ID: 1142799738

View in Genome Browser
Species Human (GRCh38)
Location 17:2337647-2337669
Sequence CGGGGGCTCTGAGGACCGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142799725_1142799738 25 Left 1142799725 17:2337599-2337621 CCTTGCGCGTGGGGCGCTGAGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1142799738 17:2337647-2337669 CGGGGGCTCTGAGGACCGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166
1142799724_1142799738 28 Left 1142799724 17:2337596-2337618 CCGCCTTGCGCGTGGGGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1142799738 17:2337647-2337669 CGGGGGCTCTGAGGACCGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166
1142799730_1142799738 4 Left 1142799730 17:2337620-2337642 CCGAGAGGCGCGGAGGCGGCGAG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1142799738 17:2337647-2337669 CGGGGGCTCTGAGGACCGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142799738 Original CRISPR CGGGGGCTCTGAGGACCGCT CGG Exonic