ID: 1142795702

View in Genome Browser
Species Human (GRCh38)
Location 17:2304946-2304968
Sequence GAGGGGCAACAGGTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 601}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142795702_1142795706 -9 Left 1142795702 17:2304946-2304968 CCTGCCTCCACCTGTTGCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 601
Right 1142795706 17:2304960-2304982 TTGCCCCTCCACAGCCCCATAGG 0: 1
1: 0
2: 1
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142795702 Original CRISPR GAGGGGCAACAGGTGGAGGC AGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900251880 1:1675192-1675214 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900262291 1:1738048-1738070 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900423291 1:2564875-2564897 GAGGAGCTACAGGTTGGGGCAGG - Intronic
900671745 1:3858683-3858705 GAGAAGCAACAGGAGGAGGAAGG - Intronic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
901114674 1:6833093-6833115 GAGGGGAGACAGGTGAAGGCAGG + Intronic
901251545 1:7783800-7783822 GAGGGGCGAGAGGCGGAGTCGGG - Intergenic
901532816 1:9864135-9864157 GAGTGTGATCAGGTGGAGGCAGG + Intronic
901648378 1:10728758-10728780 GAGGGGGGACAGCTGGGGGCCGG + Intronic
902602758 1:17551302-17551324 GATGGGCAACAGCTGAAGGGTGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903369228 1:22824567-22824589 GAGGGAAGACGGGTGGAGGCTGG + Intronic
903835017 1:26198091-26198113 GAAGGGAAACAGCTGGGGGCGGG - Intronic
904431782 1:30469009-30469031 GAGGGGCATGAGGGGGAGGAAGG + Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904722524 1:32521348-32521370 GAGGTGCCACAGGTGTGGGCTGG - Intronic
905011233 1:34748246-34748268 GGGGTGCCACAGGTAGAGGCAGG - Intronic
905254325 1:36670337-36670359 AAGGGGCAACAGCTGGATGTGGG + Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905450699 1:38054202-38054224 GGGGGGTAGCAGGTGGAGGGTGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
906531493 1:46526464-46526486 GGGGTGCAACAAGGGGAGGCTGG - Intergenic
906806632 1:48785395-48785417 GAGAGGCAACAGGTGTACGAAGG + Intronic
908417094 1:63923823-63923845 GAGGGGCATCCAGTGGAGGTGGG - Intronic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
912511051 1:110190379-110190401 GAGGGGAAAGAGGTGGGGGATGG - Intronic
913062410 1:115220444-115220466 GAGGGGAAACAAATGGAGACTGG + Intergenic
913101625 1:115572967-115572989 ACTGGGTAACAGGTGGAGGCTGG + Intergenic
913992534 1:143627884-143627906 GAGGGGCACCTGATGGAGCCTGG - Intergenic
914422373 1:147541317-147541339 GAGGAGGAAAAGGTGGAGGGGGG + Intergenic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
914904733 1:151734598-151734620 GAGGGGAAGCAGGTAGGGGCAGG + Intergenic
915598676 1:156909150-156909172 GAGGGGCAGCAGCTGGACACAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915732618 1:158064970-158064992 GAGGGGCAAGAGTTGGGGGGTGG + Intronic
916156097 1:161850264-161850286 GAGAGGGAACAGGATGAGGCTGG - Intronic
916382803 1:164231647-164231669 GGGGGGCAACAGGGAGAGACTGG + Intergenic
917930431 1:179818895-179818917 GAGGGGGAACTGGTGGAGAGAGG - Intergenic
918182361 1:182095525-182095547 GAGAGGCAAGAGGTGGAAGCAGG - Intergenic
918750759 1:188266365-188266387 AAGGCCCAACAGGTGGGGGCAGG + Intergenic
920033700 1:203052074-203052096 GGTGGGCAAGAGGTGGGGGCTGG + Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
921123065 1:212153403-212153425 GAGGGGCAGGAGGTGGAGGGTGG - Intergenic
921159711 1:212464309-212464331 GAGGGGCAGCAGTGGGAGACAGG - Intergenic
921621722 1:217332890-217332912 GAGTGACATCAGGTGGATGCAGG + Intergenic
922226021 1:223646497-223646519 GAAGAGAAAAAGGTGGAGGCAGG - Intronic
922528575 1:226325544-226325566 TAGGGACAGCAGTTGGAGGCTGG - Intergenic
923454195 1:234148935-234148957 TAGGGGCATGAGGTGGGGGCAGG + Intronic
923463964 1:234231933-234231955 GAGGGGCAGGAGGTAGAGGAAGG - Intronic
923482586 1:234397749-234397771 GAGGGGGAAGAGGGGGAGGAGGG + Intronic
924626466 1:245699860-245699882 GAGGGCCTACAGGTGGAGGCTGG + Intronic
924726589 1:246677021-246677043 GAGGGGCAAAGGATGGAGGGAGG + Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1064837804 10:19554328-19554350 CAGGAGCAAGAGGTGGAGGGAGG + Intronic
1065915285 10:30349909-30349931 AAGGGGCACCAGGAGCAGGCAGG + Intronic
1065959376 10:30722014-30722036 GATGGGCAGCAGGTGGGGGATGG + Intergenic
1067079953 10:43207170-43207192 GAGGGCCAGGAGGTTGAGGCTGG - Intronic
1067682107 10:48447934-48447956 ATGGGGCAGCAGGTGGAGGTGGG - Intronic
1067750064 10:48965628-48965650 GAGGGAGAAGAGGTGGAAGCTGG - Intronic
1068335916 10:55631543-55631565 GAGGGGGAACAGGAGCAAGCAGG - Intergenic
1069754026 10:70762284-70762306 GGAGGGCAACAGGGGGAGGGCGG - Exonic
1070301339 10:75205922-75205944 GAAAGCCAACAGGTGGAGGCTGG - Intergenic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070464938 10:76711864-76711886 AAGGAGCATCAGGTGGGGGCAGG - Intergenic
1070972504 10:80579086-80579108 GAAGGGAGATAGGTGGAGGCTGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071463405 10:85919496-85919518 GATGGGGGACAGGGGGAGGCAGG - Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072350152 10:94549511-94549533 GAGGGGGAATAGTTGGAGTCAGG + Intronic
1073054670 10:100691639-100691661 GAGCTTCAACAGGTGGAGCCTGG + Intergenic
1073135021 10:101215676-101215698 GAGGGGGATGAGCTGGAGGCAGG - Intergenic
1073327230 10:102650008-102650030 GAGGGGCAAGAAGAGGGGGCTGG - Intronic
1074140586 10:110668579-110668601 TTGGGACAACAGGTGGAGGGAGG + Intronic
1074238500 10:111610833-111610855 GAGGAGGAAGAGGAGGAGGCTGG + Intergenic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076724842 10:132408493-132408515 GAGGGGCGGGAGGAGGAGGCTGG + Intronic
1076998607 11:311168-311190 GAGGGGGAAGCGGCGGAGGCGGG + Intronic
1077000136 11:318591-318613 GAGGGGGAAGCGGCGGAGGCGGG - Intergenic
1077054543 11:584549-584571 GAGGGGCAGGAGGAGGTGGCTGG + Intronic
1077304894 11:1864614-1864636 GAGGTGGAAGAGATGGAGGCGGG + Intronic
1077388676 11:2288826-2288848 CAAGAGCAACAGTTGGAGGCAGG - Intergenic
1077481253 11:2815689-2815711 GAGGGGCAATTGGAAGAGGCTGG + Intronic
1077638412 11:3859485-3859507 GAGGGACCTCAGGTGGAGTCTGG + Intronic
1077798603 11:5516461-5516483 GATGGGGAGCAGGTGGAAGCTGG + Exonic
1077879838 11:6340460-6340482 GAGGGGCGAGAGATGGGGGCAGG - Intergenic
1078400348 11:11020788-11020810 TAGTGGCAGCAGGTGGAGTCTGG - Intergenic
1078797522 11:14607634-14607656 CAGGGGGAGCAGGTGAAGGCAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079365798 11:19808253-19808275 GAGGGGCACCAGCTGGAGAGGGG + Intronic
1080402299 11:31947432-31947454 AAGGAGCATCAGGTGGGGGCAGG - Intronic
1080590201 11:33716770-33716792 GAGGGGCAACAGCAGGTGCCAGG - Intronic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1081979029 11:47254740-47254762 GAGGGGGAACAGGCCGGGGCTGG - Intronic
1083398095 11:62405116-62405138 GAGGGGAAACGAGTGAAGGCCGG + Intronic
1083654550 11:64223214-64223236 GATGGGGGACAGGTGCAGGCCGG + Intronic
1084642118 11:70432220-70432242 GAGGGACTAGAGGGGGAGGCCGG - Intronic
1084664675 11:70569999-70570021 GAGACTCAACAGCTGGAGGCAGG - Intronic
1084791633 11:71478635-71478657 GACGGGGAACAGATGGAAGCAGG - Intronic
1084941104 11:72613780-72613802 GAGGGGAAACAGGGGGTGCCAGG + Intronic
1084945108 11:72634161-72634183 AAGGGGCAGCAGGAGGAAGCGGG + Intronic
1085044598 11:73345621-73345643 GAAGGACTAGAGGTGGAGGCTGG + Intronic
1085303731 11:75473548-75473570 GAGGGCCCTCAGGTGGAGGTGGG - Intronic
1087175013 11:95088721-95088743 GTGGGGCTAAAGGAGGAGGCAGG - Intergenic
1087743369 11:101914965-101914987 GAGGAGCTACAGGTCGGGGCGGG - Intronic
1088920521 11:114257276-114257298 GAGGAGGAACAGGTGCAGCCTGG + Intergenic
1089386770 11:118073653-118073675 GAAGGGCAACAGGAGCAGCCGGG + Intergenic
1089773715 11:120821355-120821377 GAGGAGCAAGAGAGGGAGGCAGG + Intronic
1090646978 11:128774165-128774187 CAGGGGCAACACGTGCTGGCTGG + Intronic
1091079243 11:132651072-132651094 TTGGGGCAGCAGGTGGATGCTGG - Intronic
1091358637 11:134957436-134957458 GAGGTGCAGCAGATGGAGACGGG + Intergenic
1091653395 12:2326038-2326060 TGGGGGCAGCAGGGGGAGGCAGG + Intronic
1092198990 12:6568336-6568358 TAGGCGCAACAGGAAGAGGCGGG - Intronic
1092257558 12:6935885-6935907 GAGGGGCCCCAGGAGGAGCCTGG - Exonic
1092860901 12:12718062-12718084 GAGTGGCAAGAGGTGGAGAAGGG + Exonic
1093165681 12:15802630-15802652 AATGGGCAGGAGGTGGAGGCAGG + Intronic
1093569065 12:20644853-20644875 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1094214721 12:27928655-27928677 GAGAGGGATGAGGTGGAGGCTGG + Intergenic
1094555703 12:31497826-31497848 GAGGGGCAAGGGGAGGGGGCAGG + Intronic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1096361298 12:50989845-50989867 GAATGGCTACAGATGGAGGCTGG - Intronic
1096806522 12:54144313-54144335 GAGGGGCAGCAGGTGCTGGTGGG - Intergenic
1096868999 12:54581878-54581900 GAGGGGAAAGAGTTGGAGCCTGG - Intronic
1096991646 12:55809099-55809121 GAGGGGCTAAAGCTGGAGGATGG + Intronic
1097245874 12:57607295-57607317 GAGGAGGAAGAGGTGGGGGCAGG - Exonic
1097288342 12:57894555-57894577 GAGGGTTAGAAGGTGGAGGCTGG + Intergenic
1099413457 12:82359369-82359391 GAGGGGCTGCAGGTGCAGGACGG + Intronic
1100172121 12:91986898-91986920 GAGAGAGAAAAGGTGGAGGCTGG - Intronic
1100385210 12:94099717-94099739 GAGGAGCAGGTGGTGGAGGCAGG + Intergenic
1100386507 12:94109157-94109179 GAGGGGCCTCAGCTTGAGGCAGG + Intergenic
1100468846 12:94873213-94873235 GGTGGGCGACAGGTCGAGGCCGG - Intergenic
1100572316 12:95854395-95854417 GAGGGGCAAGAGATGGGGGGTGG - Intergenic
1102796354 12:115692052-115692074 GAAGGGCAAGAGGTTGAGGTGGG - Intergenic
1103925855 12:124423046-124423068 GTGGGGCAGCAGGAGGGGGCTGG + Intronic
1104391010 12:128390567-128390589 GTGCGGCTACAGGTGGAGGCAGG - Intronic
1104642171 12:130474490-130474512 AAGTGCCAACAGGTGGAGGTGGG + Intronic
1105277190 13:18943259-18943281 GAGAGGCCCCAGGAGGAGGCTGG - Intergenic
1105800037 13:23894974-23894996 GTGGGGCGACAGGCGCAGGCTGG + Intronic
1105848995 13:24318025-24318047 GTGGGGCGACAGGGGCAGGCTGG - Intronic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106394545 13:29367432-29367454 GAGGAGGCACTGGTGGAGGCAGG + Intronic
1106603841 13:31209408-31209430 GAGAGGCAGCTGCTGGAGGCTGG + Intronic
1106933276 13:34690293-34690315 GAGGGGCAGCAGGAGGAGAAGGG - Intergenic
1107831206 13:44374619-44374641 GAGGGAAGACAGGTGGAGTCCGG - Intronic
1108450524 13:50558205-50558227 GAGGGGCCTCAGCAGGAGGCAGG + Intronic
1112461289 13:99605990-99606012 GAAGGTCGGCAGGTGGAGGCCGG + Intergenic
1112678644 13:101735573-101735595 GAGGGGGAAAAGGTGGATACAGG - Intronic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1113538963 13:111092070-111092092 GAGGAGGAACAGGAGGAGGTGGG + Intergenic
1113539199 13:111093424-111093446 GAGGGGAGAGAGGTGAAGGCAGG + Intergenic
1113805945 13:113110096-113110118 GAGGGGCCCCAAGCGGAGGCGGG + Intronic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1114739446 14:25080305-25080327 GACTGGCAGCCGGTGGAGGCTGG - Intergenic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115752471 14:36505999-36506021 GAGGGGCAGAGGGTGGGGGCTGG + Intronic
1115957156 14:38794158-38794180 GTGGGGGAACTGGAGGAGGCTGG - Intergenic
1116571716 14:46525603-46525625 GTGGGGCATCAGTTGGAGGGGGG + Intergenic
1118548572 14:66922773-66922795 GAGGGGAAAGAGGGGGAGGTGGG - Exonic
1118749363 14:68795284-68795306 GAGCGGGAATGGGTGGAGGCCGG - Intronic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1120178877 14:81323319-81323341 GGGAGGCAAATGGTGGAGGCTGG - Intronic
1121358709 14:93235601-93235623 AATGTGCAACAGGTGGAAGCAGG - Intergenic
1121469937 14:94144868-94144890 GAGAGGGGACAGGAGGAGGCAGG - Intergenic
1121588710 14:95082694-95082716 GAGGGGAAAAGGGTGGAAGCAGG + Intergenic
1121700871 14:95953200-95953222 GATGGGCAAGAGGTGGGCGCTGG - Intergenic
1121888984 14:97571842-97571864 GAGAGGCATCAGGTGGACTCTGG + Intergenic
1122775185 14:104113855-104113877 GAGGGGCTGCAGGTGGAGGGAGG + Exonic
1122812180 14:104294465-104294487 GCGGGGGAACAGGTGAAGGTGGG + Intergenic
1123108795 14:105855656-105855678 GAGGGGAAGCAGGTGGGGTCTGG - Intergenic
1123139636 14:106062422-106062444 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123141948 14:106088395-106088417 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123145922 14:106129810-106129832 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123148122 14:106153901-106153923 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123149241 14:106165476-106165498 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123154513 14:106211209-106211231 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123156871 14:106235335-106235357 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123158883 14:106258041-106258063 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123160000 14:106268879-106268901 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123172718 14:106389663-106389685 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123175279 14:106410761-106410783 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123178378 14:106443402-106443424 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123180345 14:106463534-106463556 GAGGCGCAGCTGGTGGAGTCTGG - Intergenic
1123187953 14:106538083-106538105 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123189710 14:106557215-106557237 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123192751 14:106586649-106586671 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123193424 14:106592946-106592968 GAGGTGCAGCTGGTGGAGACTGG - Intergenic
1123197622 14:106631471-106631493 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123198972 14:106643403-106643425 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123200414 14:106657996-106658018 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123201231 14:106666357-106666379 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123202056 14:106675285-106675307 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123207642 14:106728433-106728455 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123212658 14:106775436-106775458 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1123214147 14:106790971-106790993 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123215210 14:106802971-106802993 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1123216123 14:106810713-106810735 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1202946552 14_KI270726v1_random:33118-33140 GAGGCGCAGCTGGTGGAGGCTGG + Intergenic
1123401141 15:19987935-19987957 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123440798 15:20289719-20289741 CAGGGGCAGCAGGTGGAGAGCGG + Intergenic
1124048030 15:26169048-26169070 GAGGAGCACCAGGTGTTGGCCGG + Intergenic
1124211641 15:27769609-27769631 TAGGGGGAACAGGTGGTGTCTGG - Intronic
1124636322 15:31367126-31367148 AAGGGAGAACGGGTGGAGGCGGG - Intronic
1125490702 15:40146643-40146665 CACGGGCAAAAGATGGAGGCTGG + Intergenic
1126583029 15:50258456-50258478 GAGGGCCAAGAGGTGAGGGCTGG + Exonic
1126830489 15:52598391-52598413 GTGGGGCATTAGGTGGAGTCTGG - Intronic
1126920248 15:53513405-53513427 GTGGGGCTGGAGGTGGAGGCTGG + Intergenic
1126990895 15:54374392-54374414 GAGGGGCATGAGAGGGAGGCCGG - Intronic
1128286967 15:66445138-66445160 GAGGGGCAGCGGGGGGAGGTGGG + Intronic
1128565014 15:68695336-68695358 GAAGGGCAAAGGGTGGAGGAGGG - Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1129320167 15:74770345-74770367 GATAGGGCACAGGTGGAGGCAGG - Intergenic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129668281 15:77591967-77591989 GAGGCCCGGCAGGTGGAGGCAGG + Intergenic
1130386593 15:83417397-83417419 GCTGGGGAACAGGTGGAGGTGGG - Intergenic
1131056216 15:89376907-89376929 GAAGGGCAGCAGCTGGGGGCTGG + Intergenic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1132234043 15:100205930-100205952 GAGGGCAAACAAGTGGAGACTGG + Intronic
1132539963 16:504128-504150 GAGGGGGTACAGGAGGAGGTGGG - Intronic
1132541006 16:509752-509774 GAGGGGCCACAAGTGGGGGGGGG - Intronic
1132663422 16:1071406-1071428 GAGGGGCAGCAGATGGAGATGGG + Intergenic
1132680931 16:1141496-1141518 GAGGGGCAGGAGCTGGAGGAAGG + Intergenic
1132682401 16:1148458-1148480 GAGGGGCTGCAGGCGGAGGCTGG - Intergenic
1132748031 16:1445104-1445126 GAGGCGCTCCAGGTGGAGGGGGG - Exonic
1132856293 16:2046395-2046417 GTGGGGCCACAGGTGAAGGTAGG + Intronic
1132869671 16:2110248-2110270 GAGGGGCTGCAGGTGGTGGGCGG - Exonic
1133189800 16:4125221-4125243 CAGGGGCAGGAGGTGGAAGCTGG + Intergenic
1134001969 16:10789894-10789916 GAGGGGCAGGAGGAGGGGGCTGG + Intronic
1134692100 16:16197719-16197741 GGGGGGCAGGAGGAGGAGGCTGG + Intronic
1134717747 16:16365354-16365376 GAGGGGCTGCAGGTGGTGGGCGG + Intergenic
1134955752 16:18381481-18381503 GAGGGGCTAGGGGAGGAGGCAGG + Intergenic
1134957005 16:18386805-18386827 GAGGGGCTGCAGGTGGTGGGCGG - Intergenic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135187620 16:20328804-20328826 GAGGGGGAAGGGGTGGAGGATGG - Intergenic
1135423936 16:22323018-22323040 CAGAGGCTCCAGGTGGAGGCGGG + Intronic
1136680977 16:31962088-31962110 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136686181 16:31996161-31996183 AAGGTGCTACAGGTGGAGGGCGG + Intergenic
1136694537 16:32066065-32066087 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136726057 16:32358671-32358693 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1136795035 16:33009329-33009351 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136873268 16:33827366-33827388 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136874877 16:33845053-33845075 GAGGTGCAGCTGGTGGAGTCTGG - Exonic
1136888502 16:33950239-33950261 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1138244613 16:55458189-55458211 GAGGGACAAAAGGCAGAGGCAGG + Intronic
1138458684 16:57135271-57135293 GCGGGGGATCAGGGGGAGGCAGG + Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139209703 16:65065232-65065254 GAGGGGCATGAGGTGGAGAGTGG - Intronic
1139290162 16:65850672-65850694 GAGGGGAAAAAGGTCAAGGCAGG + Intergenic
1139962411 16:70725526-70725548 GAGGGGGAATAGGTGGAGTGGGG - Intronic
1140714046 16:77705983-77706005 AAGGGACAACAGGTGGCTGCAGG - Intergenic
1141336497 16:83160265-83160287 GGGAGGCTACATGTGGAGGCAGG + Intronic
1141993484 16:87622994-87623016 GAGGGGGACCTGGTGGAGGTCGG + Intronic
1142135363 16:88449511-88449533 CAGGGGCAGAAGCTGGAGGCCGG - Intergenic
1142284983 16:89167981-89168003 GAGGGGCTGCTGGTGGGGGCGGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142379625 16:89723896-89723918 GAGGAGCAAGAGGCGGAGACAGG - Intronic
1203000374 16_KI270728v1_random:159085-159107 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203083951 16_KI270728v1_random:1167583-1167605 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1203097295 16_KI270728v1_random:1270984-1271006 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1203131976 16_KI270728v1_random:1695488-1695510 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203154556 16_KI270728v1_random:1865015-1865037 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1142499494 17:324273-324295 GAGGCGGAGCAGGTGGAGGCAGG - Intronic
1142667794 17:1472391-1472413 GAGGGGTAAGGGGTGGAGTCTGG - Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1142795702 17:2304946-2304968 GAGGGGCAACAGGTGGAGGCAGG - Intronic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144218658 17:13080233-13080255 CGCAGGCAACAGGTGGAGGCGGG - Intergenic
1144855102 17:18263184-18263206 TAAGGGCAGCAGGTGGAGGCCGG - Exonic
1144867301 17:18344904-18344926 CAGGGGCTGAAGGTGGAGGCAGG + Intronic
1145749521 17:27345201-27345223 GAGGGGGTGCAGGTGGGGGCAGG - Intergenic
1146469185 17:33110776-33110798 GGGTGGCAACAGGTAGGGGCTGG + Intronic
1146770982 17:35568421-35568443 GAGGGCCATGAGGTAGAGGCTGG + Intergenic
1146933093 17:36791962-36791984 GAGGGGGAAAAGGTAGAGGGGGG + Intergenic
1147155339 17:38541982-38542004 CAGAGGCTCCAGGTGGAGGCTGG + Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147462429 17:40581937-40581959 CAGGGGCAAGAGGTGGGGGCAGG - Intergenic
1147993596 17:44349783-44349805 GACGGGCAGCATGTGGAGTCTGG + Intronic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148866355 17:50630787-50630809 GAGGGGCACCAGGTGGCACCAGG - Intergenic
1149493990 17:57105573-57105595 GATGAGCAGCAGGTGGAGGCTGG + Exonic
1149525304 17:57350991-57351013 GAGGGGCAAGAGGAGGGAGCAGG + Intronic
1150221983 17:63500940-63500962 GAGAGGCAACATGGGGAGGGAGG - Intronic
1151421162 17:73998900-73998922 TAGGGGCTTGAGGTGGAGGCAGG - Intergenic
1151733551 17:75925047-75925069 CAGGGGCTTTAGGTGGAGGCAGG + Intronic
1151911257 17:77084855-77084877 GAGAGGAAGCAGGTGGGGGCAGG - Intergenic
1152036063 17:77874009-77874031 GAGGGGCTACTGGTGCAGGAAGG - Intergenic
1152120129 17:78413390-78413412 GAGGGGCAACTCGGGGATGCTGG + Intronic
1152193592 17:78903156-78903178 GCCGGGCTGCAGGTGGAGGCGGG - Exonic
1152336030 17:79700615-79700637 GAGGGACAGGAGGTGGAGGCAGG + Intergenic
1152849129 17:82621490-82621512 GAGGGGCTCCAGGTTGGGGCAGG + Intronic
1152908642 17:82984413-82984435 GAGAGGCCACAGGAGGACGCAGG + Intronic
1152908648 17:82984436-82984458 GAGAGGCCACAGGAGGATGCAGG + Intronic
1152908658 17:82984483-82984505 GAGAGGCCACAGGAGGACGCAGG + Intronic
1152908664 17:82984506-82984528 GAGAGGCCACAGGAGGATGCAGG + Intronic
1152923088 17:83075466-83075488 GAAGGTCATCAGGTGGAGGCTGG + Intergenic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153544532 18:6192450-6192472 GTGTGGCAACAGGAGCAGGCAGG + Intronic
1154309176 18:13254276-13254298 GAGGGGCCCCAGGTGGACTCAGG + Intronic
1154496314 18:14963782-14963804 GAGGTGCAGCAGATGGAGTCAGG - Intergenic
1155688808 18:28590490-28590512 GAGGGGCAAGAGATGGGGTCAGG - Intergenic
1155928676 18:31684649-31684671 GAGGGACAAGAGGTGGAGGGGGG + Exonic
1156007675 18:32462931-32462953 GCGGGGCAACTGGGGGAGGTTGG + Intronic
1156457879 18:37304880-37304902 GAGGGGGAGCAGGTGGGGGCTGG + Intronic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1157494089 18:48142864-48142886 GAGGAGCAAAAGGAGGAGGAAGG - Intronic
1157566849 18:48684146-48684168 GTGGGGCCACAGGTGCAGGTGGG + Intronic
1157643175 18:49238910-49238932 GAGGGGCAGCATTTGGAGGGTGG - Intronic
1158389892 18:57036223-57036245 GCGGGGCAAAGGGTGAAGGCAGG + Exonic
1158437525 18:57443709-57443731 GATGGGCAAGACTTGGAGGCAGG + Intronic
1158684232 18:59598539-59598561 GAGGCACAGCAGGTGCAGGCTGG + Intronic
1160208694 18:76858794-76858816 GAGAGGGCTCAGGTGGAGGCAGG + Intronic
1160208736 18:76858926-76858948 GAGAGGGCTCAGGTGGAGGCGGG + Intronic
1160208751 18:76858970-76858992 GAGAGGGCTCAGGTGGAGGCGGG + Intronic
1160208764 18:76859014-76859036 GAGAGGGCTCAGGTGGAGGCAGG + Intronic
1160208807 18:76859146-76859168 GAGAGGGCTCAGGTGGAGGCGGG + Intronic
1160208834 18:76859234-76859256 GAGAGGGCTCAGGTGGAGGCGGG + Intronic
1160319252 18:77875074-77875096 GAGGGTGGAGAGGTGGAGGCTGG - Intergenic
1160409420 18:78665489-78665511 GATGGTCCACAGGTGAAGGCAGG + Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160575181 18:79849104-79849126 GAGGGGCTCGATGTGGAGGCGGG - Intergenic
1160583593 18:79901005-79901027 GAGGGGCCACACGCCGAGGCCGG + Intergenic
1160686532 19:439313-439335 GAGGGGCCAGAGCTGGGGGCCGG - Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161114505 19:2489161-2489183 GGCGGGCAACAGAGGGAGGCTGG - Intergenic
1161199436 19:3006308-3006330 GTGGGGCTACAGGTGAAGGGCGG - Intronic
1161233143 19:3185611-3185633 GAGGGGCGAAAGGTGGGGACAGG - Exonic
1161346169 19:3769868-3769890 GTGGGCCTCCAGGTGGAGGCGGG - Exonic
1161351004 19:3791637-3791659 GAAGGGGAGGAGGTGGAGGCTGG - Intronic
1161735660 19:5990779-5990801 GAGGGGCAGCAGCCAGAGGCAGG + Intergenic
1162366554 19:10252952-10252974 GAGGGACAAGAGGGGAAGGCAGG - Intronic
1162588666 19:11577018-11577040 GTGGGGCAGGAGGTGGGGGCGGG - Intronic
1162697073 19:12484716-12484738 GAAGGGCCTCAGGTGGAGGTAGG - Exonic
1162897646 19:13774899-13774921 GAGGGGTAAGAGGTGGAAGCTGG + Intronic
1163115679 19:15187560-15187582 GTGGGGCCACAGCTGGGGGCGGG - Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1164868632 19:31625610-31625632 GAGGAGGAAGAGGAGGAGGCTGG - Intergenic
1165144759 19:33724198-33724220 GTGGGGTAACCGGTGGAGCCTGG - Intronic
1165580009 19:36854286-36854308 GAGGAGGAAGAGGTGGAGGAGGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166280906 19:41792601-41792623 GAAGGGCAGGGGGTGGAGGCAGG - Intergenic
1166851721 19:45764562-45764584 GTGGGGCAGCAGGGGGACGCAGG - Intergenic
1166874823 19:45890886-45890908 GTGGGGGCAGAGGTGGAGGCAGG + Exonic
1166978201 19:46617353-46617375 GAGGGGCAAAGGGTGGATGGGGG + Intergenic
1166990867 19:46691902-46691924 GGAGGGCATCAGGTGGGGGCAGG + Intronic
1167112846 19:47472013-47472035 GAGGGGGAGGAGGCGGAGGCGGG + Exonic
1167473171 19:49686561-49686583 GGGGGGCAGCAGGCCGAGGCCGG + Intronic
1167499144 19:49835813-49835835 GAGGGGCACCTGGCGGGGGCTGG - Exonic
1168296190 19:55378303-55378325 CTGGGGTAACAGGTGGGGGCTGG + Intergenic
1168414280 19:56158910-56158932 GAGGGGGAACATGTGAAGGATGG - Intronic
925565848 2:5253311-5253333 GGGGAGCAACAGCTAGAGGCAGG + Intergenic
926090224 2:10044292-10044314 GCGGGGCAACGCTTGGAGGCGGG + Intronic
926367244 2:12144694-12144716 GTGGGGCAGCAGGTAGAGACAGG - Intergenic
926872587 2:17439648-17439670 GAGGCAGAAGAGGTGGAGGCTGG - Intergenic
927486545 2:23492030-23492052 GGAGGGAAAAAGGTGGAGGCAGG - Intronic
927736356 2:25526055-25526077 CAGGAGCCCCAGGTGGAGGCAGG + Intronic
927783203 2:25955383-25955405 GGTGAGCAACAGGGGGAGGCAGG - Intronic
927847186 2:26477617-26477639 GAGGGGCGGCAGGTGGGGGGAGG - Intronic
929720011 2:44358631-44358653 CAGGGACAACAGGTGTAGGCTGG + Intronic
930860837 2:56071206-56071228 CAGGGCCAACAGGTGGCTGCTGG + Intergenic
931801023 2:65757727-65757749 AATGGGTAACAGGTGGAGGTTGG - Intergenic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
932954628 2:76337251-76337273 GAAGGACATCAGGTGGGGGCAGG + Intergenic
933194135 2:79369716-79369738 TATGGGCAAAGGGTGGAGGCAGG - Intronic
934319830 2:91961910-91961932 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
934511557 2:94948133-94948155 GAGGTGCAACTGGTCGAGTCTGG - Intergenic
934513889 2:94971985-94972007 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
936234532 2:110732185-110732207 GAGGGGCCAGAGCTGGAGCCAGG + Intergenic
937045040 2:118846745-118846767 GAGGCGCAGGAGGAGGAGGCCGG - Exonic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938317414 2:130339762-130339784 GAGGAGCAACACCTGGGGGCAGG - Intronic
939560259 2:143723331-143723353 GAGGGGCTGAAGGAGGAGGCTGG + Intronic
939960589 2:148561795-148561817 AAGGGGCAATACGAGGAGGCTGG - Intergenic
940133826 2:150413680-150413702 GTGGGGGAACAGGTTGATGCTGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
942450750 2:176106881-176106903 GAGGGGGAAGAGGGGGAGGAAGG - Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942783670 2:179675607-179675629 GAGAGGAAACAGGTGGAGTAAGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
944932050 2:204529859-204529881 CAGGGGCAACAAGCAGAGGCTGG - Intergenic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
946201995 2:218075920-218075942 GTGGGGCAATAGGGAGAGGCGGG - Intronic
947411679 2:229847973-229847995 AAGAGGCCACAGATGGAGGCAGG - Intronic
947742844 2:232492740-232492762 GAGGGGCCAGAGCTGGAGACAGG - Intergenic
947864181 2:233384740-233384762 GAGGGGTGAAATGTGGAGGCTGG - Intronic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948433579 2:237936621-237936643 GATGGCAAACAGGTGGGGGCAGG + Intergenic
948676059 2:239597379-239597401 GAGGGTGCAGAGGTGGAGGCTGG + Intergenic
948867184 2:240782170-240782192 ACGGGGCCACAGGGGGAGGCGGG - Intronic
949057476 2:241936495-241936517 GGGGGCCATCAGGTGGGGGCTGG - Intergenic
1170570882 20:17631822-17631844 AAGGGGCCTCAGGTGAAGGCAGG + Intronic
1171091012 20:22285830-22285852 GAGGGGCAAGAGATGGGGGGAGG - Intergenic
1171188557 20:23141705-23141727 GAGCAGCAGCAGGTGCAGGCAGG + Intergenic
1171242353 20:23581977-23581999 AAGGGCCATCAGGTGGGGGCGGG + Intergenic
1171981735 20:31633452-31633474 GAGGGCCATGGGGTGGAGGCCGG - Intergenic
1172029948 20:31974920-31974942 GATGGGCAAGGGGAGGAGGCAGG - Intronic
1172033304 20:31996071-31996093 GTGGGCCACCAGGAGGAGGCCGG - Intronic
1172877916 20:38177282-38177304 GAAGGGCAGCAGGAGGAGGTGGG + Intergenic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174043195 20:47714553-47714575 GATGGGCTGAAGGTGGAGGCAGG - Intronic
1174572158 20:51509492-51509514 GAAGGGAAAGAGGTGGTGGCCGG - Intronic
1175531105 20:59674707-59674729 GAGGGGGAACAGGAGAAGGGGGG - Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175531148 20:59674844-59674866 AAGGGGCAACAGGAGAAGGCAGG - Intronic
1175575855 20:60060352-60060374 GAGGGTCCACAGGCAGAGGCTGG + Intronic
1176025196 20:62982109-62982131 GAGGGGCAACAGGAGGCAGCAGG + Intergenic
1176071095 20:63226788-63226810 TGGGGCCCACAGGTGGAGGCAGG + Intergenic
1176287065 21:5023822-5023844 AAGGGGCTAAGGGTGGAGGCAGG + Intronic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1176364771 21:6026264-6026286 GAGGGGCGACAGGGGCAGCCAGG - Intergenic
1177483767 21:21728409-21728431 GAGGAGCAACAGGAGGAAGTTGG - Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1177567400 21:22843234-22843256 GAGGGGCAAATGATAGAGGCAGG - Intergenic
1178959041 21:37047395-37047417 AAGGGCCATCAGGTGGGGGCAGG - Intergenic
1179276151 21:39893548-39893570 GAGGGGCCACAGGAGGATCCAGG - Intronic
1179758747 21:43512281-43512303 GAGGGGCGACAGGGGCAGCCAGG + Intergenic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1179870116 21:44239653-44239675 AAGGGGCTAAGGGTGGAGGCAGG - Intronic
1179972021 21:44841328-44841350 GAGGGTCGCCAGGTGGAGGCTGG - Intergenic
1180308080 22:11145954-11145976 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180342010 22:11627496-11627518 GGGGGGGAACGGGTGGAGCCAGG - Intergenic
1180546556 22:16507767-16507789 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1181630092 22:24146480-24146502 GAGAGGCAGCAGGTGGAGAGGGG + Intronic
1181639247 22:24188158-24188180 GAGTGGGGACAGGTGCAGGCAGG - Intronic
1181711873 22:24696215-24696237 GAGGGGGAAGAGGGGGAGGAGGG - Intergenic
1181883376 22:25999528-25999550 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1182212627 22:28689587-28689609 CAGGGGCAGCAGGTGGAGAGTGG - Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184663878 22:45977472-45977494 GCGGGGGTACAGGTGGGGGCGGG + Intergenic
1184778501 22:46635144-46635166 GAGTGGCCAGGGGTGGAGGCAGG - Intronic
1185217845 22:49613304-49613326 GAGGTGGAGCAGGTGGAGGTGGG - Intronic
1185402078 22:50624423-50624445 GTGGGTCAAAAGGTGAAGGCAGG + Intronic
949897330 3:8778016-8778038 AAAGAGCAAGAGGTGGAGGCTGG - Intronic
949976976 3:9469981-9470003 GAAGGGAAAAAGGTGGAGGAAGG - Intronic
950172821 3:10851273-10851295 AAGTGGCAATAGGAGGAGGCGGG - Intronic
950228900 3:11259105-11259127 CAGGGGCATCAGCTGGGGGCTGG - Exonic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
950581206 3:13863246-13863268 GCTGGGCCACAGGTGGAGGGAGG - Intronic
952421534 3:33136056-33136078 CAGGGGCTGGAGGTGGAGGCAGG - Intronic
953405846 3:42659400-42659422 GAGGGGGAGGAGGGGGAGGCTGG + Exonic
953572135 3:44079503-44079525 GAGGCACGGCAGGTGGAGGCAGG + Intergenic
954366836 3:50150980-50151002 GGGTGGCACCAGGAGGAGGCAGG - Intergenic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
955318905 3:57960442-57960464 GAAGAGGAAGAGGTGGAGGCAGG + Intergenic
955503546 3:59608556-59608578 GTGAGGCAGCAGGTGGAGACTGG - Intergenic
957154786 3:76533893-76533915 GAGGGTCAATCGGTGAAGGCAGG + Intronic
957155404 3:76537996-76538018 GAGGGTCAATCGGTGAAGGCAGG + Intronic
957444356 3:80295779-80295801 GAGGAGGAAGAGGTGGAGGAGGG - Intergenic
958013812 3:87914727-87914749 AAGGCGCATCAGGTGGGGGCAGG - Intergenic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961147962 3:124611098-124611120 GAGTGGCAGCATGTGGAGGTGGG + Intronic
961749704 3:129087974-129087996 GAGTGGGAACAGGTGGGGTCAGG - Exonic
962335577 3:134527411-134527433 GAAGGGGCACTGGTGGAGGCAGG + Intronic
963046579 3:141106962-141106984 AAGGAGCAACAGGTGGACCCAGG - Intronic
963239114 3:142985419-142985441 GAGGGGCACCAGGTCAAAGCAGG + Intronic
963728386 3:148947033-148947055 GAGCGCAGACAGGTGGAGGCGGG + Intergenic
966103790 3:176310418-176310440 GAAGGGCCACAGTTAGAGGCAGG - Intergenic
966690947 3:182740849-182740871 GAACGGCAGCAGGTGGAGACTGG + Intergenic
969504641 4:7577278-7577300 GTGGGGAGACAGGTGAAGGCAGG + Intronic
969568232 4:7992725-7992747 GAAGGGCATCAGGCAGAGGCAGG + Intronic
969674183 4:8606127-8606149 GGAGGGCAGCAGGTGGATGCGGG - Exonic
969788333 4:9474918-9474940 GGGGGGCAAGAGGCGCAGGCTGG - Intergenic
969788421 4:9475173-9475195 GAGGGGCAAGAGGGGCTGGCTGG - Intergenic
969881658 4:10179208-10179230 GAGGGGGAAAAGGTAGAGGCTGG + Intergenic
969890886 4:10258995-10259017 GTGGGCAGACAGGTGGAGGCTGG + Intergenic
971263254 4:25076157-25076179 GAGCAGCAGCTGGTGGAGGCTGG + Intergenic
971570938 4:28209992-28210014 GAGGGGGAAGAGGGGGAGGAAGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972335977 4:38107285-38107307 GGGAGGTAACAGGTGGAGTCTGG - Intronic
972440044 4:39079206-39079228 TAGGGGCAAAGAGTGGAGGCAGG - Intronic
972557958 4:40199378-40199400 GTAGGGTGACAGGTGGAGGCTGG + Intronic
972637551 4:40897675-40897697 GAGAGGAAACAGGTGTAAGCGGG + Intronic
973952433 4:56030127-56030149 GTGGGGCACCATGTAGAGGCAGG - Intronic
974072055 4:57132783-57132805 TAGGGGGAAAAGGTGGAGGTGGG + Intergenic
976669173 4:87632936-87632958 GAAGGGGAACAGGTGGTGGGGGG + Intergenic
976783302 4:88786254-88786276 GAGGGCTAGCAGGTGGAGGTGGG - Intronic
977021704 4:91768525-91768547 TAGGGGCAACAGGCTGGGGCTGG + Intergenic
979581971 4:122371415-122371437 GAGGGGCAAGAGTGGGAAGCAGG + Intergenic
980193652 4:129559372-129559394 ACTGGGCAACAGGTAGAGGCTGG - Intergenic
982381715 4:154755936-154755958 GAGGGACAATAGGCAGAGGCAGG + Intergenic
983035892 4:162865191-162865213 TAAGGCCATCAGGTGGAGGCAGG - Intergenic
983164002 4:164452175-164452197 AAGGGGTCACAGGTGGTGGCAGG - Intergenic
984171848 4:176368761-176368783 GAGGGACAACACTTGCAGGCAGG - Intergenic
984324957 4:178241029-178241051 GAGGGGCAAGTGGTGGTGGCAGG + Intergenic
985524461 5:394987-395009 GGGGGGCGACAGCAGGAGGCTGG - Intronic
985903894 5:2818334-2818356 GAGTGTTGACAGGTGGAGGCTGG + Intergenic
986285760 5:6357332-6357354 GGGGGGCAAGATGTGGAGGTGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987642453 5:20629594-20629616 ACTGGGTAACAGGTGGAGGCTGG - Intergenic
990764385 5:59166016-59166038 GTGGGGCGACAGGTGGTGGTGGG - Intronic
991275667 5:64843903-64843925 GAGGGGCAGCAGTGGGAGGCAGG - Intronic
991432332 5:66561475-66561497 CAGGGGCAACAACTGGAGGGTGG - Intergenic
991475193 5:67011266-67011288 GAGGAGCAACAAGTGGGGCCAGG - Intronic
991650984 5:68853142-68853164 GATGTGGAAGAGGTGGAGGCAGG - Intergenic
991923889 5:71684459-71684481 AAGGGCCACCAGGTGTAGGCAGG - Intergenic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
992349626 5:75915848-75915870 GAGGGGCAACTGGTCAAGGCAGG + Intergenic
992388693 5:76310757-76310779 GAGAGGCAAGAGTTGGAGTCTGG + Intronic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
996124134 5:119706047-119706069 AAGGACCATCAGGTGGAGGCAGG + Intergenic
998283588 5:140836211-140836233 GAGTTGCAACCGGTGGCGGCCGG + Exonic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
1000368700 5:160514844-160514866 AAGTGGGAACAGGTAGAGGCAGG - Intergenic
1001329570 5:170752668-170752690 GAGGGGCTCCAGGTGGAGAGAGG - Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001961364 5:175882121-175882143 CAGGGGCACAAGGTGGGGGCGGG - Exonic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002108702 5:176893532-176893554 GAGGAGCACCAGCTGGAAGCAGG + Intronic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002189390 5:177470836-177470858 GTGGTGCACCAGGTGGAAGCTGG + Intronic
1002523034 5:179801745-179801767 GAGGGGGAAAAGGCGGGGGCGGG - Intronic
1002617429 5:180464422-180464444 GGGGGGCTCCAGGTGGAGGCAGG - Intergenic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1005839359 6:29731409-29731431 GAGGGGCCAGAGGAGGAGGTGGG + Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006026928 6:31152901-31152923 GTGGGACAACAGGTGAAGGCGGG - Intronic
1006515680 6:34544396-34544418 GGGGGGCAGCAGGAGGTGGCTGG + Exonic
1006745231 6:36336977-36336999 GGGTGGTAACAGGTGGAGGAAGG - Intergenic
1006922269 6:37634762-37634784 GAAGGGCACAAGGTGGAGGGGGG - Exonic
1007247460 6:40472754-40472776 GTGAGGCAGCAGGTGCAGGCAGG - Intronic
1007615804 6:43179360-43179382 GAGGGAGGACGGGTGGAGGCAGG - Exonic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1012052650 6:94362699-94362721 GAGGTGCAAGTGGTGGCGGCAGG - Intergenic
1012471710 6:99579877-99579899 CAGGAGCAAGAGGTGGAGGCTGG - Intergenic
1012477921 6:99635408-99635430 GAGAGGCAAGATTTGGAGGCTGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014802320 6:125790896-125790918 GAGGAGCAAGAGGAGGAGGCGGG - Exonic
1015218523 6:130777859-130777881 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1017018373 6:150119431-150119453 GAGGGACCACAGGAGGAAGCTGG + Intergenic
1017547647 6:155469070-155469092 ACTGGGTAACAGGTGGAGGCTGG - Intergenic
1018040297 6:159915887-159915909 GAGGGGCAGGAGGTGGGGGTCGG - Exonic
1018376706 6:163219732-163219754 GGGAGGCAGCAGGAGGAGGCAGG - Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019273790 7:165173-165195 GGGAGGGAACAGGTGGAGGTGGG + Intergenic
1019404631 7:877072-877094 AGGAGGGAACAGGTGGAGGCTGG - Intronic
1019593227 7:1846176-1846198 GAAGGGCAGCAGGGGGAGACTGG - Intronic
1019799145 7:3075132-3075154 GAGGTGCAAGGGGTGGAGGTGGG - Intergenic
1020084539 7:5303365-5303387 GAGGGGTCCCTGGTGGAGGCTGG - Exonic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1021329083 7:19312608-19312630 GAGGGGCAACAGGAGGTCCCTGG + Intergenic
1022091881 7:27113433-27113455 GAGAGGCAAGAGGTGGGGGCGGG + Intronic
1022193931 7:28045156-28045178 GAGGGGCAGGAGGTGGGGGTGGG + Intronic
1023138534 7:37077757-37077779 GAGGAGCCACAGGTGGAGAGAGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023862415 7:44224571-44224593 GTGAGGCAACAGGTCCAGGCAGG + Intronic
1024220264 7:47281539-47281561 GAGGGGCTGCAGGTGGCTGCAGG - Intronic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1025904381 7:65772101-65772123 GTGGGGCCACAGGTGGACACAGG - Intergenic
1025943059 7:66087613-66087635 GTGGGGCAACAGCTGGGGGGAGG - Intronic
1026095331 7:67342124-67342146 GAGGGGCAGGACGTGGAGGCAGG - Intergenic
1027542987 7:79491812-79491834 GAGGTGGAAAAGGTGGAGGAAGG + Intergenic
1028477581 7:91267384-91267406 AGGGGGCAAAAGGAGGAGGCGGG - Exonic
1028522529 7:91747674-91747696 GAGGGGCAACTGGCAGTGGCAGG - Intronic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1029182314 7:98711916-98711938 GAGGGGCTACAGCTAGAGTCAGG + Intergenic
1029423941 7:100485286-100485308 GTGGGGCAGGAGGTGGGGGCTGG - Exonic
1029558227 7:101285296-101285318 GAGGGGACTAAGGTGGAGGCAGG + Intergenic
1029739099 7:102482029-102482051 GGGGGGCAACCGGGGGAGGAAGG + Intergenic
1029757100 7:102581208-102581230 GGGGGGCAACCGGGGGAGGAAGG + Exonic
1029775041 7:102680269-102680291 GGGGGGCAACCGGGGGAGGAAGG + Intergenic
1030501011 7:110358630-110358652 GTGGGACAAGATGTGGAGGCAGG - Intergenic
1031913158 7:127538697-127538719 GAGGACTAACAGTTGGAGGCTGG - Intergenic
1032090552 7:128909644-128909666 GAAGGGGCACAGATGGAGGCAGG - Intronic
1032248689 7:130234332-130234354 AAGGGGCCCCAGGTGGAGGAGGG + Intergenic
1032274450 7:130441750-130441772 GAATGGGAACAGGTGGTGGCTGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1032796810 7:135284146-135284168 AAGTGGCAACAGATGGAGGTGGG - Intergenic
1034781432 7:153886316-153886338 CAGGGGCAGCAGGTGGAGACGGG + Intergenic
1035122649 7:156581131-156581153 GAGGGGCCTCAGGTGGAGAGAGG + Intergenic
1035291680 7:157843462-157843484 GAGGAGCTCCAGGTGGAGGAAGG - Intronic
1035720314 8:1786216-1786238 GAGGGGCTGCAGGAGGAGGGGGG + Exonic
1036242670 8:7092696-7092718 GAGGGGCATGTGGTGGGGGCAGG + Intergenic
1036649824 8:10635096-10635118 GGGAGGGAACAGGTAGAGGCTGG + Intronic
1037013408 8:13873404-13873426 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1037587479 8:20288040-20288062 GAGAGGCAGGAGGTGGGGGCTGG - Intronic
1037877486 8:22555058-22555080 GAGGGGCAGCAGCTGGAGATGGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038625944 8:29193323-29193345 GAGGAGCAAAAGGAGGAGGATGG + Intronic
1038661620 8:29502472-29502494 GAGGGACAACAGGAGGGGTCTGG - Intergenic
1040582529 8:48708981-48709003 GAGGGGCAGTGGGAGGAGGCGGG - Intergenic
1041142972 8:54842782-54842804 TGGGGGCAGCAGGTGGTGGCGGG - Intergenic
1042304129 8:67313873-67313895 AAGGACCATCAGGTGGAGGCAGG + Intronic
1043463762 8:80486154-80486176 GAGGGGGAAAGGGTGGGGGCCGG - Intronic
1044409229 8:91866905-91866927 GAGGCGCAAGCGGTGGTGGCAGG + Intergenic
1045505380 8:102774464-102774486 GGGGGGCACCAGGTGGAGATGGG + Intergenic
1046618385 8:116501793-116501815 GGGGTACAACAGGTAGAGGCCGG - Intergenic
1048499724 8:134964626-134964648 GATGGGCTAAAGGTGGGGGCCGG + Intergenic
1049164459 8:141117644-141117666 GCGGGCCCCCAGGTGGAGGCAGG - Intronic
1049260732 8:141637713-141637735 TAGGGAGAGCAGGTGGAGGCAGG + Intergenic
1049440302 8:142606539-142606561 GAGGAACAACAGGAGGGGGCAGG - Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1051357710 9:16254892-16254914 GAGGAGGAAGAGGTGGAGGAAGG + Intronic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1053146772 9:35717385-35717407 CAAGAGCAACTGGTGGAGGCTGG - Exonic
1053459449 9:38257401-38257423 GAGGAGGAAGAGGTGGAGCCGGG - Intergenic
1055676850 9:78672014-78672036 GAAGGGGAAGAGGTGGAGGGGGG - Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056799298 9:89680374-89680396 GATGGGAAAAAGGTGGAAGCTGG + Intergenic
1057427731 9:94967234-94967256 AAGAGGCTACAGATGGAGGCAGG + Intronic
1057511547 9:95683849-95683871 AAGGTGCAACAGGTGGACCCTGG + Intergenic
1060222762 9:121773300-121773322 GGGGGGCAGGAGGTGGCGGCGGG - Exonic
1061360445 9:130138514-130138536 GAGGAGAAAGAGGTGGAGGAGGG - Exonic
1061385039 9:130284765-130284787 GAGGAGGGAGAGGTGGAGGCTGG - Intronic
1061636873 9:131917009-131917031 AAGGGGCAGCAGGTGGAGAAGGG + Intronic
1061865706 9:133490898-133490920 GAGGAGGAAAAGGTGGAGGAGGG + Intergenic
1061865725 9:133490962-133490984 GAGGAGCAAAAGGTGGAGGAGGG + Intergenic
1062295564 9:135823706-135823728 GTGTGGCAGCAGGTGGAGTCAGG - Intronic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1062576726 9:137212313-137212335 GATGGGCACCGGGAGGAGGCAGG - Intronic
1062612532 9:137381553-137381575 GACGGGCAGGAGGAGGAGGCAGG - Intronic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1203787417 EBV:135705-135727 GAGGGGATCCAGGTGAAGGCAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1187427120 X:19188039-19188061 AAGGGGCCCCAGGTGGAGGAGGG - Intergenic
1189041119 X:37542939-37542961 GGGGGGCTCCGGGTGGAGGCTGG + Intronic
1189526064 X:41823276-41823298 GATAGGCAGCAGGTGGAGGGTGG - Intronic
1191936718 X:66434910-66434932 GGGGGGCAATGGGTGGAGGTGGG + Intergenic
1192126237 X:68503305-68503327 TAAGGGGAACAGGTAGAGGCAGG - Intronic
1192139554 X:68636055-68636077 GAGGGGTAGAGGGTGGAGGCTGG + Intergenic
1192929076 X:75785550-75785572 GAGGAGCAGAAGGTGGAGGAAGG + Intergenic
1200019427 X:153189396-153189418 GAGTAGCAAAAGGTGGAGGAAGG - Intergenic
1200098490 X:153675346-153675368 GAGGGGCAGCAGATGGAAACTGG + Intronic
1201622039 Y:15970157-15970179 TAAGGGCACCAGGTGGAGGAGGG - Intergenic