ID: 1142803073

View in Genome Browser
Species Human (GRCh38)
Location 17:2357087-2357109
Sequence TGCAGAACTTGATGGCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803068_1142803073 22 Left 1142803068 17:2357042-2357064 CCATCAGCATCTGTGGTCTCCAG 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1142803073 17:2357087-2357109 TGCAGAACTTGATGGCTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 267
1142803069_1142803073 3 Left 1142803069 17:2357061-2357083 CCAGCCGTGTGTAGCATTTGTTA 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1142803073 17:2357087-2357109 TGCAGAACTTGATGGCTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 267
1142803071_1142803073 -1 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803073 17:2357087-2357109 TGCAGAACTTGATGGCTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803073 Original CRISPR TGCAGAACTTGATGGCTTTG AGG Intronic