ID: 1142803068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:2357042-2357064 |
Sequence | CTGGAGACCACAGATGCTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 416 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 47, 4: 364} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142803068_1142803072 | 14 | Left | 1142803068 | 17:2357042-2357064 | CCATCAGCATCTGTGGTCTCCAG | 0: 1 1: 0 2: 4 3: 47 4: 364 |
||
Right | 1142803072 | 17:2357079-2357101 | TGTTAGGCTGCAGAACTTGATGG | 0: 1 1: 0 2: 0 3: 22 4: 166 |
||||
1142803068_1142803070 | -2 | Left | 1142803068 | 17:2357042-2357064 | CCATCAGCATCTGTGGTCTCCAG | 0: 1 1: 0 2: 4 3: 47 4: 364 |
||
Right | 1142803070 | 17:2357063-2357085 | AGCCGTGTGTAGCATTTGTTAGG | 0: 1 1: 0 2: 0 3: 5 4: 55 |
||||
1142803068_1142803073 | 22 | Left | 1142803068 | 17:2357042-2357064 | CCATCAGCATCTGTGGTCTCCAG | 0: 1 1: 0 2: 4 3: 47 4: 364 |
||
Right | 1142803073 | 17:2357087-2357109 | TGCAGAACTTGATGGCTTTGAGG | 0: 1 1: 0 2: 0 3: 19 4: 267 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142803068 | Original CRISPR | CTGGAGACCACAGATGCTGA TGG (reversed) | Intronic | ||