ID: 1142803072

View in Genome Browser
Species Human (GRCh38)
Location 17:2357079-2357101
Sequence TGTTAGGCTGCAGAACTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803065_1142803072 25 Left 1142803065 17:2357031-2357053 CCCATAGGATTCCATCAGCATCT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803069_1142803072 -5 Left 1142803069 17:2357061-2357083 CCAGCCGTGTGTAGCATTTGTTA 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803068_1142803072 14 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803066_1142803072 24 Left 1142803066 17:2357032-2357054 CCATAGGATTCCATCAGCATCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166
1142803071_1142803072 -9 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803072 17:2357079-2357101 TGTTAGGCTGCAGAACTTGATGG 0: 1
1: 0
2: 0
3: 22
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803072 Original CRISPR TGTTAGGCTGCAGAACTTGA TGG Intronic