGG + Intergenic
1042508495 8:69586952-69586974 AGGAGTAAAAGCAAGGAATGTGG - Intronic
1042563992 8:70094834-70094856 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1042707217 8:71676179-71676201 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1042751056 8:72158135-72158157 AGGAGAAAAAGGTGAGATGGTGG - Intergenic
1042791121 8:72607288-72607310 AGAAGCAGAAGGAAGGAAGGTGG + Intronic
1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG + Intronic
1043297640 8:78684648-78684670 AGGAGTAAAGGGAAGTAATGTGG + Intronic
1043707867 8:83376645-83376667 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1043747535 8:83894471-83894493 AGAAGTAAAAGAAAGAATGGTGG - Intergenic
1043812413 8:84757616-84757638 AGAATTAAAAAGAGGGATGGAGG + Intronic
1043887891 8:85623483-85623505 AGGGAGAAAGGGAAGGATGGAGG - Intergenic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045233095 8:100324846-100324868 AAGAGAGAAAGGAAGGAGGGAGG - Intronic
1045316354 8:101046953-101046975 AGGAGTGAAATGGAGAATGGTGG + Intergenic
1045412126 8:101929658-101929680 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
1045458002 8:102400891-102400913 AAGGGGAAAAGGAAGGTTGGAGG + Intronic
1045615655 8:103907512-103907534 AGAAAAAAAAGGAAGGAAGGAGG - Intronic
1045712444 8:105000653-105000675 AGAACTGAAAGGAGGGATGGAGG + Intronic
1046074751 8:109302079-109302101 GGGAGAAAAAGGAGGAATGGAGG - Intronic
1046265129 8:111821273-111821295 AGGAAAGAAAGGAAGGAGGGTGG + Intergenic
1046439919 8:114242908-114242930 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1046443108 8:114283259-114283281 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1046541138 8:115585444-115585466 AGTAGAAAAAGGAAGGAAAGGGG + Intronic
1046786168 8:118268999-118269021 GAGAGTAAAAGAAAGGATGTGGG + Intronic
1046861879 8:119102235-119102257 AGGAAAAGAAGGAAGGAGGGAGG - Intronic
1047005954 8:120620894-120620916 AGGAAGAGAGGGAAGGATGGAGG - Intronic
1047254762 8:123206948-123206970 AGGAGGAAAAGGAGGGGAGGGGG - Intronic
1047324625 8:123824601-123824623 TGGAGGAAGAGGCAGGATGGGGG - Intergenic
1047438254 8:124853723-124853745 AGGAAGGAAAGGAAGGAGGGAGG + Intergenic
1047527368 8:125645016-125645038 AGGAGGAGGAGGAAGGAAGGTGG - Intergenic
1047699211 8:127433009-127433031 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1047767043 8:127998634-127998656 GGAAGAAAAAGGAAGGAAGGAGG - Intergenic
1047828540 8:128606058-128606080 AGGAGAAGAAGGAAGAAAGGAGG - Intergenic
1048336080 8:133503496-133503518 AGGAAGGAAAGGAAGGAGGGAGG - Intronic
1048761970 8:137805015-137805037 AGGAACAGAAGGAAGAATGGAGG + Intergenic
1048952814 8:139510188-139510210 AGGAGAAAGATGAAGGCTGGAGG + Intergenic
1049335974 8:142085544-142085566 AGGAAGGAAAGGAAGGAAGGAGG + Intergenic
1049395698 8:142399238-142399260 AGCACTAACAGGAAGGATAGTGG + Intronic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1049916920 9:326771-326793 AGAAGAGAAAAGAAGGATGGAGG + Intronic
1050361527 9:4835535-4835557 AGAAGGAGAAGGAAGGATGAGGG + Intronic
1050496059 9:6243744-6243766 TGGAGGATAAGGAATGATGGTGG + Intronic
1051051275 9:12934548-12934570 AGGATTAAAAGGAATAATGCAGG + Intergenic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1051092821 9:13430213-13430235 AGGAGCAAAATCAAGGAGGGAGG - Intergenic
1051234827 9:14988596-14988618 AGAAGTAAAGAGTAGGATGGTGG + Intergenic
1051851029 9:21508272-21508294 AGGAGTGAAAGGAAAAACGGAGG + Intergenic
1052218677 9:25995613-25995635 AGGGGAAGAAGGAGGGATGGGGG - Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1052916336 9:33926732-33926754 AGGAGTCAAAACAAGGTTGGGGG + Intronic
1053508028 9:38661514-38661536 AGGGAGAAAAGGAAGGATGAAGG + Intergenic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055232917 9:74086934-74086956 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055725696 9:79226018-79226040 AGGAATGAAGGGAAGGAGGGAGG - Intergenic
1055809908 9:80138687-80138709 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1056040522 9:82660705-82660727 AGGAGGAGGAGGAAGGAGGGGGG + Intergenic
1056061020 9:82885050-82885072 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056120116 9:83479381-83479403 AGGAGAAAAAGGAAGAAAGGAGG + Intronic
1056545143 9:87606773-87606795 AGGAGAAAAAGGAGGGAGGGAGG - Intronic
1056774013 9:89498281-89498303 GGGAGGAAAAGAAAGGTTGGGGG - Intergenic
1056882834 9:90413842-90413864 GGGAGTAGAAGGACGAATGGAGG - Intergenic
1057094755 9:92295592-92295614 AGGAGAAAAAGGGAAGAGGGGGG + Intergenic
1057112251 9:92484275-92484297 AGGAGTAAGAGGAGGGATTCTGG - Intronic
1057234698 9:93348872-93348894 GGGAGTAGAAGGACGAATGGAGG - Intergenic
1057690064 9:97276121-97276143 AGGAAGAAATGGAAGGAGGGAGG - Intergenic
1057943260 9:99303302-99303324 GGGAGGAGCAGGAAGGATGGGGG + Intergenic
1058269307 9:102950063-102950085 AGGAGGAAAGGGAATGTTGGTGG - Intergenic
1059474734 9:114536242-114536264 AGGAGAGAAAGGAGGGAAGGAGG + Intergenic
1059650991 9:116315719-116315741 AGGAGTAAGAGGAAGAAAGATGG + Intronic
1059716767 9:116920420-116920442 AGAAATAAAATGAAGAATGGGGG + Intronic
1059929899 9:119250095-119250117 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1060164782 9:121402446-121402468 AGGAATACAAGTAATGATGGAGG + Intergenic
1060225997 9:121791235-121791257 AGGAGAAGAAGGAGGAATGGAGG - Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061234586 9:129335029-129335051 GGGAGTTAATGGCAGGATGGAGG - Intergenic
1061777937 9:132978181-132978203 AGGAGGAGAAGGAGGGAGGGAGG + Intronic
1062098018 9:134712617-134712639 AGGGGGAACAGGAAGGAAGGGGG - Intronic
1062213220 9:135375759-135375781 AGGATTAAAAGGACCGATGCAGG - Intergenic
1062484454 9:136768109-136768131 AGCAGTAAAAGGAACGAAGGTGG + Intergenic
1062670276 9:137704804-137704826 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1203742657 Un_GL000218v1:16170-16192 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1203702856 Un_KI270742v1:10751-10773 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1203567442 Un_KI270744v1:103259-103281 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1203581748 Un_KI270746v1:13153-13175 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185543724 X:925204-925226 ATGAATAGATGGAAGGATGGTGG + Intergenic
1185759845 X:2682038-2682060 AGGAATGGATGGAAGGATGGTGG + Intergenic
1185820211 X:3195879-3195901 GAGAGTTAAAGGAAGGAAGGAGG + Intergenic
1185820238 X:3195991-3196013 AGGAAGAAAAGAAAGGAAGGAGG + Intergenic
1186107102 X:6219414-6219436 AAGAGAAAAAGGAAGGAGAGAGG - Intronic
1186198876 X:7136568-7136590 AAGAGTAAAAGGGTGGCTGGGGG - Intronic
1186239985 X:7555389-7555411 AGGAAGGAAAGGAAGGAGGGAGG + Intergenic
1186652464 X:11575671-11575693 GGGATTAAAAGGAAAGAGGGTGG + Intronic
1186723706 X:12334304-12334326 AGAAAGAAAAGGAAGGCTGGGGG - Intronic
1186908025 X:14132201-14132223 AAGAGGAAAAGGCAGGTTGGGGG + Intergenic
1187264404 X:17718322-17718344 AGGAAGGAAAGGAAGGAGGGAGG + Intronic
1187680905 X:21767128-21767150 AGGAGGAACAGGGAGAATGGAGG + Intergenic
1188552505 X:31378781-31378803 GGGAGAAAAAGGAGGAATGGAGG - Intronic
1188801654 X:34538994-34539016 AGGAGGACAAGGAAGGAGGGAGG + Intergenic
1188997344 X:36902062-36902084 TGGAGCAAGAGGAATGATGGAGG + Intergenic
1189369123 X:40413907-40413929 AGGAGTAAATGGAACGTTGTGGG - Intergenic
1189571414 X:42301921-42301943 AGGAGAAAGAGGGAGGAGGGAGG - Intergenic
1189932768 X:46032678-46032700 ATGAGCAAAGGGAAAGATGGGGG + Intergenic
1190047520 X:47124624-47124646 AGGAAGGAAAGGAAGGAAGGAGG + Intergenic
1190123415 X:47682757-47682779 AGGAAGAAGAGGAAGGAAGGAGG - Intergenic
1190496645 X:51033409-51033431 AGGAGTCTGAGGGAGGATGGAGG - Intergenic
1190509327 X:51160528-51160550 AGGAGTCTGAGGGAGGATGGAGG + Intergenic
1190713218 X:53083901-53083923 AGGAGTTAAATGAAGGAAAGGGG + Intronic
1191735646 X:64385557-64385579 AGGCTTTAAAGGAAGAATGGTGG + Intronic
1191904886 X:66077211-66077233 AGGAGGGAAGGGAAGGAGGGAGG - Intergenic
1191967362 X:66774527-66774549 AGGAAGAAAAGGAAGGAGGGAGG - Intergenic
1192190241 X:68986865-68986887 AGCAGCAAAATGGAGGATGGGGG - Intergenic
1192364178 X:70457249-70457271 AGGAGCAACAGGAAGGATACTGG + Intronic
1192593999 X:72387352-72387374 AGGAGGAAAGGGAAAGATGGAGG + Intronic
1192780948 X:74293334-74293356 AGGAGGTAAAGGAACGATGTAGG - Intergenic
1192818162 X:74615522-74615544 AGGAGAAAAATCAAGGAAGGGGG + Intergenic
1192940812 X:75909876-75909898 AGGAGAAAGAGGTAGGCTGGGGG - Intergenic
1193103023 X:77637015-77637037 AGGAGGAAGAAGAAGGAAGGAGG + Intronic
1194198806 X:90930325-90930347 AGGAATAGAAGGTAGGATGATGG - Intergenic
1194308678 X:92277473-92277495 GGGAGTAGAAGGAGGAATGGAGG + Intronic
1194375573 X:93128735-93128757 AGGAGTGAAGGGAAGGAGAGGGG - Intergenic
1194802094 X:98286401-98286423 AGAATTACAAGAAAGGATGGAGG + Intergenic
1194822906 X:98528699-98528721 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1194839088 X:98716116-98716138 AGGAGCAGAAGGCAGAATGGGGG - Intergenic
1194865696 X:99063162-99063184 AGTAGAGAAAGGAAGGGTGGGGG + Intergenic
1195117979 X:101718802-101718824 AGGTGCAAAAGGAAAGAGGGAGG - Intergenic
1195457892 X:105090036-105090058 GGGAGGAAAAGAAAGGAAGGAGG + Intronic
1195557210 X:106240839-106240861 AGGTGAAGAAGGAAGGAGGGAGG + Intergenic
1195726504 X:107923064-107923086 ACTAGTAAAAGAAACGATGGAGG - Intronic
1196072939 X:111545185-111545207 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1196165404 X:112531883-112531905 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1196330679 X:114468031-114468053 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1196341862 X:114605744-114605766 GGGAGTAGAAGGAGGAATGGAGG + Intronic
1196514215 X:116550485-116550507 AGGAGAAAAAGCATGGAAGGAGG - Intergenic
1197064769 X:122223306-122223328 GGGAGTAGAAGGAGGAATGGAGG - Intergenic
1197072387 X:122314539-122314561 AGGAGAAAATGGAATTATGGGGG + Intergenic
1197352203 X:125393293-125393315 GGGAGTAGAAGGAGGAATGGAGG + Intergenic
1197582089 X:128295660-128295682 AGGAGAGAAAGGAAGGAAGAAGG + Intergenic
1198311812 X:135432486-135432508 AGAAGGAAGAGGAAGGATGAAGG - Intergenic
1198598312 X:138260053-138260075 GGGAGAAGAAGGAAGAATGGAGG - Intergenic
1198728970 X:139707088-139707110 AGATGAAAAAAGAAGGATGGAGG + Intronic
1198770311 X:140123861-140123883 AGAGGCAAAAGGAAAGATGGTGG - Intergenic
1199231998 X:145446631-145446653 AGGGGTAAAAGGAAGTATTCTGG + Intergenic
1199613322 X:149635537-149635559 AGGAGAAAAAGGAATCATGTGGG - Intergenic
1199856517 X:151763291-151763313 AGAAAGAAAAGGAAGGAGGGAGG - Intergenic
1200080978 X:153576223-153576245 AGAAGGGACAGGAAGGATGGAGG + Intronic
1200420929 Y:2966777-2966799 AGGAGAAAAGGGAGGGAGGGAGG - Intronic
1200544803 Y:4506747-4506769 AGGAATAGAAGGTAGGATGATGG - Intergenic
1201156190 Y:11133642-11133664 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201452656 Y:14133159-14133181 AGGAGGCTAAGGAAGGATGTAGG + Intergenic
1201473639 Y:14358896-14358918 AGGAGAAGAAGGAGGAATGGAGG + Intergenic
1201651905 Y:16297671-16297693 AGGATCAAAATAAAGGATGGAGG + Intergenic