ID: 1142803068

View in Genome Browser
Species Human (GRCh38)
Location 17:2357042-2357064
Sequence CTGGAGACCACAGATGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803068_1142803072 14 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803068_1142803070 -2 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1142803068_1142803073 22 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803073 17:2357087-2357109 TGCAGAACTTGATGGCTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803068 Original CRISPR CTGGAGACCACAGATGCTGA TGG (reversed) Intronic