ID: 1142803066 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:2357032-2357054 |
| Sequence | CAGATGCTGATGGAATCCTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 151 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 140} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142803066_1142803072 | 24 | Left | 1142803066 | 17:2357032-2357054 | CCATAGGATTCCATCAGCATCTG | 0: 1 1: 0 2: 0 3: 10 4: 140 |
||
| Right | 1142803072 | 17:2357079-2357101 | TGTTAGGCTGCAGAACTTGATGG | 0: 1 1: 0 2: 0 3: 22 4: 166 |
||||
| 1142803066_1142803070 | 8 | Left | 1142803066 | 17:2357032-2357054 | CCATAGGATTCCATCAGCATCTG | 0: 1 1: 0 2: 0 3: 10 4: 140 |
||
| Right | 1142803070 | 17:2357063-2357085 | AGCCGTGTGTAGCATTTGTTAGG | 0: 1 1: 0 2: 0 3: 5 4: 55 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142803066 | Original CRISPR | CAGATGCTGATGGAATCCTA TGG (reversed) | Intronic | ||