ID: 1142803071

View in Genome Browser
Species Human (GRCh38)
Location 17:2357065-2357087
Sequence AGCCTAACAAATGCTACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803071_1142803077 14 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803077 17:2357102-2357124 CTTTGAGGTCACATCGGGGCTGG 0: 1
1: 0
2: 2
3: 9
4: 81
1142803071_1142803080 30 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803080 17:2357118-2357140 GGGCTGGTGAAGGGAGCCCCAGG 0: 1
1: 0
2: 5
3: 69
4: 460
1142803071_1142803074 8 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803074 17:2357096-2357118 TGATGGCTTTGAGGTCACATCGG 0: 1
1: 0
2: 2
3: 18
4: 157
1142803071_1142803079 21 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803079 17:2357109-2357131 GTCACATCGGGGCTGGTGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 107
1142803071_1142803076 10 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803076 17:2357098-2357120 ATGGCTTTGAGGTCACATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1142803071_1142803078 20 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803078 17:2357108-2357130 GGTCACATCGGGGCTGGTGAAGG 0: 1
1: 0
2: 2
3: 4
4: 128
1142803071_1142803073 -1 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803073 17:2357087-2357109 TGCAGAACTTGATGGCTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 267
1142803071_1142803072 -9 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803071_1142803075 9 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803075 17:2357097-2357119 GATGGCTTTGAGGTCACATCGGG 0: 1
1: 0
2: 1
3: 18
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803071 Original CRISPR AGCCTAACAAATGCTACACA CGG (reversed) Intronic