ID: 1142799733

View in Genome Browser
Species Human (GRCh38)
Location 17:2337627-2337649
Sequence GCGCGGAGGCGGCGAGGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 0, 2: 10, 3: 125, 4: 851}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142799725_1142799733 5 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799733 17:2337627-2337649 GCGCGGAGGCGGCGAGGGCGCGG 0: 1
1: 0
2: 10
3: 125
4: 851
1142799724_1142799733 8 Left 1142799724 17:2337596-2337618 CCGCCTTGCGCGTGGGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1142799733 17:2337627-2337649 GCGCGGAGGCGGCGAGGGCGCGG 0: 1
1: 0
2: 10
3: 125
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142799733 Original CRISPR GCGCGGAGGCGGCGAGGGCG CGG Exonic