ID: 1142799725

View in Genome Browser
Species Human (GRCh38)
Location 17:2337599-2337621
Sequence GGCTCAGCGCCCCACGCGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 65}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142799725_1142799731 -1 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799731 17:2337621-2337643 CGAGAGGCGCGGAGGCGGCGAGG 0: 1
1: 0
2: 1
3: 32
4: 375
1142799725_1142799729 -6 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799729 17:2337616-2337638 TGAGCCGAGAGGCGCGGAGGCGG 0: 1
1: 0
2: 1
3: 10
4: 172
1142799725_1142799728 -9 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799728 17:2337613-2337635 CGCTGAGCCGAGAGGCGCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1142799725_1142799736 8 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799736 17:2337630-2337652 CGGAGGCGGCGAGGGCGCGGGGG 0: 1
1: 2
2: 10
3: 112
4: 841
1142799725_1142799735 7 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799735 17:2337629-2337651 GCGGAGGCGGCGAGGGCGCGGGG 0: 1
1: 1
2: 13
3: 126
4: 982
1142799725_1142799732 0 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799732 17:2337622-2337644 GAGAGGCGCGGAGGCGGCGAGGG 0: 1
1: 0
2: 1
3: 59
4: 410
1142799725_1142799733 5 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799733 17:2337627-2337649 GCGCGGAGGCGGCGAGGGCGCGG 0: 1
1: 0
2: 10
3: 125
4: 851
1142799725_1142799734 6 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799734 17:2337628-2337650 CGCGGAGGCGGCGAGGGCGCGGG 0: 1
1: 0
2: 9
3: 95
4: 913
1142799725_1142799738 25 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799738 17:2337647-2337669 CGGGGGCTCTGAGGACCGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166
1142799725_1142799737 16 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799737 17:2337638-2337660 GCGAGGGCGCGGGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142799725 Original CRISPR GGCTCAGCGCCCCACGCGCA AGG (reversed) Exonic