ID: 1142768920

View in Genome Browser
Species Human (GRCh38)
Location 17:2082621-2082643
Sequence GAATGTGCCACCAGCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142768920 Original CRISPR GAATGTGCCACCAGCCTGGC AGG (reversed) Intronic
900018402 1:170413-170435 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900048658 1:529008-529030 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900070887 1:770832-770854 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900379455 1:2376641-2376663 GTATGTGGCACGAGCCTGCCTGG + Intronic
901228425 1:7628537-7628559 GCATGTGCCACCATCCCTGCTGG - Intronic
902135368 1:14300439-14300461 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
902359736 1:15935891-15935913 GAAGGTGCCACCAGCCAGCAAGG + Exonic
904006950 1:27368036-27368058 GCATGAGCCACCGCCCTGGCTGG - Intergenic
904567999 1:31439538-31439560 GAATTTCCCACCAGCATGGTGGG + Intergenic
904852086 1:33467028-33467050 AAATGGGCAACCATCCTGGCAGG - Intergenic
906318682 1:44803805-44803827 CTGTGTGTCACCAGCCTGGCGGG + Intronic
906393446 1:45439810-45439832 GCATGTACCACCAGCATGCCTGG - Intronic
906412862 1:45593250-45593272 ACATGAGCCACCTGCCTGGCCGG - Intronic
910798050 1:91118429-91118451 GAGTGTGCCACCACCATGCCTGG + Intergenic
911635247 1:100228053-100228075 GAGTTTGAGACCAGCCTGGCTGG - Intronic
912852101 1:113135739-113135761 GAAAATCCTACCAGCCTGGCTGG - Intergenic
914723269 1:150306773-150306795 GTGTGAGCCACCAGCCTGACAGG + Intronic
914859439 1:151373998-151374020 CATTGTGCCATCAGCCTGCCAGG + Intergenic
916139519 1:161682364-161682386 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
916548944 1:165831257-165831279 GTATGTGCCACCAGCTTCTCAGG + Intronic
916775600 1:167960507-167960529 GAGTTTGAGACCAGCCTGGCTGG - Intronic
917242128 1:172959897-172959919 GATTGTGCCCCCATCCAGGCTGG - Intergenic
917565805 1:176210391-176210413 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
918181877 1:182091269-182091291 GAAAGTGGAACCAGGCTGGCTGG - Intergenic
919803147 1:201365470-201365492 GGATGGGCACCCAGCCTGGCTGG + Intronic
921121948 1:212144919-212144941 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
921284703 1:213598773-213598795 GCATGTGCCACCATCATGCCTGG - Intergenic
922106253 1:222516278-222516300 CAATGTCCCACCAGGTTGGCAGG + Intergenic
924348433 1:243093843-243093865 CAATGTCCCACCAGGTTGGCAGG + Intergenic
924904865 1:248441608-248441630 GATTGTGGCGGCAGCCTGGCTGG + Exonic
924923022 1:248650434-248650456 GATTGTGGCGGCAGCCTGGCTGG - Exonic
1063553121 10:7052066-7052088 CAATCTGCTACCAGCATGGCTGG - Intergenic
1064135026 10:12743135-12743157 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1065916878 10:30360153-30360175 GAATGTCCCAACAGCCCAGCTGG + Intronic
1066402916 10:35092339-35092361 GACAGTGCCACCAACCTGTCCGG + Intergenic
1066727927 10:38411058-38411080 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1068999347 10:63245761-63245783 GCGTGAGCCACCAGCCCGGCCGG + Intronic
1069361670 10:67650117-67650139 GCGTGAGCCACCACCCTGGCCGG + Intronic
1072513842 10:96156966-96156988 AAATGTGCCAACATCCTGGGTGG - Exonic
1073256431 10:102154732-102154754 GAATTTGAGACCAGCCTGGCTGG - Intronic
1073437272 10:103526788-103526810 GCATGAGCCACCACGCTGGCTGG + Intronic
1075713413 10:124542676-124542698 AAATGGGCCTCCAGCCTGGCTGG - Intronic
1076121912 10:127943387-127943409 GTCTCTGCCACCAGCCTGGAAGG + Intronic
1076709747 10:132325999-132326021 GCATGAGCCACCACGCTGGCCGG + Intronic
1076975005 11:165609-165631 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1077772765 11:5238161-5238183 GCATGTGCCACCACCATGCCTGG - Intergenic
1078790043 11:14533168-14533190 GAATTTCTCACCAGCATGGCAGG - Intronic
1079051834 11:17167473-17167495 GCATGTGCCACTACACTGGCTGG - Intronic
1080025658 11:27611514-27611536 GAATGTGACACAAGACTGGGAGG - Intergenic
1080437818 11:32262422-32262444 GCCTGTGCCACCACCCTGGAGGG - Intergenic
1080795646 11:35560457-35560479 AAATCTGCCACCAGCTTGGTAGG - Intergenic
1082678303 11:56137411-56137433 GAATGTGCCACCCAACTGGGAGG - Exonic
1082695609 11:56360532-56360554 GAATGTGCCACCCAACTGGGAGG + Exonic
1083252793 11:61479008-61479030 GAGTGAGCCTCCACCCTGGCAGG + Intronic
1083458830 11:62797492-62797514 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1083900681 11:65641855-65641877 GAATCTCTCCCCAGCCTGGCAGG - Intronic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1084726855 11:70947496-70947518 GCATGTGCCACCACCATGCCTGG + Intronic
1088588805 11:111383467-111383489 GCATGAGCCACCATGCTGGCTGG - Intronic
1089507547 11:118973901-118973923 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1089547308 11:119238622-119238644 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1090991325 11:131819566-131819588 TGGTGTGCCAACAGCCTGGCAGG - Intronic
1091154093 11:133357823-133357845 GAATGTGCTAGTAGCCTGGCAGG - Intronic
1096520799 12:52183524-52183546 GACTGGGCAAACAGCCTGGCTGG - Intronic
1097214446 12:57399194-57399216 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1098320335 12:69237631-69237653 GCATGAGCCACCATGCTGGCTGG + Intergenic
1099100622 12:78435921-78435943 GCATGAGCCACCACACTGGCCGG - Intergenic
1099517186 12:83611450-83611472 ACGTGTGCCACCAGCCTGGCTGG - Intergenic
1101549720 12:105750668-105750690 GTGTGAGCCACCACCCTGGCTGG - Intergenic
1102118161 12:110419419-110419441 GCATGTGCCACCTGCCCGGCTGG + Intergenic
1102688112 12:114739947-114739969 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1103879690 12:124156578-124156600 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1107124902 13:36836569-36836591 GTATGAGCCACCACACTGGCTGG - Intergenic
1108115074 13:47118635-47118657 GAATGAGCCAGCAGCAGGGCAGG + Intergenic
1109863294 13:68227761-68227783 GAATGTGCCACTATGCAGGCTGG + Intergenic
1114338261 14:21715196-21715218 GAGTTTGACACCAGCCTGGTCGG + Intergenic
1115155289 14:30332072-30332094 GAGTTTGAGACCAGCCTGGCCGG - Intergenic
1117491022 14:56248513-56248535 GAAGGAGCCTCCAGGCTGGCAGG + Intronic
1117541845 14:56755128-56755150 GCACGTGCCACCAGAGTGGCAGG + Intergenic
1118185647 14:63535217-63535239 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1118971669 14:70642514-70642536 GACTGTTACAACAGCCTGGCAGG + Exonic
1119342907 14:73895757-73895779 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1121652193 14:95566741-95566763 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1122290727 14:100679014-100679036 GGATGCCCCAGCAGCCTGGCTGG - Intergenic
1122682835 14:103479236-103479258 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1122869750 14:104632835-104632857 GACTGAGCCACCAGACAGGCAGG + Intergenic
1124384738 15:29197379-29197401 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1125985832 15:44050861-44050883 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1128372726 15:67052199-67052221 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1128599701 15:68985612-68985634 GGATGTGCCACCAGCATGCAGGG - Intronic
1130348852 15:83072697-83072719 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1130854073 15:87825412-87825434 GACTGTCCCACCAGCCCAGCAGG + Intergenic
1132222101 15:100112693-100112715 GAACGTGCCACCTGCATGGCTGG + Intronic
1138128778 16:54460805-54460827 GCATGTGTGTCCAGCCTGGCTGG + Intergenic
1139460338 16:67117254-67117276 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1139846447 16:69924833-69924855 GAATGTGCCCTCAGTCTGGGTGG + Intronic
1139851292 16:69952661-69952683 GAATTCCCCACCAGCCCGGCTGG + Intronic
1140756101 16:78068299-78068321 GAATGCACTACCAGCATGGCTGG + Intergenic
1142136579 16:88454362-88454384 GGAGGTGTCACCAGGCTGGCGGG - Intronic
1142445258 16:90132050-90132072 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1142462251 17:103416-103438 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1142768920 17:2082621-2082643 GAATGTGCCACCAGCCTGGCAGG - Intronic
1142978964 17:3660564-3660586 GACGGTGCCACGTGCCTGGCCGG - Intronic
1144088197 17:11829676-11829698 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1144812887 17:18012032-18012054 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1144947464 17:18977265-18977287 GACTGTGCCACCCATCTGGCAGG + Intronic
1145207048 17:20990140-20990162 GAAAGGTCCACCACCCTGGCTGG + Intergenic
1146288850 17:31594003-31594025 GAATGTGGAGCCAGCCTGCCCGG - Intergenic
1147702363 17:42404126-42404148 GAATGAGCCCTCACCCTGGCTGG - Exonic
1147913134 17:43869724-43869746 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1148070038 17:44903433-44903455 GACTTTTCCACCAGGCTGGCAGG + Exonic
1148078526 17:44954250-44954272 GAATTTGAGACCAGCCTGGGTGG - Intergenic
1148255477 17:46127630-46127652 GAGTGTGCCACCACCATGCCTGG - Intronic
1148767368 17:50047081-50047103 GCAGGTGCCACGGGCCTGGCTGG + Intergenic
1149206584 17:54254591-54254613 GAGTTTGGGACCAGCCTGGCCGG - Intergenic
1149850767 17:60032317-60032339 GAATGGGCCACCAGCCAAGGAGG - Intergenic
1149859399 17:60114207-60114229 GAATGGGCCACCAGCCAAGGAGG + Intergenic
1150153267 17:62828824-62828846 GAATGAGCCACCATCGTGCCTGG - Intergenic
1151245350 17:72790226-72790248 GGATGACCCCCCAGCCTGGCTGG - Intronic
1152192817 17:78898941-78898963 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1152400889 17:80065536-80065558 CAATGGGCCAGCAGCCTGGTGGG + Exonic
1152698036 17:81806010-81806032 GAAGGTGACACCAGCCTGAAGGG - Intronic
1153726006 18:7955781-7955803 TAATGTGCCAGCAGCCTGGAGGG + Intronic
1156250812 18:35351071-35351093 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1157187012 18:45549328-45549350 AGATGTGCTACCAGCATGGCAGG + Intronic
1157564506 18:48670723-48670745 GAAGGTCCTTCCAGCCTGGCAGG + Exonic
1159042549 18:63338392-63338414 GAAAGTGCCACCAGCCCCGTGGG - Intronic
1160547018 18:79664788-79664810 GCATGAGCCACTGGCCTGGCCGG + Intergenic
1160651957 19:235792-235814 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1162486695 19:10964915-10964937 GAAAGTTCCACCAGACTGGCTGG - Intronic
1162974986 19:14203449-14203471 TGCTCTGCCACCAGCCTGGCAGG + Intronic
1163229058 19:15987581-15987603 GCATGTGCCACCACCATGCCCGG - Intergenic
1164682511 19:30145118-30145140 GGGGGTGCCACCACCCTGGCTGG + Intergenic
1165643222 19:37408018-37408040 GCATGAGCTACCGGCCTGGCAGG - Intergenic
1166165385 19:40984195-40984217 GCATGTGCCACCAGCAGGCCTGG + Intergenic
1166726328 19:45030190-45030212 GCATGAGCCACCAGCCCAGCCGG - Intronic
1166788828 19:45385561-45385583 GACTGCGCCACCTACCTGGCAGG - Exonic
1167211744 19:48137852-48137874 GAACGTGCCCCCAGCCACGCTGG + Intronic
1167377713 19:49120352-49120374 GACGGGGCCACGAGCCTGGCCGG - Intronic
925173422 2:1766701-1766723 GAATGCGCCTCCAGCCTGTCTGG + Intergenic
927778620 2:25921587-25921609 GCATGAGCCACACGCCTGGCTGG - Intergenic
928016512 2:27663066-27663088 GCATGAGCCACCGGTCTGGCTGG + Intronic
931184650 2:59938249-59938271 GACTGTGCTACATGCCTGGCTGG - Intergenic
931734313 2:65180162-65180184 GAGTTTGAGACCAGCCTGGCAGG - Intergenic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
932697604 2:73969804-73969826 GCATGTGCCACCACCATGCCTGG + Intergenic
933506248 2:83180845-83180867 GCATGTGCCACCAGGCTGAGAGG + Intergenic
934664108 2:96158118-96158140 GAATGAGCCACCATCCGGGAAGG + Intergenic
934674234 2:96238362-96238384 GCAGGAGCCACCATCCTGGCAGG + Intergenic
936936814 2:117846826-117846848 TAATGTGCCAACAGCCGGGAGGG + Intergenic
937157501 2:119731430-119731452 GCATGAGCCACGCGCCTGGCTGG - Intergenic
942848428 2:180454179-180454201 GCGTGAGCCACCAGCCTGCCCGG + Intergenic
943169946 2:184385773-184385795 GACTGAGACACCAGCCTGGCTGG + Intergenic
944055796 2:195520742-195520764 GAATGTTCCACCAGCGGGGGTGG - Intergenic
944660403 2:201916875-201916897 GCGTGAGCCACCAGCCTGGCCGG - Intergenic
944725489 2:202467115-202467137 GCATGTGCCACCACCATGCCCGG - Intronic
946299472 2:218813899-218813921 GAATTTGCCACTAGCCTAGCAGG - Intronic
947361537 2:229350315-229350337 GAATTGGAGACCAGCCTGGCCGG + Intergenic
947587989 2:231368828-231368850 GAGTTCGCGACCAGCCTGGCCGG - Intronic
947734244 2:232446587-232446609 GAATCTCCCTCCAGCCAGGCAGG + Intergenic
1169056699 20:2627960-2627982 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1169182408 20:3581104-3581126 GTATGTGCCACCATCATGCCCGG - Intronic
1169264933 20:4161938-4161960 GAACGTGCCCCCCGCCTGCCCGG + Intronic
1170197047 20:13699963-13699985 GCATGTGCCACCACCATGCCTGG + Intergenic
1172232935 20:33349239-33349261 AAATGTGCCAGCTGCCTGGCAGG + Intergenic
1172803720 20:37596577-37596599 GCGTGAGCCACCAGCCTAGCCGG - Intergenic
1172838578 20:37888424-37888446 GAAGGTGGCACCAGGCTGGGAGG - Intergenic
1173089882 20:39960427-39960449 GAATGTGCCATCAGCCCAACAGG + Intergenic
1173849262 20:46207523-46207545 GACTATGCCACCAGCCCGGGTGG + Intronic
1177239906 21:18443339-18443361 GAAGCTGGCACCAGCCTGTCTGG + Intronic
1181557992 22:23683154-23683176 GAATGTTCCAGCAACCTGGATGG + Intergenic
1181966857 22:26662621-26662643 AAATGTGCCACGCGCCTCGCAGG - Intergenic
1183344191 22:37298086-37298108 GCATGAGCCCCGAGCCTGGCCGG - Intronic
1184179461 22:42810260-42810282 GAGTTTGAGACCAGCCTGGCTGG + Intronic
952920197 3:38278612-38278634 GAATTTGAGACCAGCCTGGCTGG + Intergenic
954111041 3:48433296-48433318 GAAGGTAGCACCAACCTGGCTGG + Intronic
954265029 3:49465219-49465241 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
957125654 3:76156824-76156846 GCATGTGCCACCACCATGCCAGG - Intronic
957281376 3:78155054-78155076 GAATTTGCCACAATCCAGGCTGG - Intergenic
958999679 3:100948629-100948651 AAATGTGCCACCAGCCTGGGAGG - Intronic
960983721 3:123257037-123257059 GCATGAGCCACCGCCCTGGCTGG + Intronic
961265688 3:125640456-125640478 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
962198904 3:133385443-133385465 GTCTGACCCACCAGCCTGGCAGG - Intronic
962588915 3:136869030-136869052 GAGTTTGAGACCAGCCTGGCCGG + Intronic
963156306 3:142100749-142100771 CCATGTTCCACCATCCTGGCTGG + Intronic
965687381 3:171318882-171318904 GTATGAGCCACCATGCTGGCCGG - Intronic
965822823 3:172701669-172701691 GAGTTTGAGACCAGCCTGGCCGG - Intronic
967030474 3:185601682-185601704 GACTGTGCCACCAAACTGCCTGG - Intronic
967292049 3:187930944-187930966 TCTTGTGCCACCTGCCTGGCTGG + Intergenic
967882592 3:194312555-194312577 GAAGTTGGCACCAGCCTGACGGG + Intergenic
968365873 3:198184180-198184202 CAATGTCCCACCAGGTTGGCAGG - Intergenic
968705460 4:2075505-2075527 ATCTGGGCCACCAGCCTGGCAGG + Exonic
968705481 4:2075565-2075587 GCGTGGGCCACCAGCCTGGCAGG + Intronic
970551229 4:17183152-17183174 TAAAGTGCCAGCAGCCTGGCTGG - Intergenic
970847285 4:20555353-20555375 GAATTTGGCTCCAGCCAGGCTGG - Intronic
971409451 4:26354728-26354750 GCATGAGCCACATGCCTGGCCGG + Intronic
971529274 4:27663925-27663947 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
971883814 4:32415648-32415670 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
976021646 4:80636193-80636215 GAAAGTGACACCTGCCTAGCTGG + Intronic
976503961 4:85824807-85824829 GCATGAGCTACCAACCTGGCCGG - Intronic
978289535 4:107120769-107120791 GAATGTGCTGACAGCCTGGCTGG + Intronic
978841544 4:113219999-113220021 GAATGAGCCACCAGATGGGCAGG - Intronic
979254911 4:118599338-118599360 CAATGTCCCACCAGGTTGGCAGG - Intergenic
979334057 4:119446681-119446703 CAATGTCCCACCAGGTTGGCAGG + Intergenic
981853880 4:149263768-149263790 GAAAGTGGCACCAGCATGGGTGG - Intergenic
982364726 4:154564537-154564559 AAATCTGGAACCAGCCTGGCTGG + Intronic
982370180 4:154625673-154625695 GAATGATCCACCAGGCTGTCGGG + Intergenic
982373000 4:154654964-154654986 TCATGTGGCACCAGACTGGCAGG + Intronic
983493194 4:168412611-168412633 GAAAAGGACACCAGCCTGGCTGG + Intronic
983494667 4:168429353-168429375 GAGTTCGACACCAGCCTGGCTGG - Intronic
984607963 4:181806513-181806535 GAATGCGCCACCTTCCTGGGTGG + Intergenic
984719615 4:182957562-182957584 GCATGTGCCCCTTGCCTGGCTGG + Intergenic
986085280 5:4438611-4438633 GAATTTGAGACCAGCCTGGCTGG + Intergenic
990318682 5:54608799-54608821 GAATTTCCCACCAGCCTAGGAGG - Intergenic
990438195 5:55815915-55815937 GCATGTGCCACCATCTTAGCTGG + Intronic
992632176 5:78692192-78692214 GAGTTTGAGACCAGCCTGGCTGG + Intronic
992822241 5:80509117-80509139 GCGTGTGCCACCAGCATGCCTGG + Intronic
993229240 5:85210680-85210702 GTATGTCCGACAAGCCTGGCAGG - Intergenic
994116082 5:96062646-96062668 GAAGGGGTCACCATCCTGGCAGG + Intergenic
994990680 5:106992688-106992710 TAATGTGCCATCAGTCAGGCAGG - Intergenic
997313680 5:132913720-132913742 GCGTGTGCCACCACACTGGCTGG + Intronic
997324485 5:133008657-133008679 GAATTTGAGACCAGCCAGGCAGG + Intronic
997474312 5:134133837-134133859 GAATGAGCCCACAGCCTGCCAGG + Intronic
998969896 5:147579658-147579680 GAGTGTGCCACCACCATGCCCGG - Intergenic
999120224 5:149203963-149203985 GAATGTGAGACCAGCCAGTCTGG + Intronic
1000452756 5:161410708-161410730 GAATATGCTAACAGCCTGGAAGG - Intronic
1002569077 5:180129856-180129878 GGAAGTGCCATCAGACTGGCTGG - Intronic
1002572005 5:180145264-180145286 GCATGTGCCACCACCGTGTCCGG + Intronic
1002689477 5:181040425-181040447 GAATGAGCCACTTACCTGGCAGG - Exonic
1002725099 5:181289404-181289426 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1002924060 6:1594758-1594780 GGAGGAGCCCCCAGCCTGGCAGG + Intergenic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003110980 6:3252085-3252107 GAAGCTGCCGCCAGCCTGCCTGG + Intronic
1004938356 6:20529996-20530018 GCATGAGCCACCAGCCCAGCTGG - Intergenic
1005155657 6:22803151-22803173 GAATTTTCCACCAGTCTGGATGG + Intergenic
1005804290 6:29459726-29459748 GGATGCGGCACCACCCTGGCAGG - Intronic
1006079974 6:31559435-31559457 GATGGAGCCAGCAGCCTGGCTGG - Intergenic
1006881167 6:37341241-37341263 GCGTGAGCCACCAGCCCGGCTGG + Intergenic
1007234392 6:40379829-40379851 GTATGTGGGACTAGCCTGGCTGG - Intergenic
1008603099 6:53114907-53114929 CAAAGTGCCTCCAGCCTAGCAGG + Intergenic
1008709257 6:54203789-54203811 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1009474078 6:64066054-64066076 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1015978490 6:138815432-138815454 GTACCTGCTACCAGCCTGGCTGG - Intronic
1019811829 7:3170626-3170648 AAGCGTGCCACCTGCCTGGCCGG + Intronic
1021732884 7:23613603-23613625 GGATGTGACAACAGCCTGGGGGG - Intronic
1021834013 7:24648949-24648971 GTATGTGCTACCAGCATGGGTGG - Intronic
1022002508 7:26239388-26239410 GCATGAGCCACCAGCGTGGCCGG - Intergenic
1022299217 7:29087143-29087165 GCATGAGCCACCGCCCTGGCCGG - Intronic
1022794840 7:33723969-33723991 GAATTTCCTACCATCCTGGCAGG - Intergenic
1024069999 7:45777015-45777037 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1024559769 7:50632954-50632976 CACTCTGCCACCACCCTGGCTGG - Intronic
1025005749 7:55353322-55353344 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1025900353 7:65739341-65739363 GAATTTGAGACCAGCCTGGGTGG + Intergenic
1025990315 7:66492425-66492447 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1026038434 7:66846169-66846191 CAATGTGCCACCAGGTTGGCAGG - Intergenic
1026676646 7:72433913-72433935 GTGTGTGCCACCACCCTGCCTGG - Intronic
1029198784 7:98825007-98825029 GCATGTGCCACCACCATGCCTGG + Intergenic
1030188834 7:106790780-106790802 CAATGTGCCAAGAGCCGGGCAGG + Intergenic
1032047397 7:128621303-128621325 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1035446633 7:158947697-158947719 GAGTGAGCCCCCAGCCAGGCAGG - Intronic
1036085523 8:5609051-5609073 GCATATTCCACCAGCCTGGTTGG + Intergenic
1036550741 8:9813273-9813295 GCATGTGCCACCAACATGCCTGG + Intergenic
1037945821 8:22988729-22988751 GGAAGTGACAGCAGCCTGGCTGG - Intronic
1039547716 8:38421662-38421684 GGATGTGGCACCAGGCAGGCAGG + Intronic
1040372829 8:46794365-46794387 GAATGTGCCCCTAGCCTACCCGG + Intergenic
1045047637 8:98294292-98294314 GTAGGTGCTCCCAGCCTGGCCGG + Exonic
1045106781 8:98900284-98900306 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1047410897 8:124623847-124623869 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1047574270 8:126135778-126135800 GAAAATGCCAACAGCCTGGCCGG + Intergenic
1047700280 8:127442727-127442749 TAATGTTCCACCACCCTGACTGG + Intergenic
1048821675 8:138385938-138385960 GCATGAGCCACGTGCCTGGCTGG - Intronic
1049008793 8:139873877-139873899 GAATGTGGCACCATGGTGGCTGG - Intronic
1051012792 9:12439004-12439026 ACATGTGCTACCAGCCTGCCAGG - Intergenic
1051724219 9:20072028-20072050 GGGTGTGCCACCCTCCTGGCAGG + Intergenic
1053479858 9:38408206-38408228 GAATTTGAGACCAGCCTGGGCGG + Intergenic
1057440385 9:95078758-95078780 AAATGTGCCACCAAACTGCCAGG - Intronic
1058711978 9:107687016-107687038 GCATGTGCCACCACCATGTCCGG + Intergenic
1059423653 9:114207538-114207560 TGAGATGCCACCAGCCTGGCAGG - Intronic
1059643088 9:116236302-116236324 GAGTGAGCCACCTCCCTGGCCGG - Intronic
1060250994 9:121986668-121986690 AAAGGTGCCGCCAGCCTGCCTGG + Intronic
1060438956 9:123620284-123620306 GAATGTGCCAAGAGCCTTGTAGG - Intronic
1060841388 9:126795909-126795931 AAAAGTGCCACCAGTCTGGATGG + Intergenic
1061430534 9:130527697-130527719 GACTGCCCCACCAGACTGGCTGG - Intergenic
1062163213 9:135091202-135091224 GAATGTGCCAAAAGGCTGGTGGG - Intronic
1062750243 9:138247047-138247069 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1186037732 X:5443109-5443131 GCATGTGCCACCACCATGCCTGG + Intergenic
1187175841 X:16895654-16895676 GAATTCGAGACCAGCCTGGCTGG + Intergenic
1187288068 X:17925338-17925360 GAATTTCCCACCAGCTTAGCAGG - Intergenic
1192443542 X:71193100-71193122 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1193116689 X:77782541-77782563 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1193549338 X:82871465-82871487 GAAGGTGCCACAATCCAGGCTGG + Intergenic
1193716043 X:84935502-84935524 GAGTGAGCCACGACCCTGGCTGG + Intergenic
1194023949 X:88727550-88727572 GAATGTGCAAGCAGCTTTGCAGG - Intergenic
1195119091 X:101731904-101731926 CAGTGAGCCACCAACCTGGCTGG - Intergenic
1195551403 X:106175534-106175556 GAATATAACACCAGCGTGGCCGG - Intronic
1196615831 X:117766328-117766350 GAATTTGAGACCAGCCTGACTGG - Intergenic
1197012764 X:121587286-121587308 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1197329369 X:125134516-125134538 GTTTGTGCCTCCAGCATGGCTGG + Intergenic
1197620769 X:128745047-128745069 GAATGGGACAGCAGCCTGACTGG + Intergenic
1197769076 X:130078324-130078346 GTGTGAGCCACCAGCCTGACCGG + Intronic
1201633573 Y:16097056-16097078 GCATGTACCACCACCATGGCTGG - Intergenic