ID: 1142788626

View in Genome Browser
Species Human (GRCh38)
Location 17:2245361-2245383
Sequence CAAGCTGGAAACTGCAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142788622_1142788626 -9 Left 1142788622 17:2245347-2245369 CCTCTATGTAGGCCCAAGCTGGA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1142788620_1142788626 -3 Left 1142788620 17:2245341-2245363 CCAAATCCTCTATGTAGGCCCAA 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1142788618_1142788626 7 Left 1142788618 17:2245331-2245353 CCAGTTTTGGCCAAATCCTCTAT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1142788617_1142788626 12 Left 1142788617 17:2245326-2245348 CCACTCCAGTTTTGGCCAAATCC 0: 1
1: 0
2: 4
3: 8
4: 140
Right 1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG 0: 1
1: 0
2: 1
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142788626 Original CRISPR CAAGCTGGAAACTGCAATCT GGG Intronic
900573113 1:3369475-3369497 GATGCTGGAAACTGCAATGCCGG - Intronic
900799528 1:4728712-4728734 CTTGCTGGAAACTTCTATCTTGG + Intronic
902074821 1:13775894-13775916 AAAGCAGGAGACTGCCATCTGGG - Intronic
906197689 1:43939094-43939116 CCAGCTGGAGGCTGCATTCTGGG + Intergenic
906579410 1:46924005-46924027 CAAGCTGGAAAATGCACTTCAGG - Intergenic
908649780 1:66319600-66319622 GAACCTGGAAACTTGAATCTAGG - Intronic
910423896 1:87100204-87100226 CTAGGTGGAATCTGCAATCTAGG + Intronic
910966004 1:92808718-92808740 CAAGTTAGAAATTGCAATTTTGG - Intergenic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
912574100 1:110649014-110649036 CAAGCTGGCTAATGCAATCATGG + Intergenic
915046303 1:153019874-153019896 CAAGTTGGAAAATGCACTTTAGG + Intergenic
915069107 1:153251378-153251400 CAAGATGGAAACCGCATTTTGGG + Intergenic
916587479 1:166161195-166161217 CAGGCTGGAGTGTGCAATCTTGG + Intronic
920817451 1:209348207-209348229 CAAGGTGGGAACTCCTATCTCGG - Intergenic
920881176 1:209881731-209881753 TAAGCTGGCATCTGCAATGTGGG - Intergenic
921001390 1:211047522-211047544 CAGCCTGGAAACTCCAATCTTGG + Intronic
924409097 1:243784678-243784700 CACGCTGGACACTGCTCTCTGGG + Intronic
924743484 1:246811878-246811900 CAAACTTCAATCTGCAATCTTGG - Intergenic
1062835106 10:630178-630200 CAAGCTGGGAACTGCAATGGTGG - Intronic
1063763306 10:9106980-9107002 GAAGGTGAAACCTGCAATCTGGG + Intergenic
1065056866 10:21853741-21853763 CAGGCTGGAGTGTGCAATCTCGG - Intronic
1065915748 10:30353754-30353776 CAATCTGGCAACTGTAATCCTGG - Intronic
1069820157 10:71222623-71222645 CAACCTGGAAACTGCCACTTTGG - Intronic
1070113016 10:73502818-73502840 TAAGCTGCAAATTGAAATCTGGG - Intronic
1070991970 10:80740593-80740615 CAAGATGGTAACTGCAAAGTTGG - Intergenic
1071519662 10:86321602-86321624 GAAGCTGGCAGCTCCAATCTGGG + Intronic
1075282982 10:121156955-121156977 CAAGCTGGAAATGGAATTCTAGG - Intergenic
1076442718 10:130491398-130491420 GAAGCTGGAAAATGCAGACTGGG - Intergenic
1076681023 10:132171236-132171258 CACGCTGGAGACTGCACACTCGG - Intronic
1080226451 11:29966601-29966623 CCAGCTAGAAACTGCTAGCTGGG + Intergenic
1080952413 11:37050297-37050319 CACACTGGAAACTGCACTCTTGG - Intergenic
1081647803 11:44802148-44802170 CAAGCTGGAAAAGGCAATAGAGG + Intronic
1082257404 11:50046598-50046620 AAAGGTGGAAACTACACTCTAGG - Intergenic
1085483949 11:76846000-76846022 CAAGATGGAAACTGAACTCCTGG - Intergenic
1089109916 11:116047212-116047234 CACGCTGCACACAGCAATCTGGG + Intergenic
1090597242 11:128333357-128333379 CCAGCTGGAAGCTGGGATCTGGG - Intergenic
1091941377 12:4486331-4486353 CAAGCTGGGAACCACAACCTTGG - Intergenic
1092897480 12:13026643-13026665 AAAGCTGGGAACTGCATACTGGG + Intergenic
1095716669 12:45353690-45353712 CAAACTGGAAACAGCAACCTAGG + Intronic
1095976515 12:47943885-47943907 GAAGCAGGAAGCTGCCATCTGGG + Intergenic
1096066601 12:48745553-48745575 CAGGCTGGGAGGTGCAATCTCGG - Intergenic
1097393072 12:59039636-59039658 CATGGTGGACACTGCTATCTAGG - Intergenic
1098106986 12:67078791-67078813 CAACCTGCAAACTTCAGTCTCGG + Intergenic
1098965682 12:76785848-76785870 AAAGCTGGAAAAAGCAAACTGGG + Intronic
1101949552 12:109163978-109164000 CAATCTGGAAACTTCCATCCTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102455458 12:113068119-113068141 TAGGCTGGAGACTGCAAGCTGGG - Intronic
1102944477 12:116974058-116974080 CCAGCTGGAAACTCCAAACAAGG + Intronic
1104966996 12:132512795-132512817 AGAGCTGGAAACTGCAGCCTGGG + Intronic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1109486181 13:63023569-63023591 GAAACTGGAAACTGCACCCTTGG - Intergenic
1109936159 13:69287394-69287416 CAAGCTGGAAACTGCTTTACTGG - Intergenic
1111410730 13:87873398-87873420 CAAGCCTGAAACAGCAATCAAGG + Intergenic
1115247795 14:31314301-31314323 CAAGCTGGATGGTGCGATCTTGG + Intronic
1116729443 14:48603466-48603488 CAAGCTGAAAACTGCACTTCAGG - Intergenic
1116801266 14:49445983-49446005 AAAGCTGGAAATAGCCATCTGGG + Intergenic
1120188473 14:81418510-81418532 TAAGCTTTAAACTGTAATCTGGG - Intronic
1120925548 14:89793816-89793838 CTAGCTGCAAACTGTAGTCTAGG - Intergenic
1125990223 15:44099511-44099533 AAATGTGGAAACTGCAATCATGG + Intronic
1126920647 15:53519518-53519540 TAAGCCGGAAACTTCAATCTGGG + Intronic
1127475666 15:59330347-59330369 AAAGCTGGAAACTGGATTCGAGG - Intronic
1128185857 15:65642876-65642898 GAAGCTGGAAAGTGCAATCTGGG - Intronic
1128674457 15:69598384-69598406 GAAGCTGGAAAAGGCAATCTGGG - Intergenic
1131029722 15:89176351-89176373 CAAGCTGGGATCTGAAAGCTGGG + Intronic
1131192060 15:90324762-90324784 CAAGCTAGATATTGCAAACTGGG - Intergenic
1133132531 16:3686366-3686388 CAGGCTGGAGGCTGCAATCACGG + Intronic
1133536085 16:6703798-6703820 CAAGCTGCTGACTGCCATCTGGG + Intronic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1137255761 16:46773994-46774016 CAAGCTGGAGGGTGCACTCTTGG + Intronic
1138952200 16:61926771-61926793 CACGCTGGAGACTGGCATCTAGG + Intronic
1140357821 16:74321021-74321043 CAGGCTGGAAACTGGGGTCTTGG + Intergenic
1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG + Intronic
1145372690 17:22320216-22320238 CAAGCTGTAAAGTGTAAGCTAGG - Intergenic
1146660434 17:34662067-34662089 AAAGCTGGCCACTGCCATCTTGG - Intergenic
1147156612 17:38547385-38547407 CAAGATCCAAACTCCAATCTTGG + Intronic
1148461782 17:47843277-47843299 CAGCCTGGAAACTGCAACCTGGG - Intergenic
1149242011 17:54662082-54662104 CAAGCTGGAAACTACACTTCAGG - Intergenic
1155447647 18:25928823-25928845 AAAACTGGAAACTCCAATCGGGG + Intergenic
1155996628 18:32337446-32337468 CAAGCTTGAAACTGATAACTCGG + Intronic
1157771729 18:50353822-50353844 CAAACTGGCAACTTCAATCTGGG + Intergenic
1158185790 18:54769916-54769938 CAGGCTGGATTGTGCAATCTTGG + Intronic
1159403475 18:67968417-67968439 CTAGCTGGATACTGAAAACTTGG + Intergenic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1164002881 19:21121080-21121102 CAGGCTGGAGTGTGCAATCTCGG + Exonic
1167981987 19:53283050-53283072 GAAGCTGGAAACTGGAGTATGGG - Intergenic
925707208 2:6698082-6698104 CAAGATGGAAGCTCCACTCTGGG + Intergenic
925740930 2:7005536-7005558 GCAGCTGGAAACTGCCAGCTTGG - Intronic
926562586 2:14434334-14434356 CAAGCAGCAACCTGCAAGCTCGG - Intergenic
928719308 2:34100860-34100882 GGTGCTGGAAACTTCAATCTGGG - Intergenic
929928467 2:46233927-46233949 CAGACTGGAAAGTGCAATCATGG + Intergenic
929991096 2:46787583-46787605 CCAGCTGGAGACTGGAATATGGG - Intergenic
935318575 2:101862158-101862180 CAAGCTGCAAACTCCACTCCTGG - Intronic
936022050 2:109002305-109002327 CAAGCTGGGAAGTGGAATCCCGG - Intergenic
938187533 2:129244962-129244984 CAAGCTGTAAAATGCAGTCCGGG - Intergenic
941442214 2:165552743-165552765 CAGGCTGGAGTGTGCAATCTTGG + Intronic
943393035 2:187294666-187294688 CAAGCAGAAAACTGGATTCTGGG - Intergenic
944134760 2:196386568-196386590 CAAGCTGGGCACTGCAAATTAGG + Intronic
946293133 2:218761054-218761076 CAACCTGGGAACTCCACTCTAGG - Intergenic
947191923 2:227515381-227515403 GATGCTTGAAACTGAAATCTGGG - Intronic
1169518054 20:6339409-6339431 CCAGCTGGAAAATGCAAACTAGG - Intergenic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1170861712 20:20110628-20110650 CAACCTTCAAACTGCAAACTGGG - Intronic
1173122504 20:40306632-40306654 AGAGCTGGACACTGCAGTCTGGG - Intergenic
1173717245 20:45219284-45219306 AAAGCAGGAAAATGCAAACTAGG - Intergenic
1174378184 20:50139931-50139953 GCAGCTGGAAATAGCAATCTGGG - Intronic
1179296214 21:40065210-40065232 CAACATGGAAGCAGCAATCTTGG + Intronic
1182623113 22:31628604-31628626 CAACCTGGTCACTGCAATCCTGG + Intronic
1183384451 22:37506936-37506958 CAAGCTTGAAAGTGCAAATTTGG - Intronic
950227095 3:11244790-11244812 CGAGCTGAAAGCTGCACTCTTGG + Intronic
951218025 3:20041799-20041821 CAATCGGGAATCTGGAATCTGGG - Intronic
952994884 3:38870119-38870141 CAAGCTGGAAAATAGAAACTAGG + Intronic
954873936 3:53788471-53788493 CTAGCTGTGAACTGCAATCCAGG - Intronic
955557574 3:60154443-60154465 GAAGCTAGAAACTCCAATCAGGG + Intronic
956542751 3:70361094-70361116 TAAGATGGAAACTGTAATCCTGG + Intergenic
958254213 3:91306234-91306256 CAACTGGGAAACTTCAATCTAGG - Intergenic
960867172 3:122213488-122213510 CAAGCTGGACAATGAAAGCTTGG - Intronic
962508821 3:136077651-136077673 GAAGATGGAAGCTGCAATCCTGG - Intronic
962625110 3:137218330-137218352 TAAAATGGAAGCTGCAATCTAGG - Intergenic
964284800 3:155106539-155106561 CAATGTGAAAACTGGAATCTGGG - Intronic
967749192 3:193094408-193094430 CAGCCTGGAATCTGCAGTCTGGG + Intergenic
970269999 4:14336180-14336202 TATGGTGGAAACTACAATCTGGG + Intergenic
970952905 4:21776811-21776833 CAAGCTGGAGTATACAATCTCGG + Intronic
973600402 4:52537104-52537126 CAACCTACAAAATGCAATCTTGG + Intergenic
975380675 4:73697366-73697388 CAAGTTGAAAACTCCAATCTTGG + Intergenic
976032761 4:80777092-80777114 ACACCTGAAAACTGCAATCTGGG - Intronic
976864963 4:89713877-89713899 CAAGCAGGGAAAAGCAATCTTGG - Intergenic
978623915 4:110663152-110663174 GCAGCAGGAAACTTCAATCTAGG - Intergenic
982197323 4:152929498-152929520 CAAGCTGGAAACTGCGTCGTTGG - Intergenic
984350357 4:178582808-178582830 CAACCTAGAAACTGTAAACTAGG - Intergenic
985992782 5:3577149-3577171 CAAATTGTAATCTGCAATCTTGG + Intergenic
986203652 5:5602272-5602294 CAAGCAGGAAACTGACATCTAGG + Intergenic
986637684 5:9838956-9838978 CTAACTGGACACTGAAATCTGGG + Intergenic
987456222 5:18150368-18150390 CAAGCTGGAAACCATAAGCTAGG - Intergenic
987476787 5:18400267-18400289 CAATATGAAAAATGCAATCTAGG - Intergenic
987863223 5:23510407-23510429 CAGGCTGGATGGTGCAATCTTGG + Intronic
988338025 5:29931429-29931451 CAAGCTTGAGATTGCAATCTGGG + Intergenic
993411130 5:87574460-87574482 AAGGCTGGAAAGTACAATCTTGG + Intergenic
993725333 5:91360504-91360526 CAAGTTTTAAACTGCAATATTGG + Intergenic
994190083 5:96859546-96859568 CAAGCTGCACAGTGCAATGTGGG + Intronic
994441796 5:99816319-99816341 CCAGCTGGAAACTAAAATGTTGG - Intergenic
995385329 5:111582212-111582234 GAAGCTGCAAGCTGCAAGCTGGG + Intergenic
997069373 5:130602177-130602199 TAACCTGAAGACTGCAATCTAGG + Intergenic
999527187 5:152420018-152420040 CAAGCAGCAAACTTAAATCTTGG - Intronic
999677015 5:154014667-154014689 CAAGATGGAAACTGCTTGCTAGG - Intronic
1000272691 5:159701669-159701691 CAAGCTTGAAACACCATTCTTGG + Intergenic
1000385409 5:160670516-160670538 CCATCTGGAAACTGCCAGCTTGG - Exonic
1005027560 6:21478057-21478079 CAACCTGGAAAATGGAAACTTGG - Intergenic
1005515011 6:26545964-26545986 CAAACTGAAAACAGGAATCTTGG - Exonic
1007734273 6:43970909-43970931 CAAGCTGGAAGCTCCCTTCTAGG + Intergenic
1009189615 6:60614249-60614271 CAATTGGGAAACTTCAATCTAGG + Intergenic
1010546316 6:77161150-77161172 CAAGCTAGAAAGTGAAATTTTGG - Intergenic
1010878960 6:81144451-81144473 CAACCTGAAAACTTCAATTTAGG - Intergenic
1011790726 6:90895541-90895563 CAATCTGATAACTGCAATGTTGG - Intergenic
1013183317 6:107736211-107736233 CAAGGAGGAAACTACACTCTAGG - Intronic
1015226447 6:130862335-130862357 CATGGTGGAAAGTGCAAACTAGG - Intronic
1015239061 6:131003886-131003908 CAAGCTGCAAGCTGCATTCCAGG - Intronic
1017642731 6:156510061-156510083 GAGGCTGGAAACTCCAATATCGG - Intergenic
1017828922 6:158106782-158106804 CAGGCTGGAGTGTGCAATCTCGG - Intergenic
1017941961 6:159061091-159061113 CAAGCTGGATCCTGCCCTCTGGG - Intergenic
1018068447 6:160140229-160140251 CAAGCTGGAGTGTGCGATCTCGG - Intronic
1020111742 7:5451586-5451608 GAAGCTGGAAAAAGCATTCTGGG - Intronic
1024017278 7:45328535-45328557 CAGGCTTGAGACTGCATTCTGGG + Intergenic
1030020963 7:105274936-105274958 CAAGCTGGATGGCGCAATCTCGG + Intronic
1034410748 7:150940861-150940883 CCACCTGGAAACTGGAAACTGGG + Intergenic
1035913445 8:3594361-3594383 TATGCTGGAAACTGAAATTTGGG + Intronic
1036098438 8:5750895-5750917 CCAGATGGAGGCTGCAATCTGGG - Intergenic
1041990686 8:63987277-63987299 CAAACTGGATAATGCAATTTTGG - Intergenic
1042963353 8:74325691-74325713 CCAGCTGAAAATTGCAAACTGGG + Intronic
1045640761 8:104247827-104247849 CAAGCTGGAGATGCCAATCTAGG + Intronic
1046551904 8:115728733-115728755 CAAGCTGGAAATAGAAATGTGGG + Intronic
1048793436 8:138126038-138126060 GAAGCAGGAATCTGCAATCTAGG + Intergenic
1053175008 9:35916204-35916226 CAGGCTGGATTCTGGAATCTAGG + Intergenic
1058743690 9:107968935-107968957 CAAGCTGAAAACTTCACTCCAGG + Intergenic
1060480111 9:124012660-124012682 CAAGGTTGAAACCGAAATCTCGG + Intronic
1060968515 9:127724751-127724773 CCAGCTGGAAGAAGCAATCTAGG - Exonic
1061751495 9:132780646-132780668 CAAACTGGAAACTGCTATATAGG - Intronic
1186344419 X:8677071-8677093 GTAGCTAGAAACTGCAATATTGG - Intronic
1186611257 X:11140084-11140106 GAGGCTGGAAACTGCCATGTAGG - Intronic
1188678097 X:32967771-32967793 CAAGATTGAAAATGTAATCTCGG + Intronic
1188841025 X:35017554-35017576 AAAGCTAGAAACTGCAATCAGGG - Intergenic
1189936317 X:46072744-46072766 CAACCTGGAAACTGCATTACTGG - Intergenic
1192772176 X:74204350-74204372 CAAGCTAGAGATAGCAATCTTGG - Intergenic
1198714412 X:139541245-139541267 GAAACTGGAAAATGCAATATTGG + Intronic