ID: 1142803066

View in Genome Browser
Species Human (GRCh38)
Location 17:2357032-2357054
Sequence CAGATGCTGATGGAATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803066_1142803072 24 Left 1142803066 17:2357032-2357054 CCATAGGATTCCATCAGCATCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803066_1142803070 8 Left 1142803066 17:2357032-2357054 CCATAGGATTCCATCAGCATCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803066 Original CRISPR CAGATGCTGATGGAATCCTA TGG (reversed) Intronic