ID: 1142799732

View in Genome Browser
Species Human (GRCh38)
Location 17:2337622-2337644
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142799725_1142799732 0 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799732 17:2337622-2337644 GAGAGGCGCGGAGGCGGCGAGGG 0: 1
1: 0
2: 1
3: 59
4: 410
1142799724_1142799732 3 Left 1142799724 17:2337596-2337618 CCGCCTTGCGCGTGGGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1142799732 17:2337622-2337644 GAGAGGCGCGGAGGCGGCGAGGG 0: 1
1: 0
2: 1
3: 59
4: 410
1142799720_1142799732 27 Left 1142799720 17:2337572-2337594 CCGGGAGCGCGGCGGGCGGGGGC 0: 1
1: 0
2: 6
3: 100
4: 655
Right 1142799732 17:2337622-2337644 GAGAGGCGCGGAGGCGGCGAGGG 0: 1
1: 0
2: 1
3: 59
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type