ID: 1142803065

View in Genome Browser
Species Human (GRCh38)
Location 17:2357031-2357053
Sequence AGATGCTGATGGAATCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803065_1142803070 9 Left 1142803065 17:2357031-2357053 CCCATAGGATTCCATCAGCATCT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1142803065_1142803072 25 Left 1142803065 17:2357031-2357053 CCCATAGGATTCCATCAGCATCT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803065 Original CRISPR AGATGCTGATGGAATCCTAT GGG (reversed) Intronic