ID: 1142799737

View in Genome Browser
Species Human (GRCh38)
Location 17:2337638-2337660
Sequence GCGAGGGCGCGGGGGCTCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142799730_1142799737 -5 Left 1142799730 17:2337620-2337642 CCGAGAGGCGCGGAGGCGGCGAG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1142799737 17:2337638-2337660 GCGAGGGCGCGGGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 360
1142799725_1142799737 16 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799737 17:2337638-2337660 GCGAGGGCGCGGGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 360
1142799724_1142799737 19 Left 1142799724 17:2337596-2337618 CCGCCTTGCGCGTGGGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1142799737 17:2337638-2337660 GCGAGGGCGCGGGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142799737 Original CRISPR GCGAGGGCGCGGGGGCTCTG AGG Exonic