ID: 1142803075

View in Genome Browser
Species Human (GRCh38)
Location 17:2357097-2357119
Sequence GATGGCTTTGAGGTCACATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803069_1142803075 13 Left 1142803069 17:2357061-2357083 CCAGCCGTGTGTAGCATTTGTTA 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1142803075 17:2357097-2357119 GATGGCTTTGAGGTCACATCGGG 0: 1
1: 0
2: 1
3: 18
4: 134
1142803071_1142803075 9 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803075 17:2357097-2357119 GATGGCTTTGAGGTCACATCGGG 0: 1
1: 0
2: 1
3: 18
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803075 Original CRISPR GATGGCTTTGAGGTCACATC GGG Intronic