ID: 1142803065 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:2357031-2357053 |
| Sequence | AGATGCTGATGGAATCCTAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 144 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 130} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142803065_1142803072 | 25 | Left | 1142803065 | 17:2357031-2357053 | CCCATAGGATTCCATCAGCATCT | 0: 1 1: 0 2: 2 3: 11 4: 130 |
||
| Right | 1142803072 | 17:2357079-2357101 | TGTTAGGCTGCAGAACTTGATGG | 0: 1 1: 0 2: 0 3: 22 4: 166 |
||||
| 1142803065_1142803070 | 9 | Left | 1142803065 | 17:2357031-2357053 | CCCATAGGATTCCATCAGCATCT | 0: 1 1: 0 2: 2 3: 11 4: 130 |
||
| Right | 1142803070 | 17:2357063-2357085 | AGCCGTGTGTAGCATTTGTTAGG | 0: 1 1: 0 2: 0 3: 5 4: 55 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142803065 | Original CRISPR | AGATGCTGATGGAATCCTAT GGG (reversed) | Intronic | ||