ID: 1142769309

View in Genome Browser
Species Human (GRCh38)
Location 17:2085258-2085280
Sequence CAGGAGGGAGGGAGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7921
Summary {0: 1, 1: 3, 2: 96, 3: 1095, 4: 6726}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142769301_1142769309 -2 Left 1142769301 17:2085237-2085259 CCTTAATCACATCAGGATGTGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG 0: 1
1: 3
2: 96
3: 1095
4: 6726
1142769299_1142769309 26 Left 1142769299 17:2085209-2085231 CCAAGGGCAAACAAACAAGAGGA 0: 1
1: 0
2: 0
3: 30
4: 331
Right 1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG 0: 1
1: 3
2: 96
3: 1095
4: 6726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142769309 Original CRISPR CAGGAGGGAGGGAGGGAACA AGG Intronic
Too many off-targets to display for this crispr