ID: 1142794996

View in Genome Browser
Species Human (GRCh38)
Location 17:2300783-2300805
Sequence ATCCAAATGCTAATACTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142794996 Original CRISPR ATCCAAATGCTAATACTGGT AGG Intronic
903941928 1:26937943-26937965 ATTCAAATGCTAATCCAGGTCGG - Intronic
907610010 1:55859742-55859764 ATCCAAATGCTGTTCCTTGTGGG - Intergenic
908293542 1:62691042-62691064 ATGCAATTTCTAATTCTGGTTGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910150310 1:84134392-84134414 ATCCATATGGTATTATTGGTAGG - Intronic
911391728 1:97253601-97253623 ATTTAAATGCTAATAGTGATGGG - Intronic
918454802 1:184698582-184698604 ATCAAACTGCTAACATTGGTTGG + Intronic
919696356 1:200580075-200580097 ATATAATTGTTAATACTGGTTGG + Intronic
919760947 1:201097701-201097723 GCCCAAATGCTATTACTGATGGG - Intronic
921770216 1:219027716-219027738 ATCCAAATGCTAATATTTTGTGG + Intergenic
923245635 1:232129253-232129275 CTCCACATGCTGATACTGATAGG + Intergenic
1063296616 10:4813031-4813053 ATGCAAATGCTAAATCTGGCCGG - Intronic
1067747397 10:48946247-48946269 ATTCAAATGCAATTACTTGTAGG - Intronic
1072280952 10:93864879-93864901 ATTAAAATGCTAATACTCCTAGG - Intergenic
1073093341 10:100964024-100964046 ACCCAAATGCAAATACTGACTGG - Intronic
1086499176 11:87434656-87434678 ACCCAACTGTTAATTCTGGTAGG - Intergenic
1089890717 11:121878175-121878197 ATTCAAATGCTAATATTGTCTGG + Intergenic
1090574631 11:128087574-128087596 ATCAAAATGCTAGTATTGGCTGG + Intergenic
1095261254 12:40102410-40102432 ATCCAAATTCCATTGCTGGTCGG - Intronic
1098753813 12:74331637-74331659 ATCCAAATGGTAAAACTGATTGG + Intergenic
1100779049 12:98004378-98004400 ATGCAAAGGCAAATTCTGGTGGG + Intergenic
1106589625 13:31088283-31088305 ATCAAAATGATAATAGTGGCCGG - Intergenic
1106971695 13:35148061-35148083 ATCATAAAGATAATACTGGTGGG + Intronic
1115766019 14:36624620-36624642 ATGCAAAGGCTAGTACTAGTGGG + Intergenic
1116526919 14:45917012-45917034 ATCAAAATGCTAATAGTGATAGG - Intergenic
1122127838 14:99588678-99588700 TTCCAAGTGCTTATACGGGTGGG - Intronic
1125257995 15:37788792-37788814 AACCACATGGAAATACTGGTTGG - Intergenic
1125474966 15:40040883-40040905 AACCAAAAGCCAATACAGGTTGG - Intergenic
1127040518 15:54970552-54970574 ATTCAAATGCTAATCCTGTTTGG + Intergenic
1127516965 15:59705357-59705379 TTCTAAATTCTAATAATGGTTGG - Intergenic
1130827232 15:87561746-87561768 ATCCAAAAGCTATTACTTGAAGG + Intergenic
1133417158 16:5615810-5615832 ACCCCATTGCTAACACTGGTGGG - Intergenic
1137349964 16:47705106-47705128 AGCCAAATTCTAATTCTAGTAGG - Intergenic
1141210596 16:81976070-81976092 AGCCACATGATAATACTGGGAGG + Intergenic
1142794996 17:2300783-2300805 ATCCAAATGCTAATACTGGTAGG + Intronic
1144296332 17:13878522-13878544 ATCCCAATGCCAATTCTAGTGGG + Intergenic
1153079024 18:1198515-1198537 ATGCTAATGTTAATACTGGTTGG - Intergenic
1155080332 18:22403549-22403571 ATCCCTGTGCTAATTCTGGTTGG + Intergenic
1156375352 18:36510241-36510263 ATCAAAATGTTAACACTGATAGG - Intronic
1167275545 19:48536720-48536742 ATCGGAATGCTATCACTGGTGGG + Intergenic
925995677 2:9290943-9290965 ATCAAAATGCTAACAGTGGTGGG - Intronic
926201383 2:10801551-10801573 GTCCAAATGCTAATTCTGTGTGG - Intronic
926774165 2:16405588-16405610 TTACAAATTCTAATACTGTTGGG - Intergenic
928896963 2:36276920-36276942 ATCTTAATGCTAATCATGGTCGG + Intergenic
932301173 2:70667913-70667935 ATTCAAATGCTAATCCTGGACGG - Intronic
933938552 2:87226555-87226577 CTCCAAATGCCAGTACTGTTGGG + Intergenic
935253897 2:101290997-101291019 AGCCACATGCTGATACTGATTGG - Intronic
936354583 2:111739219-111739241 CTCCAAATGCCAGTACTGTTGGG - Intergenic
937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG + Intergenic
939667021 2:144964933-144964955 ACCAAAATGCTAATAGTGATAGG + Intergenic
939897340 2:147808105-147808127 ATCCTAATGCTAGTGCTAGTGGG + Intergenic
943980028 2:194538441-194538463 ACACAGATGCTAATACTAGTGGG - Intergenic
946197179 2:218040720-218040742 GTGAAAATGCAAATACTGGTAGG + Intronic
946213605 2:218166620-218166642 GTGAAAATGCAAATACTGGTAGG - Intronic
946725787 2:222659929-222659951 ATTCAAATGCTAATCTTGGCTGG + Intergenic
947374294 2:229480219-229480241 GACAAAATGCTAATAATGGTTGG - Intronic
948932965 2:241143926-241143948 ATTCAAATGCTGATACAGGGTGG + Intronic
1169305477 20:4486651-4486673 TTACAAATCCTAATACTGCTTGG + Intergenic
1169822419 20:9727049-9727071 ATTCAAATGCTAAGATTGGTAGG - Intronic
1172066192 20:32222345-32222367 ATAGAAAAGCTAATACTGGATGG - Intronic
1181302680 22:21892673-21892695 ATACAAATGCCAATATTGGCCGG + Intergenic
1183220246 22:36507379-36507401 AGCCAAACGCTAAAACTAGTTGG + Intergenic
951361886 3:21735108-21735130 ATCCTAATGCAAATAATGGCAGG + Intronic
951698187 3:25467699-25467721 AACCAAATGCAAGTTCTGGTAGG - Intronic
954196020 3:48997759-48997781 ATCCAAATGCTATGCCTGGTTGG - Intronic
954725573 3:52605933-52605955 ATAGAAATGCTAATACTTGTAGG + Intronic
956754977 3:72376264-72376286 ATCCACATTTTAATATTGGTGGG - Exonic
958469641 3:94500809-94500831 ATGCAACTGCAAATACTGGAAGG - Intergenic
958811779 3:98868097-98868119 ATTCAAATGTTATTTCTGGTCGG - Intronic
959292743 3:104495060-104495082 ATCCAAATGTTAATACTGAAAGG - Intergenic
960029304 3:113041621-113041643 TTCCAAATGCTGATCCTGGCAGG + Intergenic
960794296 3:121468356-121468378 ATCAAAATGCCAACACTAGTAGG - Exonic
962531604 3:136286396-136286418 GTCCAAATGGAAATTCTGGTAGG - Intronic
964204306 3:154154825-154154847 ATCCTAATGCTCATACAGATAGG - Intronic
965979081 3:174664697-174664719 GTGCAAATGATAATTCTGGTGGG + Intronic
972442212 4:39105781-39105803 CTCCAAAAGCTAGTACTGGTGGG + Intronic
975725286 4:77285537-77285559 CTTCAAATGCCCATACTGGTCGG - Intronic
977554147 4:98471705-98471727 ATCCAACTGCTAATTTTGGCAGG + Exonic
977965095 4:103136598-103136620 ATCAAAATGTTAAGAATGGTTGG - Intronic
978376717 4:108081717-108081739 ATCCAACTCTTACTACTGGTTGG - Intronic
980959450 4:139460262-139460284 ATTCAAATGGAAATACTGATTGG + Intronic
982418061 4:155160501-155160523 GTACAATTGCTAATACTGCTTGG + Intergenic
989136479 5:38161078-38161100 TTCCAAATGCTAATTGTTGTGGG - Intergenic
992408875 5:76485526-76485548 ATGCAAATGCAAATACTGGGTGG - Intronic
993186795 5:84632170-84632192 ATCTAAATACTAATAATGGGTGG + Intergenic
993409434 5:87555351-87555373 ATCAAAATGCTAATAGTGATAGG - Intergenic
993777249 5:92014613-92014635 ATCCAAAAGCTATTGCTGATTGG - Intergenic
994683228 5:102916230-102916252 ATCCAAATGCTGAGTCTGATTGG + Intronic
995209843 5:109525139-109525161 ATCTAAATGCTAACATTGGAAGG - Intergenic
996250510 5:121324636-121324658 ATCCAAATTCTAATATTGCATGG - Intergenic
996753454 5:126912323-126912345 ATCTAAACGCTAACATTGGTTGG - Intronic
1001624946 5:173124259-173124281 ATAGAAAAGCTAATACTGGCTGG + Intronic
1002112940 5:176932576-176932598 AGCCGAATCCTAATACTGGGAGG + Intronic
1002632244 5:180590061-180590083 ATCCAAATGCTGATCCCTGTGGG - Intergenic
1004179432 6:13368136-13368158 AGCCAAATCCTAGAACTGGTCGG + Intronic
1007029103 6:38611570-38611592 GTCCAAATGCAAATCCTGGAGGG + Intronic
1012157249 6:95834848-95834870 CTCAAAATGCTAATACAGCTTGG - Intergenic
1015638635 6:135306188-135306210 ATAAAAATGCCAATGCTGGTAGG + Intronic
1020198537 7:6061094-6061116 ATACAAATACAAATACTGGCCGG + Intergenic
1020395124 7:7706591-7706613 ATCCAAAGGCACATACTAGTAGG + Intronic
1022764487 7:33395288-33395310 CTTCAAATGCTAATGCTGATTGG + Intronic
1023429307 7:40073289-40073311 AAACAACTGCTAAAACTGGTAGG + Intronic
1026287198 7:68973692-68973714 ATCCAAATGCTTTTATTGGCTGG + Intergenic
1028979544 7:96952223-96952245 ATCACAATGCTAATACTGTTAGG - Intergenic
1030081228 7:105780256-105780278 ATCCAGATGCTGATGCTGGTTGG - Intronic
1031180940 7:118414077-118414099 AACCAAATGCTAAAACTACTGGG + Intergenic
1033388373 7:140901539-140901561 ATCCAAATGCAAATTCCTGTAGG - Intronic
1033577208 7:142696941-142696963 ATTCTAATGTTAATGCTGGTTGG + Intergenic
1033892511 7:146032512-146032534 ATTCAAATGCGAGTAATGGTTGG - Intergenic
1034704783 7:153131100-153131122 ATCAAAATTCTCATACTGGTGGG - Intergenic
1042026167 8:64426096-64426118 AGGCAAATGCTAATAATGTTTGG + Intergenic
1042571359 8:70168615-70168637 TTCAAAATGCTGATACTGGCTGG - Intronic
1044438155 8:92190150-92190172 GTCCAAATGGTAATAGAGGTGGG - Intergenic
1046269644 8:111877553-111877575 AACCCAATCCTAATAGTGGTTGG + Intergenic
1046637372 8:116685609-116685631 CTCCAAATTCTTTTACTGGTGGG - Intronic
1051228540 9:14928834-14928856 ATGAAAATGCTAAGATTGGTAGG - Intergenic
1051310913 9:15770859-15770881 ATCAAAATGTTAAGAATGGTTGG - Intronic
1051581054 9:18674946-18674968 CTCCAATTGGTAAGACTGGTGGG - Intronic
1058940031 9:109804634-109804656 ATCAGAATGCTAATGATGGTGGG + Intronic
1060761554 9:126255188-126255210 ATCCAAGTGCTAATACTTTGGGG + Intergenic
1186880716 X:13863300-13863322 ATCCACATGCTAAGACTATTGGG + Intronic
1187601156 X:20832142-20832164 TTCCAAATACTAACACTGGGGGG - Intergenic
1190167873 X:48088167-48088189 ACCCATATGCAAATAGTGGTAGG - Intergenic
1190817750 X:53943742-53943764 AACCAAATTCCAATACTGGTGGG + Intronic
1193871774 X:86806864-86806886 GGCCAAATGTCAATACTGGTTGG - Intronic
1197228601 X:123978805-123978827 ATCCAAATATTAATATTGTTTGG - Intronic