ID: 1142786872

View in Genome Browser
Species Human (GRCh38)
Location 17:2231364-2231386
Sequence CCTGAATTACAGAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142786872_1142786880 21 Left 1142786872 17:2231364-2231386 CCCTCTACCTTCTGTAATTCAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1142786880 17:2231408-2231430 AAGCATAAGGCTGGGTGCAGTGG 0: 1
1: 10
2: 171
3: 1403
4: 6239
1142786872_1142786878 12 Left 1142786872 17:2231364-2231386 CCCTCTACCTTCTGTAATTCAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1142786878 17:2231399-2231421 ATTCAAAGCAAGCATAAGGCTGG 0: 1
1: 0
2: 3
3: 53
4: 344
1142786872_1142786879 13 Left 1142786872 17:2231364-2231386 CCCTCTACCTTCTGTAATTCAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1142786879 17:2231400-2231422 TTCAAAGCAAGCATAAGGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 265
1142786872_1142786876 8 Left 1142786872 17:2231364-2231386 CCCTCTACCTTCTGTAATTCAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1142786876 17:2231395-2231417 CACCATTCAAAGCAAGCATAAGG 0: 1
1: 0
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142786872 Original CRISPR CCTGAATTACAGAAGGTAGA GGG (reversed) Intronic
900172535 1:1276105-1276127 CCTGAATTTCAAAAGGGAGGAGG + Intergenic
900173197 1:1280638-1280660 CCTGAATTCCAGCAGGGAGGAGG + Exonic
900729316 1:4243162-4243184 CCTTAATAAAAGAAGCTAGAAGG + Intergenic
901097204 1:6691557-6691579 CACGAATGACAGAAGGTATAAGG - Intronic
902738457 1:18417185-18417207 CCTGAATTTCAAAAGGGAGAGGG + Intergenic
903067687 1:20709927-20709949 CCTGCATTACAGGAGGGCGAGGG - Intronic
903840673 1:26237044-26237066 CCTAAATTCCAGAAGGGAGGAGG + Intronic
904712145 1:32438266-32438288 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
905341902 1:37283991-37284013 CCTGATTTCCAGAAGGGAAAAGG - Intergenic
906867512 1:49438657-49438679 CCCTAATTACAGAAGAGAGATGG + Intronic
907275664 1:53315321-53315343 CCTGAAGGACAGATGGGAGAGGG + Intronic
910508708 1:87979464-87979486 CCCCAATTACAGAATGTGGATGG - Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911516432 1:98873594-98873616 CCTGAATTCCAAAAGGGAGGTGG - Intergenic
913029320 1:114882941-114882963 CAAAGATTACAGAAGGTAGAGGG - Intronic
916440489 1:164820027-164820049 CCTGAATCACAGAAAGGAAAAGG - Intronic
916460045 1:165014506-165014528 CCCCAATAACAAAAGGTAGATGG - Intergenic
916801351 1:168219588-168219610 CCTGAATTCCAAAAGGCAGGAGG + Intergenic
917530766 1:175833059-175833081 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
918691156 1:187480878-187480900 CAGGAACTACAGAAGGCAGAAGG - Intergenic
919503562 1:198369029-198369051 CCTGAATTCCATAAGGAAGGAGG - Intergenic
919993767 1:202728995-202729017 CCTGAATTACATTAAGTAGGGGG + Exonic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
922337386 1:224628785-224628807 CCTGAATTCCAAAAGGGAGGAGG - Intronic
922494059 1:226042135-226042157 CCTGAAGTACAGAAAGCAGAGGG - Intergenic
923198323 1:231688940-231688962 TCTGAATTATTGAAGGAAGATGG + Intronic
1063258947 10:4362580-4362602 CGTGAATTTCAAGAGGTAGAAGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1065006694 10:21386992-21387014 CCTGAATTTCAAAAGGGAGGAGG - Intergenic
1065012509 10:21432370-21432392 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1067731429 10:48814442-48814464 CCTGACTTAGAGAAGGCAGATGG + Intronic
1070148385 10:73790881-73790903 CCCAAAATACAGAAGATAGAGGG - Intronic
1070171817 10:73938632-73938654 CCTGAATTCCAAAAGGCAGGAGG - Intergenic
1072588146 10:96800538-96800560 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1074354997 10:112774650-112774672 CCTGATTAACAGAAAGTACATGG + Intronic
1076034708 10:127189423-127189445 GCTGAATGACAGAAGTTAGCAGG - Intronic
1076832496 10:133003317-133003339 CCTGAATTCCAAAAGGGGGAGGG + Intergenic
1076977337 11:184252-184274 CCTGAATTCCAAAAGGGAGGAGG - Intronic
1078385862 11:10892054-10892076 CCTGAATTCCAAAGGGAAGAGGG + Intergenic
1081361605 11:42187040-42187062 CCTGAATTCCAGATGGCACATGG + Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083389771 11:62339350-62339372 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1084025451 11:66445630-66445652 CCTGAATTCCAAAAGGGAGAAGG - Intronic
1084025851 11:66448880-66448902 CCTGAATTCCAAAAGGGAGAAGG - Intronic
1085619610 11:78027956-78027978 CCTGAATTCCAAAAGGGGGAAGG + Intronic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1086949502 11:92877178-92877200 CCTAAATTCCAGCTGGTAGAAGG + Intronic
1088313765 11:108486919-108486941 CCTGAATTCCAAAAGGGAGGAGG - Intronic
1090096960 11:123751910-123751932 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1090185282 11:124735005-124735027 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1091104255 11:132903555-132903577 CCTGAATTCCAAAAGGGAGGAGG - Intronic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097711572 12:62923310-62923332 TGTGAATTACAGAATCTAGATGG + Intronic
1099287245 12:80729395-80729417 ACAAAATTTCAGAAGGTAGATGG - Intergenic
1099308069 12:80982993-80983015 CTTGAATTCCAAAAGGAAGAAGG - Intronic
1100779277 12:98007198-98007220 GGTGGATTACAGAAGGTACACGG + Intergenic
1101505798 12:105345080-105345102 CCTGAATTTCAAAGGGAAGAGGG - Intronic
1101713043 12:107286505-107286527 CCTGAATTCCAAAAGGGAGAAGG - Intergenic
1103919832 12:124393514-124393536 GTTGAATCCCAGAAGGTAGAGGG - Intronic
1104277298 12:127341418-127341440 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1104724558 12:131067771-131067793 TCAGACATACAGAAGGTAGAGGG - Intronic
1105284753 13:18994868-18994890 CCAGAATGTCAGAAGGCAGAAGG + Intergenic
1106114696 13:26807107-26807129 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1106761516 13:32873114-32873136 CCTGAATAACAGAGGCCAGATGG + Intergenic
1107313798 13:39109141-39109163 ATTGAATTACAGAAGGTGCAGGG + Intergenic
1107759204 13:43658691-43658713 TCTAAATTGCAGTAGGTAGAGGG - Intronic
1108248423 13:48540866-48540888 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1108390970 13:49947336-49947358 CCTGAATTCCAAAAAGGAGAAGG - Intergenic
1110455239 13:75684025-75684047 CCTGAATTCCAAAAGGGAGGGGG + Intronic
1111542418 13:89686612-89686634 CTTGTATTACAGAAAGTAAAAGG - Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1112619501 13:101040233-101040255 CCTGAATTCCAAAAGGGAGGTGG + Intergenic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113742724 13:112722540-112722562 CCTGAATTCCAAAAGGAAGGAGG + Intronic
1114237903 14:20838173-20838195 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1114321014 14:21547135-21547157 CCTGGATTTCAGAAGATATATGG - Intergenic
1114940672 14:27606604-27606626 CCTGAACTCCAAAAGGGAGAAGG - Intergenic
1115303460 14:31910895-31910917 CCTGAATTCCAAAAGGGAGAAGG + Intergenic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1116649780 14:47574934-47574956 CCTTAATGATAGAAGATAGAGGG - Intronic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1117857777 14:60053110-60053132 CCTAACTTACAGATGTTAGATGG + Exonic
1117897423 14:60502175-60502197 ACTCAATTTCTGAAGGTAGATGG - Intronic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1120213770 14:81660283-81660305 ACTGAATTCCAGAGGGTAGAAGG + Intergenic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1121377107 14:93422468-93422490 CCTGAATTCCAAAAGGAAGGAGG + Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1126626209 15:50687892-50687914 GCTGAATGAAAGAAGTTAGACGG - Intergenic
1129148452 15:73671009-73671031 CCTGAGAAACAAAAGGTAGATGG - Intergenic
1130691634 15:86086373-86086395 CCTGAAATAAAGAAAGTGGAGGG + Intergenic
1130991992 15:88881069-88881091 TGTGAATTACAGCGGGTAGAGGG + Intronic
1131921452 15:97332899-97332921 CCTGGATTTCAGAGGGTATATGG + Intergenic
1132753880 16:1472704-1472726 TCTGAAGTTCACAAGGTAGAAGG - Intronic
1133559523 16:6937866-6937888 CCTGAATTCCAAAAGGGAGATGG + Intronic
1133716773 16:8457698-8457720 CCTGCATTACAACAGGAAGAGGG + Intergenic
1134142218 16:11730530-11730552 CCTGAATTGCAGCAAGTAAAAGG - Intronic
1138600471 16:58051245-58051267 CCTGAATTCCAAAAGGGAAAAGG + Intergenic
1138633293 16:58316515-58316537 CCTGAATTCCAGAAGGGAGGAGG - Intronic
1139265587 16:65635570-65635592 TCTGAATGACAGAAGGTCAAGGG - Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1141241167 16:82266598-82266620 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1142442915 16:90112430-90112452 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1142464788 17:128962-128984 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143449837 17:7029486-7029508 GCAGAATTAAAGAAGGAAGAAGG + Exonic
1145223362 17:21107303-21107325 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1145362898 17:22226945-22226967 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1146561168 17:33871705-33871727 CCTGAATTACGGGAGGAGGAGGG + Intronic
1149400008 17:56286348-56286370 CCTGAATCACAGAAACTATAAGG - Intronic
1151874368 17:76858245-76858267 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1152320499 17:79606361-79606383 CCTAAATTAAAGATGGTGGATGG + Intergenic
1152823903 17:82451692-82451714 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1153182125 18:2446754-2446776 CCTGAATTCCAAAGGGAAGAGGG + Intergenic
1153572600 18:6488122-6488144 CCTGAATTCCAAAAGGGAGGGGG - Intergenic
1153837566 18:8977680-8977702 CCTGAATTCCAAAGGGAAGAAGG + Intergenic
1155173336 18:23283029-23283051 CCTGAATTCCAAAAGGTAGGGGG - Intronic
1155514057 18:26606265-26606287 CCTGAATTTCAAAAGGGAGGAGG + Intronic
1155873529 18:31056115-31056137 TATGAATTTCAGAAGGCAGAAGG + Intergenic
1156402706 18:36755146-36755168 CCCGAATTGCATAAGGTGGATGG - Exonic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1158004651 18:52658453-52658475 TCTGAATCAAAGAAGGTAAATGG - Intronic
1158020588 18:52836933-52836955 CCTGTATTTCAGAAGATATATGG - Intronic
1158972792 18:62684140-62684162 TCTGAACTCCAGAAGGGAGAGGG - Intergenic
1159712298 18:71776139-71776161 CCAGAATTACAGAAGCTAGATGG - Intronic
1159743643 18:72205518-72205540 CCTGTATTTCAGACAGTAGATGG - Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1161982341 19:7636727-7636749 CCTGAAGTACAGAAGGCAAGTGG + Intronic
1165249773 19:34520580-34520602 CCTGAATTCCAAAAGGGAGATGG + Intergenic
1165692050 19:37871269-37871291 CCTGAATTCCAAAGGGAAGAAGG + Intergenic
1166129394 19:40736974-40736996 CCTGCCCTACAGAAGGCAGATGG + Exonic
1166534935 19:43567223-43567245 TCTGAATTAGAGAATGGAGATGG + Intronic
1167201100 19:48066136-48066158 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1167705918 19:51081176-51081198 CCTGAGTTTCTGAATGTAGACGG + Intronic
927656215 2:24948835-24948857 CCTGAATTAGAAAAGGAAGGTGG - Intronic
928018917 2:27685496-27685518 CCAGAATTACAGAAAATTGAAGG + Intronic
928519273 2:32072477-32072499 CCTGAATTCCAAAGGGAAGAGGG + Intronic
929270981 2:39971367-39971389 CCTGACTGACGGACGGTAGATGG - Intergenic
929696313 2:44118874-44118896 CCTGAATTAAATAAGGTAATGGG + Intergenic
930023955 2:47018816-47018838 CCTGTTTTACAGAAGAGAGAAGG + Intronic
930133395 2:47876430-47876452 CCTCACTTACAGAAGCTTGATGG - Intronic
930458841 2:51643191-51643213 TCTCAATTACAGATGCTAGAAGG - Intergenic
930957754 2:57224535-57224557 CCTTAATTAAATAATGTAGAAGG - Intergenic
931654558 2:64499204-64499226 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
934107818 2:88712025-88712047 CCTGAATTCCAAAGGGAAGATGG + Intronic
934869643 2:97851315-97851337 GCTGAATTGAAGAAGGCAGAGGG - Intronic
935364440 2:102274662-102274684 CCTGAATTCCAAAAGGGAGAAGG - Intergenic
936481199 2:112886376-112886398 CCTGAATTCCAAAAGGGAGAAGG - Intergenic
936798553 2:116237360-116237382 CCTGAATTACTGCAGTCAGATGG + Intergenic
937507099 2:122549951-122549973 CCTGAACTATAGATAGTAGAGGG + Intergenic
937555116 2:123144596-123144618 CCTGAATTAGTACAGGTAGAAGG + Intergenic
937770456 2:125714679-125714701 CCAGAATCACAGTAAGTAGAGGG + Intergenic
937803696 2:126112094-126112116 GCTGAATCACAGAAAGGAGATGG - Intergenic
937925358 2:127163529-127163551 CCTGAACTCCAAAGGGTAGAGGG - Intergenic
938171880 2:129085901-129085923 CCTGAATTCCAAAGGGAAGAGGG - Intergenic
938794914 2:134709761-134709783 CCTGAATTCCAGAAGGGAGGAGG - Intronic
938966456 2:136392994-136393016 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
941966827 2:171308993-171309015 CCTGAATAGAATAAGGTAGAGGG - Intergenic
942641396 2:178064629-178064651 ACATAATAACAGAAGGTAGAGGG - Intronic
942785233 2:179693327-179693349 GCTGAATGACTGAAGGGAGAAGG + Intronic
943657251 2:190522612-190522634 CCTGAATTCCAAAAGGGAGGAGG - Intronic
944634893 2:201666179-201666201 CCAGAACTACAGAAGATAGATGG + Intronic
944686003 2:202118366-202118388 CCTGTACTACAGAGGCTAGAAGG + Intronic
944960267 2:204864358-204864380 GCTGAATTAGAGAAGATAGTAGG - Intronic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
946281789 2:218671290-218671312 ACTGACTCACAGAAGCTAGATGG + Intronic
947226909 2:227849375-227849397 CCTGAATTCCAAAAGGAAGGAGG - Intergenic
947294393 2:228614748-228614770 CCTGAATTCCAAAGGGAAGACGG - Intergenic
947324825 2:228962724-228962746 CCTGTGTTAGAGAAGGGAGAAGG + Intronic
948091079 2:235296328-235296350 CCCGAATTCCAGAAGGGAGGAGG + Intergenic
949076163 2:242059429-242059451 CCTGAATTCCAAATGGGAGAGGG - Intergenic
1169295925 20:4398959-4398981 CCTGAATTAAGAAAAGTAGATGG - Intergenic
1169749134 20:8973898-8973920 CCTGAACTCCAAAAGGGAGAGGG - Intergenic
1170110389 20:12798354-12798376 GATGAATTACAATAGGTAGAAGG + Intergenic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1171974490 20:31585732-31585754 CCTGAATTCCAAAAGGAAGGAGG - Intergenic
1172086176 20:32384708-32384730 TCTGAACTTCAGGAGGTAGAAGG - Intronic
1173713509 20:45180970-45180992 CCTGAATTCCAGAAGGGAATCGG - Intergenic
1174236181 20:49094174-49094196 CCTGAAATTCAGAAGGTATCTGG + Exonic
1174260513 20:49291398-49291420 CCTGAATGACACAAGGCAGAGGG - Intergenic
1174839279 20:53886363-53886385 CTTGAATTACAAAAGGGAGGAGG - Intergenic
1178570596 21:33732297-33732319 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1178814460 21:35915295-35915317 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1178897384 21:36570350-36570372 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1179077137 21:38133076-38133098 CCTCAATTATAGAAAGAAGAAGG + Intronic
1180818478 22:18808358-18808380 CCTGAATGACAGATGGTTGGAGG + Intergenic
1181204701 22:21242813-21242835 CCTGAATGACAGATGGTTGGAGG + Intergenic
1183717688 22:39543463-39543485 CCTGTTTCACAGAAGGGAGAAGG - Intergenic
1184423676 22:44396441-44396463 CCTGAATTATAGAAGGATGCTGG - Intergenic
1203222224 22_KI270731v1_random:52602-52624 CCTGAATGACAGATGGTTGGAGG - Intergenic
1203268607 22_KI270734v1_random:34212-34234 CCTGAATGACAGATGGTTGGAGG + Intergenic
949461783 3:4302549-4302571 CCTGAATTCCAAAAGGAAGAAGG + Intronic
949663661 3:6311498-6311520 CCTGAAATCCAGAATGGAGATGG + Intergenic
951146098 3:19229379-19229401 CCTAGATTTCAGAAGGTATACGG - Intronic
951202245 3:19888641-19888663 CCTGTATAACAGAAGGGAGATGG - Exonic
952688003 3:36171955-36171977 CCTGAATTACAAAAAGGAGGAGG + Intergenic
953368959 3:42371134-42371156 CCAGTATTACAGAGGGGAGATGG - Intergenic
953422332 3:42764228-42764250 CCTGAATTCCAAAAGGGAGGAGG + Intronic
953842295 3:46398644-46398666 CCTACATTACAGAGGGTAGAAGG - Intergenic
954923501 3:54212600-54212622 CCTGAATTCCAAAAGGGAGGAGG + Intronic
956505526 3:69934602-69934624 AATGAATTGCAGAAGGTACACGG + Intronic
956660807 3:71595362-71595384 GCAGAATAGCAGAAGGTAGAAGG + Intergenic
957305238 3:78449327-78449349 CCTGAATTCCAAAAGGAAGAGGG - Intergenic
957870312 3:86083154-86083176 CCTAGATTTCAGAAGATAGATGG - Intergenic
959752849 3:109858842-109858864 CCTGAATTCCAAAAGGAAGGAGG + Intergenic
960371734 3:116849260-116849282 CCTGAATTCCAAAAGGGAGGAGG - Intronic
961141630 3:124561306-124561328 TCTGCAGGACAGAAGGTAGAAGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961957442 3:130818565-130818587 CCTGAATTCCAAAAGGGAGAAGG - Intergenic
964881130 3:161424258-161424280 CCTGAATTATATTAGATAGAAGG + Intergenic
965677183 3:171210176-171210198 ACGGAAGGACAGAAGGTAGAGGG + Intronic
965793368 3:172412210-172412232 CTGGAATTAGATAAGGTAGATGG + Intergenic
966754302 3:183354083-183354105 CCTGAATTCCAAAGGGAAGAGGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968363187 3:198163390-198163412 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
970658112 4:18254336-18254358 CCTGGATGACAGTTGGTAGAAGG + Intergenic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
972500686 4:39675246-39675268 GATGAATTACAGAAAGCAGAAGG + Intergenic
973979539 4:56296558-56296580 ACTGAATTACAGAATGCAGTGGG - Intronic
976783927 4:88795260-88795282 CATGAATTAGAGAAGGTATGAGG - Intronic
976926871 4:90509724-90509746 CCTGAATTACAGCAGAATGATGG + Intronic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
977983965 4:103360325-103360347 CCTAAATTTCAGAAGATATATGG + Intergenic
980492022 4:133540736-133540758 CCTGAATTCCAAAAGGGAGAAGG + Intergenic
982412126 4:155090203-155090225 CATAAATTACAGAAGATAGGAGG - Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982449323 4:155533247-155533269 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
982705112 4:158700475-158700497 GCTTAAGTACACAAGGTAGATGG - Intronic
982915287 4:161201641-161201663 CCTGAATTCCAAAAGGAAGGTGG + Intergenic
983295291 4:165859210-165859232 TCTGAATGACAGAAACTAGAAGG + Intergenic
983744322 4:171176847-171176869 GCTGAATTTCAAAAGGTAGGTGG - Intergenic
983785916 4:171729302-171729324 CCTAGATTTCAGAAGGTATATGG + Intergenic
985504206 5:269677-269699 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
986015530 5:3754210-3754232 CCTGTATTGCAAAAGGTAAATGG - Intergenic
987122657 5:14781685-14781707 CCTCAATTCAAGATGGTAGAAGG + Intronic
988294272 5:29334744-29334766 CCTGAACTAAAGGAGATAGAGGG + Intergenic
988649423 5:33131877-33131899 CCTAGATTTCAGAAGGTATATGG + Intergenic
989805156 5:45594805-45594827 TCTAAATAACAGAAGGTAGTAGG - Intronic
992108036 5:73466556-73466578 CCTGAATTCCAGTAGGGAGGAGG + Intergenic
992283026 5:75201746-75201768 CCTCAATTCCAGAAGGGAGGAGG - Intronic
992583668 5:78209244-78209266 CCTGAATTCCAAAAGGGAGGAGG - Intronic
992736873 5:79730581-79730603 CATGAATTACAGGAGCAAGAAGG + Exonic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
994044725 5:95295168-95295190 TCTGAATTACAAAGGGAAGAGGG - Intergenic
994378193 5:99038515-99038537 CCTGACTGTTAGAAGGTAGAAGG + Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
995594346 5:113731724-113731746 CCTGAATTCTAAAAGGGAGAAGG + Intergenic
997672007 5:135682966-135682988 GCTGAATGAGAGAGGGTAGAAGG + Intergenic
998406324 5:141876601-141876623 TCTGACTTACAGAGGGTAGCTGG + Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
1000403016 5:160852405-160852427 CATGCATTACCAAAGGTAGATGG - Intergenic
1000529713 5:162404681-162404703 ACAGAATTACAGATGGTAAAGGG - Intergenic
1004200880 6:13546804-13546826 TCTGAATTACAAAAGGGAGGAGG - Intergenic
1004791348 6:19029902-19029924 CATGAATTATAGAATGTGGAAGG - Intergenic
1007105384 6:39280068-39280090 CCTGAATGAAGGAAGGAAGAAGG - Intergenic
1007365297 6:41387449-41387471 CCTGGATTACAGAAAAGAGAAGG - Intergenic
1008162027 6:48089920-48089942 TCTGAATCAAAGAAGGCAGATGG - Intergenic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1010755974 6:79666660-79666682 ACTGGATTAAGGAAGGTAGAAGG - Intronic
1011242199 6:85284867-85284889 CCTGAATTCCAAAAGTTAAACGG + Intergenic
1012600696 6:101093025-101093047 TCTGAATTTCATAAGGTAGAAGG - Intergenic
1014171962 6:118288669-118288691 CCTGAATTCCAAAAGGAAGGAGG + Intronic
1017198136 6:151724011-151724033 CTGGAATTCTAGAAGGTAGAAGG + Intronic
1019252493 7:25321-25343 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1019545039 7:1570074-1570096 CCTGACTTCCGGAAGGTGGACGG - Intronic
1020205856 7:6115183-6115205 CCTGAAATACAGGGGGAAGAGGG - Intronic
1020766597 7:12329590-12329612 CCTGAATTACAAAGGGATGAGGG + Intergenic
1021099398 7:16571310-16571332 CCTGAATTCCAAAAGGGAGGGGG - Intronic
1023524873 7:41090587-41090609 CCTCTATTATAGAGGGTAGAAGG - Intergenic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024160611 7:46671245-46671267 CCTGAATTCCAAAGGGTGGAGGG - Intergenic
1024774424 7:52765873-52765895 TCTGAAACACAGAAGGCAGAAGG - Intergenic
1026606436 7:71819997-71820019 CCTGAATTCCAAAAGGGAGGAGG - Intronic
1027996773 7:85434675-85434697 CCTGGATTTCAGAAGATATATGG + Intergenic
1028007637 7:85595924-85595946 TCTGAATTCCAAAAGGTAGCTGG - Intergenic
1029002246 7:97166620-97166642 CCTGAATTCCAAAAGGAAGAAGG + Intronic
1030290239 7:107864817-107864839 TCTGAAGGACAGAAAGTAGAGGG + Intergenic
1033635429 7:143207674-143207696 CCTGAATTCCAAAAGGAAGGAGG + Intergenic
1034005637 7:147469248-147469270 CCTGAATTACAGAACGGACACGG - Intronic
1036583860 8:10104720-10104742 CCTGAATTCCAAAAGGGAGACGG + Intronic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1038739505 8:30204577-30204599 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1038779730 8:30559576-30559598 TCTGAATTACAGAAGGCATTTGG - Intronic
1038905464 8:31897255-31897277 CCTGAGTTCCAGAAGGGAGGAGG - Intronic
1039259967 8:35760891-35760913 CCTGAATTTTAGAAGTTGGATGG - Intronic
1040522962 8:48193532-48193554 ACTGAGTTACAGGAGGCAGAAGG + Intergenic
1040654951 8:49496847-49496869 CCTGAATGACTGGAGGGAGATGG + Intergenic
1041267403 8:56078386-56078408 CCTGAAATACAAAAGTTAGCCGG - Intergenic
1042032001 8:64486539-64486561 ACCCAATTACTGAAGGTAGAGGG + Intergenic
1043947912 8:86275186-86275208 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1044831391 8:96253402-96253424 CCTACAGGACAGAAGGTAGAAGG - Intronic
1045023130 8:98061735-98061757 CCTGAATTACAGGGGAGAGAAGG + Intergenic
1045332017 8:101163372-101163394 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1045644272 8:104284920-104284942 CCTGAATTCCAAAGGGTGGAGGG + Intergenic
1045660677 8:104434365-104434387 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1045818103 8:106301488-106301510 ACTGCATTACAAAAGTTAGATGG - Intronic
1046864383 8:119129588-119129610 CCTGAATAACAGAAGAGAGCAGG + Intergenic
1046903557 8:119547858-119547880 CCTTAATTACAGAAGATGGCTGG - Intergenic
1047055158 8:121155731-121155753 CCTGAATTCCAAAAGGAAGGAGG - Intergenic
1049467589 8:142759122-142759144 CCTGAATTCCAGGAGGGAGGAGG - Intergenic
1051655550 9:19378360-19378382 CCTTAAATAAAGAAGGTAGGAGG - Exonic
1055355989 9:75437386-75437408 CCTGAAATACAGAGAGTAAAAGG - Intergenic
1055697719 9:78905134-78905156 CCTGAAGTTCAGAAGTCAGAAGG - Intergenic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056272535 9:84960368-84960390 CCTGAGCCACAGAAGGGAGAAGG + Intronic
1056381939 9:86063660-86063682 TAAGAATTACAGAAGGTAAACGG + Intronic
1056464030 9:86836625-86836647 CCTGAATTAGAGCTGGGAGAAGG - Intergenic
1056995345 9:91452117-91452139 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058125493 9:101189463-101189485 CCTGAATTCCAAAAGGGAGGAGG + Intronic
1058452087 9:105106526-105106548 CTTACATAACAGAAGGTAGAAGG + Intergenic
1059052720 9:110944499-110944521 CTTGATTCAGAGAAGGTAGATGG - Intronic
1061504803 9:131025715-131025737 GCTGAATTGCAGGAGGTTGAAGG + Intronic
1062492310 9:136811851-136811873 CCTGAATTCCAGAAGGGAGGAGG + Intronic
1062747874 9:138227050-138227072 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1186873302 X:13793053-13793075 CCTGAATTCCAGAAGGGAGGAGG - Intronic
1188102875 X:26112232-26112254 CTTGAATTAAACAAGATAGAAGG - Intergenic
1188192370 X:27187845-27187867 CCTGAATTCCACAAGGGAGGGGG - Intergenic
1188263091 X:28040531-28040553 CCTGAATGTCAGAACGGAGATGG + Intergenic
1189188080 X:39071139-39071161 CCTGAATTCCAAAAGGGAGAAGG + Intergenic
1189758753 X:44299287-44299309 CCTGAATTCCAAAAGGGAGGAGG - Intronic
1190408245 X:50109191-50109213 CCTGAATTCCAAAAGGAAGGAGG - Intergenic
1193959209 X:87902626-87902648 CCTGAATTCCAAAAGGGAGGAGG - Intergenic
1194015004 X:88608515-88608537 CCTGAATTTCAAAAGGGAGGAGG + Intergenic
1194488698 X:94519310-94519332 TTTGAATTTCATAAGGTAGAAGG - Intergenic
1194653115 X:96538936-96538958 CCTGACTAACACAAGGTTGAAGG + Intergenic
1196763128 X:119218119-119218141 CCTGAATTCCAAAATGGAGAAGG + Intergenic
1197351369 X:125387550-125387572 CCTGAATTCCAAAAGGGAGGAGG + Intergenic
1198982856 X:142419061-142419083 CCTGAATTCCAAAAGGGAGGGGG - Intergenic
1201060777 Y:10044363-10044385 CCTGAAATCCAGAATATAGAGGG - Intergenic
1201689467 Y:16746803-16746825 CATGTATTACAGAAAGCAGAAGG - Intergenic