ID: 1142803076

View in Genome Browser
Species Human (GRCh38)
Location 17:2357098-2357120
Sequence ATGGCTTTGAGGTCACATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142803071_1142803076 10 Left 1142803071 17:2357065-2357087 CCGTGTGTAGCATTTGTTAGGCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1142803076 17:2357098-2357120 ATGGCTTTGAGGTCACATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1142803069_1142803076 14 Left 1142803069 17:2357061-2357083 CCAGCCGTGTGTAGCATTTGTTA 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1142803076 17:2357098-2357120 ATGGCTTTGAGGTCACATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142803076 Original CRISPR ATGGCTTTGAGGTCACATCG GGG Intronic