ID: 1142803070

View in Genome Browser
Species Human (GRCh38)
Location 17:2357063-2357085
Sequence AGCCGTGTGTAGCATTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803065_1142803070 9 Left 1142803065 17:2357031-2357053 CCCATAGGATTCCATCAGCATCT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1142803068_1142803070 -2 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1142803066_1142803070 8 Left 1142803066 17:2357032-2357054 CCATAGGATTCCATCAGCATCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1142803070 17:2357063-2357085 AGCCGTGTGTAGCATTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803070 Original CRISPR AGCCGTGTGTAGCATTTGTT AGG Intronic