ID: 1142803079 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:2357109-2357131 |
Sequence | GTCACATCGGGGCTGGTGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 113 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 107} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142803069_1142803079 | 25 | Left | 1142803069 | 17:2357061-2357083 | CCAGCCGTGTGTAGCATTTGTTA | 0: 1 1: 0 2: 0 3: 11 4: 84 |
||
Right | 1142803079 | 17:2357109-2357131 | GTCACATCGGGGCTGGTGAAGGG | 0: 1 1: 0 2: 1 3: 4 4: 107 |
||||
1142803071_1142803079 | 21 | Left | 1142803071 | 17:2357065-2357087 | CCGTGTGTAGCATTTGTTAGGCT | 0: 1 1: 0 2: 0 3: 13 4: 160 |
||
Right | 1142803079 | 17:2357109-2357131 | GTCACATCGGGGCTGGTGAAGGG | 0: 1 1: 0 2: 1 3: 4 4: 107 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142803079 | Original CRISPR | GTCACATCGGGGCTGGTGAA GGG | Intronic | ||