ID: 1142799734 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:2337628-2337650 |
Sequence | CGCGGAGGCGGCGAGGGCGC GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1018 | |||
Summary | {0: 1, 1: 0, 2: 9, 3: 95, 4: 913} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142799724_1142799734 | 9 | Left | 1142799724 | 17:2337596-2337618 | CCGCCTTGCGCGTGGGGCGCTGA | 0: 1 1: 0 2: 0 3: 3 4: 39 |
||
Right | 1142799734 | 17:2337628-2337650 | CGCGGAGGCGGCGAGGGCGCGGG | 0: 1 1: 0 2: 9 3: 95 4: 913 |
||||
1142799725_1142799734 | 6 | Left | 1142799725 | 17:2337599-2337621 | CCTTGCGCGTGGGGCGCTGAGCC | 0: 1 1: 0 2: 1 3: 5 4: 65 |
||
Right | 1142799734 | 17:2337628-2337650 | CGCGGAGGCGGCGAGGGCGCGGG | 0: 1 1: 0 2: 9 3: 95 4: 913 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142799734 | Original CRISPR | CGCGGAGGCGGCGAGGGCGC GGG | Exonic | ||